Primer group for detecting important drug-resistant genes and virulence genes of multi-drug-resistant pathogenic bacteria and application of primer group
By designing 104 pairs of primer sets and using the MGISEQ-200 platform, the high-efficiency and specificity of multidrug-resistant pathogen detection is solved, and high-throughput detection of multiple drug-resistant genes and virulence genes is achieved, supporting environmental risk assessment and clinical treatment.
Patent Information
- Application Number
- CN202510406045.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-04-01
AI Technical Summary
The prior art is difficult to efficiently detect drug-resistant genes and virulence genes of multiple important priority multidrug-resistant pathogens simultaneously, especially in environmental and disease samples, and lacks high-throughput, specificity and sensitive detection methods.
A set of primer groups was designed, covering 104 pairs of primers, used to target the amplification of multiple important drug-resistant genes and virulence genes of multiple drug-resistant pathogens such as the third-generation cephalosporin-resistant Enterobacteriaceae, Carbapenem-resistant Enterobacteriaceae, Carbapenem-resistant Acinetobacter baumannii, and detection in combination with the MGISEQ-200 sequencing platform of Shenzhen BGD Manufacturing Co., Ltd.
It has achieved efficient and specific amplification and detection of a variety of drug-resistant genes and virulence genes, and can enrich target genes from extremely low concentration samples, providing environmental risk assessment and clinical treatment guidance.
Smart Images

Figure CN120230871A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of high-throughput targeted sequencing, and particularly relates to a primer set for detecting important drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria and its application. Background Art
[0002] High-throughput sequencing technologies mainly include metagenomic high-throughput sequencing (Metagenomic Next Generation Sequencing, mNGS), targeted high-throughput sequencing (Targeted Next Generation Sequencing, tNGS), and whole genome sequencing (Whole Genome Sequencing, WGS). tNGS improves the sensitivity and accuracy of detection by targeted enrichment of target genes, and can be divided into multiplex PCR amplification method (abbreviated as amplification method) and probe capture method. Among them, the multiplex PCR amplification method enriches the target nucleotide sequences of target pathogens through the design of specific primers. The tNGS detection technology based on the amplification method can quickly obtain detailed sequence information of target genes in samples in a short time. This technology does not rely on traditional bacteria separation means, is applicable to various types of samples, and has a wide range of applications. It is a highly targeted method, which is more economical and efficient.
[0003] Sequencing is one of the common methods for detecting drug resistance / virulence genes in various samples. Due to the limitations of the conventional data volume of mNGS for drug resistance gene detection, the random sequencing scheme can only stably detect drug resistance / virulence genes at high concentrations. At this time, tNGS is a good choice. At present, tNGS has been clinically applied to the detection of drug resistance genes and virulence genes, but there is no design for simultaneous detection of important drug resistance genes and virulence genes that several important priority multi-drug resistant pathogenic bacteria can carry.
[0004] At present, there are many types of drug resistance genes and virulence genes that have been discovered. Among them, some genes have higher risks and pose threats to animal health and even human health. According to the literature, drug resistance genes can be classified into risk levels Ⅰ-Ⅳ according to three characteristics: ① the enrichment degree in the human-related environment, that is, the richness of the human environment; ② the transferability of the gene; ③ the presence in ESKAPE pathogenic bacteria, that is, pathogenicity, etc. Among them, level Ⅰ is the highest risk level, which is basically the drug resistance genes carried by several important priority pathogenic bacteria in the "List of Bacterial Priority Pathogens in 2024" released by the World Health Organization (WHO).
[0005] Priority drug resistance genes mainly involve the following pathogens and their drug resistance characteristics:
[0006] 1. The Critical group mainly involves the following 4 pathogens and their drug resistance characteristics: (1) Enterobacterales resistant to third-generation cephalosporins; (2) Enterobacterales resistant to carbapenems; (3) Acinetobacter baumannii resistant to carbapenems; (4) Mycobacterium tuberculosis resistant to rifampicin.
