Application of cassava common mosaic virus CP in down-regulation of MeGRXC3

Abstract

The invention provides an application of a CP gene, or a protein encoded by the CP gene, or a recombinant vector or host bacteria containing a CP gene coding region in down-regulation of the MeGRXC3 expression level. Researches find that CP and MeGRXC3 interact with each other, so that the growth ability of yeast in an SD / -Leu / -Trp / -His / -Ade auxotrophic culture medium can be improved, cell autophagy can be activated, the expression of MeGRXC3 can be down-regulated, and the active oxygen content of plant tissues co-expressed with MeGRXC3 can be increased. Research results lay a theoretical foundation for breeding of common cassava mosaic virus disease resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of cassava common mosaic virus CP in down-regulating MeGRXC3. Background Art

[0002] Cassava (Manihot esculenta) is a perennial crop of the Euphorbiaceae family, mainly planted in tropical and subtropical countries and regions. It is the sixth largest food crop in the world, and related industries play an important role in the agricultural economy. Cassava mosaic virus disease has a devastating impact on the cassava industry. Globally, the annual loss of cassava production due to mosaic disease can reach 25 million tons, affecting the food security of more than 500 million people. Among them, cassava common mosaic virus (CsCMV) is a virus of the genus Potexvirus in the family Alphaflexiviridae. CsCMV was first reported in southern Brazil. CsCMV has the typical molecular characteristics of Potexvirus viruses. It is a single-component positive-sense ssRNA (+) flexuous virus, and the virus particle size is about 15 nm × 495 nm. The genome size is about 6.4 kb, with a cap structure and a poly (A) tail at the 5′ end and 3′ end respectively, producing 3 subgenomic RNAs (sgRNAs), containing 5 open reading frames (ORFs): ORF1 at the 5′ end encodes an RNA-dependent RNA polymerase (RdRp) essential for virus replication with a molecular weight of 165 kD; the middle 3 ORFs, ORF2, ORF3, and ORF4, encode three overlapping triple gene block proteins (TGBs), namely CP with a molecular weight of 25 kD, TGBp2 with a molecular weight of 12 kD, and TGBp3 with a molecular weight of 10 kD; ORF5 at the 3′ end encodes a coat protein (CP) with a molecular weight of 24 kD. Among them, ORF1 is directly translated from the viral genomic RNA, and other ORFs are translated from sgRNAs. Research shows that RdRp is the only viral protein absolutely required for virus replication, and CP-3 and CP are necessary for virus cell-to-cell or long-distance movement. At present, there are few research reports on CsCMV at home and abroad, and it is still in the stage of detection and identification. The host range, transmission vector, gene function, etc. of CsCMV are not clear, and in-depth research on it is urgently needed. The present invention discovers that CP interacts with cassava glutaredoxin 3 (MeGRXC3) and down-regulates its expression, as well as increases the content of reactive oxygen species in plant tissues co-expressed with MeGRXC3. Summary of the Invention

[0003] The object of the present invention is to overcome the deficiencies in the prior art and provide the application of cassava common mosaic virus CP in down-regulating MeGRXC3 and increasing the content of reactive oxygen species in plant tissues co-expressed with MeGRXC3.

[0004] The first aspect of the present invention is to provide the application of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in down-regulating the expression level of MeGRXC3.

[0005] Among them, the nucleotide sequence of the CP gene is shown as SEQ ID NO:1.

[0006] Among them, the nucleotide sequence of the gene corresponding to MeGRXC3 is shown as SEQ ID NO:2.

[0007] The second aspect of the present invention is to provide the application of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in the interaction with MeGRXC3.

[0008] Among them, the interaction between CP and MeGRXC3 leads to the down-regulation of the expression level of MeGRXC3.

[0009] Among them, the interaction between CP and MeGRXC3 increases the content of reactive oxygen species in plant tissues.

[0010] Among them, the interaction between CP and MeGRXC3 improves the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutritional defective medium.

[0011] Among them, the interaction between CP and MeGRXC3 improves the autophagic flux of tobacco leaves.

[0012] The third aspect of the present invention is to provide the application of the CP gene and the gene corresponding to MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the gene corresponding to MeGRXC3, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the gene corresponding to MeGRXC3 in increasing the content of reactive oxygen species in plant tissues.