[0007] 2. The High group mainly involves the following 7 pathogens and their drug resistance characteristics: (1) Salmonella Typhi resistant to fluoroquinolones; (2) Shigella spp. resistant to fluoroquinolones; (3) Enterococcus faecium resistant to vancomycin; (4) Pseudomonas aeruginosa resistant to carbapenems; (5) Non-typhoidal Salmonella resistant to fluoroquinolones; (6) Neisseria gonorrhoeae resistant to third-generation cephalosporins and / or fluoroquinolones; (7) Staphylococcus aureus resistant to methicillin.
[0008] 3. The Medium group mainly involves the following 4 pathogens and their drug resistance characteristics: (1) Group A Streptococci resistant to macrolides; (2) Streptococcus pneumoniae resistant to macrolides; (3) Haemophilus influenzae resistant to ampicillin; (4) Group B streptococci resistant to penicillin.
[0009] The emergence and spread of the above drug-resistant pathogens pose a certain threat to public health security. In addition, hypervirulent Klebsiella pneumoniae (hvKp) is a new variant of Klebsiella pneumoniae that emerged in the 1980s and is a pure pathogenic bacterium that can cause fatal infections in healthy people. hvKP strains are sensitive to most antibacterial drugs. However, in recent years, the discovery of the ST11 type carbapenem-resistant hypervirulent Klebsiella pneumoniae (CR-hvKp) with high toxicity, multidrug resistance, and high transmissibility has proven that high toxicity and high drug resistance can coexist, also posing a certain threat to animal and human health.
[0010] Based on the above existing technical problems, in order to better evaluate the risk of priority multi-drug resistant pathogenic bacteria in the environment and provide a basis for the clinical treatment of patients or diseased animals, the present invention designs a set of primer groups for simultaneously detecting various important drug resistance genes and virulence genes that can be carried by multi-drug resistant pathogenic bacteria such as third-generation cephalosporin-resistant Enterobacteriaceae bacteria, carbapenem-resistant Enterobacteriaceae bacteria, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, highly virulent Klebsiella pneumoniae, etc. in various samples, and applies them based on the MGISEQ-200 sequencing platform of Shenzhen BGI Manufacturing Co., Ltd.
[0011] The primer groups of the present invention can perform simultaneous targeted amplification of various important drug resistance genes and virulence genes on metagenomic samples from various environments, such as soil, intestinal feces, etc., and metagenomic samples from various diseased materials, such as bronchoalveolar lavage fluid, nasal / pharyngeal swabs, diseased tissue, etc. Then, detection and identification and subtype typing of some genes are completed through sequencing technology, thereby predicting and evaluating the risk of the environment, and further guiding the prevention and clinical treatment medication on this basis. Summary of the Invention
[0012] The purpose of the present invention is to provide a set of targeted sequencing primer groups for simultaneously detecting various drug resistance genes and virulence genes that can be carried by multi-drug resistant pathogenic bacteria in various samples, including third-generation cephalosporin-resistant Enterobacteriaceae bacteria, carbapenem-resistant Enterobacteriaceae bacteria, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, fluoroquinolone-resistant Salmonella typhi, fluoroquinolone-resistant Shigella, vancomycin-resistant Enterococcus faecium, carbapenem-resistant Pseudomonas aeruginosa, fluoroquinolone-resistant non-typhoidal Salmonella, third-generation cephalosporin and / or fluoroquinolone-resistant Neisseria gonorrhoeae, methicillin-resistant Staphylococcus aureus, macrolide-resistant group A Streptococcus, macrolide-resistant Streptococcus pneumoniae, ampicillin-resistant Haemophilus influenzae, penicillin-resistant group B Streptococcus, highly virulent Klebsiella pneumoniae and other multi-drug resistant pathogenic bacteria, as well as important virulence genes that can be carried by highly virulent Klebsiella pneumoniae, etc.
[0013] The present invention provides a primer combination for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria, which consists of the following primer pairs:
[0014] Table 2
[0015]
[0016]
[0017]
[0018]
[0019]
[0020] As shown in SEQ ID NO: 1-208.