[0013] The fourth aspect of the present invention is to provide the application of the CP gene and the gene corresponding to MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the gene corresponding to MeGRXC3, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the gene corresponding to MeGRXC3 in improving the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutritional defective medium.

[0014] The fifth aspect of the present invention is to provide the application of the CP gene and the corresponding gene of MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the corresponding gene of MeGRXC3, or the recombinant vector or host bacterium containing the coding region of the CP gene and the recombinant vector or host bacterium containing the coding region of the corresponding gene of MeGRXC3 in improving the autophagic flux in tobacco leaves.

[0015] The present invention's research found that there is an interaction between CP and MeGRXC3, which can improve the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutritional defective medium, activate autophagy, and can down-regulate the expression of MeGRXC3 to increase the reactive oxygen species content in plant tissues co-expressed with MeGRXC3. The research results will lay a theoretical foundation for the disease resistance breeding of cassava common mosaic virus. Brief Description of the Drawings

[0016] Figure 1 Yeast interaction of pGADT7-CP and pGBKT7-MeGRXC3. SD-LW: SD-LW / -Leu / -Trp medium; SD-LWHA: SD-LWHA / -Ade / -His / -Leu / -Trp medium.

[0017] Figure 2 BiFC was used to verify the interaction between CP protein and MeGRXC3 protein in tobacco. Upper panel: Tobacco was co-injected with MeGRXC3-FYP, p1300-YNs and the nuclear localization marker H2B-RFP; Lower panel: Tobacco was co-injected with MeGRXC3-FYC, YNs-CP and the nuclear localization marker H2B-RFP.

[0018] Figure 3 Fluorescence observation on the 5th day after co-expression of MeGRXC3-GFP and different concentrations of YNs-CP.

[0019] Figure 4 Western Blot was used to detect the accumulation level of MeGRXC protein on the 5th day after infiltrating Nicotiana benthamiana leaves with MeGRXC3-GFP and Vec and CP-Flag respectively. MeGRXC3-GFP: Plant expression vector expressing MeGRXC3-GFP; Vec: Empty vector; CP-Flag: CP with Flag tag Flag: Flag antibody; GFP: GFP antibody; Rubisco: Rubisco Coomassie brilliant blue staining.

[0020] Figure 5To detect the effect of CP on the reactive oxygen species in leaf tissues co-expressed with MeGRXC3 by laser scanning imaging (left) and DAB staining observation (right). p1300-Flag + CP-GFP: Co-infiltration of Nicotiana benthamiana leaves with the empty vector and CP-GFP; p1300-Flag + pG1300: Co-infiltration of Nicotiana benthamiana leaves with the empty vector and the pG1300 vector expressing only GFP; MeGRXC3-Flag + CP-GFP: Co-infiltration of Nicotiana benthamiana leaves with MeGRXC3-Flag and CP-GFP; MeGRXC3-Flag + pG1300: Co-infiltration of Nicotiana benthamiana leaves with MeGRXC3-Flag and the pG1300 vector expressing only GFP.

[0021] Figure 6 For the effect of co-expression of MeGRXC3-RFP and CP-Flag on autophagic flux. Confocal microscopy observation (upper figure) and autophagosome statistics (lower figure) on the 4th day after infiltration of Nicotiana benthamiana leaves with MeGRXC3-RFP and GFP-AtATG8 with the empty vector or CP-Flag with the empty vector and CP-GFP respectively. Detailed implementation manners

[0022] The present invention will be further described below with reference to the accompanying drawings in combination with specific embodiments for better understanding of the present invention. For those not specified in the embodiments in terms of specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments not specified in terms of the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0023] 1 Experimental materials Seeds of Nicotiana benthamiana ( Nicotiana benthamiana ), yeast two-hybrid expression vectors pGADT7, pGBKT7-Lam, pGADT7-T, pGBKT7-53, pGBKT7-MeGRXC3, and plant expression vectors p1300-YNs, YNs-CP, FYC-MeGRXC3, MeGRXC3-RFP, pZP-P19 are all stored in the laboratory. Restriction endonuclease BamH I, EcoTool enzymes such as R Ⅰ were purchased from Baori Biotechnology (Beijing) Co., Ltd.; the high-efficiency seamless cloning kit was purchased from Mona Biotechnology Co., Ltd.; the agarose gel DNA kit and the agarose gel recovery kit were purchased from Shanghai Yihui Biotechnology Co., Ltd.; Escherichia coli DH5α, Agrobacterium competent GV3101 and yeast competent AH109 were all purchased from Shanghai Weidi Biotechnology Co., Ltd.; LB medium was purchased from Shanghai Shengong Biological Engineering Co., Ltd.; the plasmid mini-prep midium kit and DNA Marker were purchased from Beijing Tiangen Biochemical Co., Ltd.; SD / -Trp / -Leu (SD-LW), SD / -Trp / -Leu / -His / -Ade (SD-LWHA) media were all purchased from Beijing Coolaber Technology Co., Ltd.; kanamycin ( Kanamycin ), ampicillin ( Ampicillin ), rifampicin ( Rifampicin were purchased from Beijing Suobolai Technology Co., Ltd.; spectinomycin ( Spectinomycin ) was purchased from Shanghai Yisheng Biotechnology Co., Ltd.

[0024] 2 Experimental methods and results

[0025] 2.1 Construction of expression vectors (1) Construction of yeast expression vector AD-CP Using pCsCMV as a template, the target fragment CPEB (specific sequence is shown in Table 2) was amplified with primers CP-1F EcoRI and CP-687R BamHI (the specific sequences of the primers are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and then ligated to the large fragment of the yeast expression vector pGADT7 digested with the same double enzymes. The ligation product was transformed into Escherichia coli. After the positive clone was identified as correct by sequencing, it was named AD-CP (also known as pGADT7-CP).

[0026] (2) Construction of yeast expression vector BD-MeGRXC3 Shanghai Shengong Biological Engineering Co., Ltd. was commissioned to artificially synthesize the target fragment MeGRXC3-EcoRI & BamHI (specific sequence is shown in Table 2) with restriction endonucleases EcoRI and BamHI added to both ends. The target fragment was double-digested with EcoRI and BamHI and then ligated to the large fragment of pGBKT7 digested with the same double enzymes. The ligation product was transformed into Escherichia coli. After the positive clone was identified as correct by sequencing, it was named BD-MeGRXC3 (also known as pGBKT7-MeGRXC3).

[0027] (3) Construction of plant expression vector YNs-CP Using pCsCMV as a template, the target fragment CPMK (specific sequence shown in Table 2) was amplified with primers CP-1F MluI and CP-687R KpnI (specific sequences shown in Table 1). After double digestion of the PCR product with MluI and KpnI, it was ligated to the large fragment of the plant expression vector p1300-YNs (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Research on the Interaction between AC4 Protein of Cassava Mosaic Virus and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) that had been digested with the same two enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named YNs-CP after being correctly identified by sequencing.

[0028] (4)Construction of the plant expression vector CP-GFP Using pCsCMV as a template, the target fragment CPSK (specific sequence shown in Table 2) was amplified with primers CP-1F SpeI and CP-687R KpnI (specific sequences shown in Table 1). After double digestion of the PCR product with SpeII and KpnI, it was ligated to the large fragment of the plant expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been digested with the same two enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named CP-GFP after being correctly identified by sequencing.

[0029] (5)The construction method of the plant expression vector MeGRXC3-YC is as follows: The target fragment MeGRXC3-SpeI&KpnI with restriction endonucleases SpeI and KpnI added to both ends was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. (the specific sequence is shown in Table 2), and double digested with SpeI and KpnI and ligated with the large fragment of p1300-FYC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) digested with the same double enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named MeGRXC3-YC after being correctly identified by sequencing.

[0030] (6)The construction method of the plant expression vector MeGRXC3-GFP is as follows: The above synthesized target fragment MeGRXC3-SpeI & KpnI was double digested with SpeI and KpnI and ligated with the large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) digested with the same double enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named MeGRXC3-GFP after being correctly identified by sequencing.

[0031] (7)The construction method of the plant expression vector MeGRXC3-RFP is as follows: The synthesized target fragment MeGRXC3-SpeI & KpnI was double-digested with SpeI and KpnI and ligated to the large fragment of pR1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been digested with the same two enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named MeGRXC3-RFP after being correctly identified by sequencing.

[0032] (8)The construction method of the empty vector p1300-Flag is as follows: The target fragment Flag-XbaI & SacI (the specific sequence is shown in Table 2) with restriction endonucleases XbaI and SacI added to both ends was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. and double-digested with XbaI and SacI and ligated to the large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been digested with the same two enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-Flag after being correctly identified by sequencing.

[0033] (9)The construction method of the plant expression vector CP-Flag is as follows: Using pCsCMV as a template, the target fragment CPXB (specific sequence shown in Table 2) was amplified with primers CP-1F XbaI and CP-687R BamHI (specific sequences shown in Table 1). The target fragment CPXB was double-digested with XbaI & BamHI and ligated to the large fragment of p1300-Flag that had been successfully constructed with the same double digestion. The ligation product was transformed into Escherichia coli, and after the positive clone was correctly identified by sequencing, it was named CP-Flag.

[0034] (10) The method for constructing the plant expression vector MeGRXC3-Flag is as follows: Entrust Shanghai Sangon Biotech Co., Ltd. to artificially synthesize the target fragment MeGRXC3-XbaI & BamHI (specific sequence shown in Table 2) with restriction endonucleases XbaI & BamHI added to both ends, and double-digest it with XbaI & BamHI and ligate it to the large fragment of p1300-Flag that had been successfully constructed with the same double digestion. The ligation product was transformed into Escherichia coli, and after the positive clone was correctly identified by sequencing, it was named MeGRXC3-Flag.

[0035] (11) The method for constructing the plant expression vector GFP-MeATG8f is as follows: Entrust Shanghai Sangon Biotech Co., Ltd. to artificially synthesize the target fragment MeATG8f-SpeI & SacI (specific sequence shown in Table 2) with restriction endonucleases SpeI & SacI added to both ends, and double-digest it with SpeI & SacI and ligate it to the large fragment of GFP-AtATG8 (Liu X, Kong H, Liu L, Xie Q, Fu Y, Yu X, Li W, RenY, Ruan M, Zhang X. Sri Lankan cassava mosaic virus Silencing Suppressor AC4Mediates Autophagic Degradation of SGS3 / RDR6 Bodies in Plants. Plant CellEnviron. 2025 Apr 3. doi: 10.1111 / pce.15511) that had been double-digested in the same way. The ligation product was transformed into Escherichia coli, and after the positive clone was correctly identified by sequencing, it was named GFP-MeATG8f.

[0036] Table 1 Primers used Primer Name Sequence CP-1F EcoRI <![CDATA GAATTC ATGGCCACCCCCACCTCAACCA]]> CP-1F XbaI <![CDATA TCTAGA ATGGCCACCCCCACCTCAACCA]]> CP-687R BamHI <![CDATA GGATCC TCACTCATCCACCCCTGTGAGGAAC]]> CP-1F MluI <![CDATA ACGCGT ATGGCCACCCCCACCTCAACCA]]> CP-687R KpnI <![CDATA GGTACC CTCATCCACCCCTGTGAGGAAC]]> CP-1F SpeI <![CDATA ACTAGT ATGGCCACCCCCACCTCAACCA]]> Table 2 Target fragment sequences Fragment Name Sequence (5′–3′) CPEB <![CDATA GAATTC ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAGGGATCC <!-- 6 -->]]> CPMK <![CDATA ACGCGT ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGTACC <!-- 7 -->]]> CPSK <![CDATA ACTAGT ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGTACC <!-- 8 -->]]> CPXB <![CDATA TCTAGA ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGATCC > MeGRXC3-EcoRI & BamHI GAATTCATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATTAGGGATCC MeGRXC3-SpeI& KpnI ACTAGTATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGTACC Flag-BamHI & SacI GGATCCACGCGTATGgactacaaggacgacgatgacaaggattacaaagatgacgacgataaggactataaggacgatgatgataaatagTAAGAGCTC MeGRXC3 - XbaI & BamHI TCTAGAATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGATCC MeATG8f - SpeI & SacI ACTAGTATGGCAAGGAGCGGCTTCAAGCTAGAGCATGATTTTGAGAAGAGGCGCGCTGAGGCTGCAAGAATTAGGGATAAGTACCCAGATAGAATTCCGGTAATTGTGGAGAAGGCTGAGAGAAGTGATATTCCCACCATTGACAAGAAAAAATACCTAGTCCCAGCTGATCTGACAGTGGGTCAGTTTGTGTATGTAATCCGGAAGAGAATTAAACTGAGCGCAGAAAAGGCTATTTTCATATTTGTGGACAATGTACTCCCACCAACAGGAGCAGTAATGTCAACAATTTACGATGAAAAGAAGGATGCAGATGGATTTCTGTATGTGACATACAGCGGTGAGAACACCTTTGGGAGAGCAGATGCTGCTGTTGCTCAAGGCGGACTATAAGAGCTC

[0037] 2.2 Yeast two-hybrid assay to identify the interaction between CP and MeGRXC3 For ease of description, during the co-transformation process, the "pGADT7" vector was abbreviated as "AD", and the "pGBKT7" vector was abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-lam (pGBKT7-lam), and BD-53 (pGBKT7-53) (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) were all stored in this laboratory.

[0038] Table 3 Pairing combinations of yeast bait plasmids and prey plasmids Combination Bait vector Prey vector 1 (Positive control) pGADT7 - T pGBKT7 - 53 2 (Negative control) pGADT7 - T pGBKT7 - lam 3 pGBKT7 - MeGRXC3 pGADT7 - CP 4 pGADT7 - CP pGBKT7 5 pGBKT7 - MeGRXC3 pGADT7 - T After co-transforming different yeast expression vectors into yeast competent cells according to Table 3, single colonies identified as positive by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. The suspension was serially diluted 10-fold, 100-fold, and 1000-fold with sterile water. Then, 2 μL of each dilution was inoculated into SD / -Leu / -Trp (SD-LW) and SD / -Leu / -Trp / -His / -Ade (SD-LWHA) auxotrophic media. Yeast co-transformed with AD-T and BD-Lam and yeast co-transformed with AD-T and BD-53 were used as negative and positive controls, respectively. The yeast cell suspensions transformed with the target plasmids were also inoculated onto solid media and incubated upside down in a 28°C incubator for 3 d to observe and record the growth status.

[0039] The results of the yeast two-hybrid study are as Figure 1 shown. All co-transformed yeasts could grow normally in the SD-LW auxotrophic medium, but only the yeast positive control and the yeast co-transformed with pGADT7-CP and pGBKT7-MeGRXC3 could grow normally in the SD-LWHA auxotrophic medium. The negative control and the yeasts co-transformed with pGADT7-CP and pGBKT7 or pGBKT7-MeGRXC3 and pGADT7 could not grow normally. The results indicate that there is an interaction between CP and MeGRXXC3 in yeast cells.

[0040] 2.3 Identification of the interaction between CP and MeGRXC3 by bimolecular fluorescence The BiFC vector p1300-YNs (Liu, L., Zhao, P., Fu, Y., et al. Study on the interaction between AC4 protein of cassava mosaic virus and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) and the nuclear localization red fluorescent protein vector H2B-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) are both stored in this laboratory.

[0041] (1) Transformation of Agrobacterium tumefaciens GV3101 with plant expression vectors The plant expression vectors YNs-CP, p1300-YNs, MeGRXC3-YC, H2B-RFP, and the silencing suppressor expression vector pZP-P19 (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) were respectively transformed into competent cells of Agrobacterium tumefaciens GV3101. The transformed Agrobacterium was evenly spread on LB solid medium containing the corresponding resistance (YNs-CP, p1300-YNs, MeGRXC3, H2B-RFP were spread on LB plates containing Kan and Rif resistance, and pZP-P19 was spread on LB plates containing Spec and Rif resistance, with a working concentration of 50 μg / mL for all), and cultured inverted at 28°C for 72 - 90 h. After 2 - 3 days when 2 - 3 mm Agrobacterium colonies grew out, single colonies were selected for PCR identification.

[0042] (2) Agrobacterium infiltration of Nicotiana benthamiana Use a pipette tip to pick a single colony that was identified as positive by colony PCR into 5 mL of LB liquid medium containing the corresponding antibiotic, and place it in a constant temperature shaker at 28°C and 200 r / min for overnight shaking culture. After centrifuging the bacterial solution at 7000 rmp / min for 15 min, discard the supernatant, and resuspend the pellet with 5 mL of injection buffer. After thoroughly vortexing and mixing evenly, dilute the bacterial solution concentration to an OD600 of 0.5. After the diluted bacterial solution is placed at room temperature for 2 - 3 h, mix the resuspension of different recombinant vectors in a ratio of 1:1:1 (the specific combinations are shown in Table 4), and set up the mixing and injection of the resuspended bacteria of MeGRXC3 - YC with p1300 - YNs and YNs - CP respectively. Add the bacterial solution of the nuclear localization red light vector FIB2 - RFP, which is 1 / 10 of the total volume, to each combination as the nuclear marker localization in the experiment. Thoroughly mix and use it to inject the Nicotiana benthamiana leaves at the vigorous growth stage of 5 - 7 leaves. Each combination is injected with at least 3 replicates. After injection, the Nicotiana benthamiana is treated in the dark overnight and then cultured under normal conditions. After 2 - 3 days, take about 1 - 2 cm from each sample 2 Use a laser confocal microscope (Olympus FV3000) to observe the fluorescence of tobacco cells and take pictures. The excitation light for GFP is 488 nm, and the excitation light for RFP is 546 nm.

[0043] The observation results are as Figure 2 shown: Co - injection of MeGRXC3 - YC and YNs - CP into Nicotiana benthamiana leaves can restore green fluorescence under the excitation light of 488 nm, and it coincides with the red fluorescence expressed by H2B - RFP under the excitation light of 546 nm, while no green fluorescence recovery is observed when MeGRXC3 - YC and p1300 - YNs are co - injected. The results of BiFC further illustrate the interaction between the cassava common mosaic virus CP from Sri Lanka and MeGRXC3.

[0044] Table 4 Combinations of agrobacterium with different recombinant plasmids Combination Name of recombinant plasmid 1 YNs-CP + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear marker H2B-RFP 2 p1300-YNs + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear marker H2B-RFP

[0045] 2.4 CP negatively regulates the expression of MeGRXC3 The single - chain green fluorescent protein expression vector pG1300 is stored in this laboratory.

[0046] First, refer to the method in 2.3 to transform the recombinant plasmid into the competent cells of agrobacterium (GV3101).

[0047] Then, refer to the method in 2.3 again to mix the agrobacterium of each combination in Table 5 and inject it into the same tobacco leaf. Observe under a fluorescence microscope on the 5th day after injection. The results are as Figure 3As shown, the fluorescence intensity of MeGRXC3-GFP decreased with the increase in the concentration of YNs-CP bacterial solution, indicating that CP negatively regulates the expression of MeGRXC3.

[0048] To further confirm that CP negatively regulates the expression of MeGRXC3, we mixed MeGRXC3-GFP with GFP tag and pZP-p19, and then co-injected them with the empty vector (Vec) and CP-Flag on the left and right sides of the same leaf respectively. Proteins were extracted 5 days after injection, and Western Blot detection was performed using GFP antibody and Flag antibody respectively. The results are as Figure 4 shown, the expression level after co-injection of MeGRXC3-GFP and CP-Flag was significantly lower than that of co-expression with Vec, further indicating that CP negatively regulates the expression of MeGRXC3.

[0049] Table 5 Agrobacterium combinations of different recombinant plasmids Combination Name of recombinant plasmid 1 Buffer + MeGRXC3-GFP + pZP-P19 2 OD0.1 YNs-CP + MeGRXC3-GFP + pZP-P19 3 OD0.5 YNs-CP + MeGRXC3-GFP + pZP-P19 4 OD1.0 YNs-CP + MeGRXC3-GFP + pZP-P19

[0050] 2.5 ROS content in tobacco leaves of CP and MeGRXC3 First, refer to the method in 2.3 to transform the competent cells of Agrobacterium tumefaciens (GV3101) with the recombinant plasmid. Then, refer to the method in 2.3 to mix the Agrobacterium of each combination in Table 6 and inject them into the same tobacco leaf. The changes in ROS were detected by laser scanning imager at 532 nm and DAB staining 3 days after injection.

[0051] Take the leaves 3 days after injection, immerse them in DAB staining solution, let them stand in the dark for 3 h, then transfer them to the termination solution and boil them in water bath for 10 min. Decolorize them with 95% ethanol until the chlorophyll is completely removed, and then transfer them to the preservation solution and take pictures for observation. The results are as Figure 5 shown, the ROS content increased when CP and MeGRXC3 were co-expressed.

[0052] Table 6 Agrobacterium combinations of different recombinant plasmids Combination Name of recombinant plasmid 1 p1300-Flag + pG1300 + pZP-P19 2 p1300-Flag + CP-GFP + pZP-P19 3 MeGRXC3-Flag + pG1300 + pZP-P19 4 MeGRXC3-Flag + CP-GFP + pZP-P19

[0053] 2.6 Co-expression of CP and MeGRXC3 enhances autophagic flux in tobacco leaves First, refer to the method in 2.3 to transform the competent cells of Agrobacterium tumefaciens (GV3101) with the recombinant plasmid. Then, refer to the method in 2.3 to mix MeGRXC3-RFP, the silencing suppressor pZP-P19 and GFP-MeATG8f with the empty vector (Vec) or CP-Flag ( Figure 6After mixing (denoted as CP in Chinese), they were respectively injected on both sides of the same Nicotiana benthamiana leaf. On the third day after injection, the leaves were treated with E64D for 12 hours. On the fourth day, two replicated tobacco leaves from each combination were taken for observation, photographing, and autophagosome counting under a laser confocal fluorescence microscope (Olympus FV3000). The excitation light for GFP was 488 nm, and the excitation light for RFP was 546 nm.

[0054] The results are as Figure 6 shown. Autophagosomes could be observed when MeGRXC3-RFP, the silencing suppressor pZP-P19, and GFP-MeATG8f were co-expressed with the empty vector or CP-Flag (as indicated by the arrows in the upper panel of Figure 6 ), but the number of autophagosomes increased significantly after co-expression with CP (the lower panel of Figure 6 ), indicating that co-expression of CP and MeGRXC3 can enhance the autophagic flux in co-expressed tobacco leaves.

[0055] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the invention are also within the scope of the present invention. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Use of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in down-regulating the expression level of MeGRXC3; wherein, The nucleotide sequence of the CP gene is as shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is as shown in SEQ ID NO:

2.

2. Use of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in interacting with MeGRXC3; wherein, The nucleotide sequence of the CP gene is as shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is as shown in SEQ ID NO:

2.

3. The application according to claim 2, characterized in that, The interaction between CP and MeGRXC3 results in a decrease in the expression level of MeGRXC3.

4. The application according to claim 2, characterized in that The interaction between CP and MeGRXC3 increases the content of reactive oxygen species in plant tissues.

5. The application according to claim 2, characterized in that, The interaction between CP and MeGRXC3 enhances the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient medium.

6. The application according to claim 2, wherein The interaction between CP and MeGRXC3 increases the autophagic flux in tobacco leaves.

7. Use of the CP gene and the gene corresponding to MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the gene corresponding to MeGRXC3, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the gene corresponding to MeGRXC3 in increasing the content of reactive oxygen species in plant tissues, wherein, The nucleotide sequence of the CP gene is as shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is as shown in SEQ ID NO:

2.

8. Use of the CP gene and the gene corresponding to MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the gene corresponding to MeGRXC3, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the gene corresponding to MeGRXC3 in enhancing the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient medium, wherein, The nucleotide sequence of the CP gene is as shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is as shown in SEQ ID NO:

2.

9. Use of the CP gene and the gene corresponding to MeGRXC3, or the protein encoded by the CP gene and the protein encoded by the gene corresponding to MeGRXC3, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the gene corresponding to MeGRXC3 in increasing the autophagic flux in tobacco leaves, wherein, The nucleotide sequence of the CP gene is as shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is as shown in SEQ ID NO:2.

Images