[0021] Preferably, the 5'-end of each Primer 1 primer in the primer combination is added with the sequence "GACATGGCTACGATCCGACTT", and the 5'-end of each Primer 2 primer is added with the sequence "CGCTTGGCCTCCGACTT"; as shown in SEQ ID NO: 209-210.
[0022] The present invention also provides the application of the primer combination in the preparation of detection reagents for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria.
[0023] The present invention also provides a kit for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria, including the primer combination.
[0024] The present invention also provides a method for detecting drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria, including the following steps:
[0025] (1) Extract the DNA of the sample to be tested;
[0026] (2) Perform multiplex PCR amplification on the obtained DNA sample with the primer combination;
[0027] (3) Purify, construct a library and sequence the amplification product obtained in step (2);
[0028] (4) Perform bioinformatics analysis on the sequencing results obtained in step (3).
[0029] Preferably, the sample to be tested in step (1) is an environmental sample or a pathological sample, and the environmental sample is soil or intestinal feces; the pathological sample is bronchoalveolar lavage fluid, nasal swab, throat swab or pathological tissue.
[0030] Preferably, the sequencing platform in step (3) is MGISEQ-200, and the sequencing strategy is FCL, PE100.
[0031] Preferably, the system of the multiplex PCR amplification in step (2) is: 12.5 μL of PCR Enzyme Mix, 0.5 μL of PCR CleanEnzyme, 2 μL of primer pool, 10 μL of DNA template, and make up to 25 μL with water
[0032] Preferably, the program of the multiplex PCR amplification in step (2) is: 105 °C hot lid, 37 °C for 5 min, 95
[0033] 10 min at 10 °C; 20 s at 95 °C, 1 min at 64 °C, 1 min at 60 °C, 30 s at 72 °C, for 13 cycles; store at 12 °C.
[0034] The present invention also provides a method for evaluating the risk of multi-drug resistant pathogenic bacteria in the environment, comprising the following steps:
[0035] a. Using the detection method described above, detect the drug-resistant genes and virulence genes in environmental samples;
[0036] b. Evaluate the risk of multi-drug resistant pathogenic bacteria in the environment according to the types and abundances of the detected genes.
[0037] Compared with the prior art, the present invention has the following beneficial effects:
[0038] The drug-resistant genes detected by the present invention cover 7 types of aminoglycoside-resistant genes: aac(3)-II, aac(3)-VI, aadB, aadE, aph(3')-III, rmtF, rmtG; 1 type of bacitracin-resistant gene: bacA; β-lactam-resistant genes blaZ, bla CMY , bla CTX-M-1 , bla CTX-M-2 , bla CTX-M-129 , bla GES-11 , bla IMP-1 , bla KPC , mecA, mecR1, bla NDM , bla OXA-1 , bla OXA-23 , bla OXA-51 , bla OXA-58 , bla SHV , bla TEM , bla VEB-3 , bla VIM-1 , bla MOX , bla DHA , bla ACC , bla ACT-1 , bla FOX , bla ADCThere are 25 kinds of bla; 4 kinds of chloramphenicol resistance genes catA, catB, cmlA, floR; 3 kinds of colistin resistance genes mcr-1, mcr-3, mcr-8; 8 kinds of MLSB resistance genes ermB, ermC, ermT, lnuA, lnuB, mphA, mphB, msrA; 5 kinds of multidrug resistance genes mepA, mdtE, mdtL, norA, TolC; 3 kinds of quinolone resistance genes qnrA, qnrB, qnrS; 2 kinds of tetracycline resistance genes tetL, tetM; 8 kinds of trimethoprim resistance genes dfrA1, dfrA5, dfrA12, dfrA14, dfrA15, dfrA17, dfrA25, dfrB1; 12 kinds of vancomycin resistance genes vanA, vanB, vanC, vanD, vanG, vanM, vanR, vanS, vanY, vanH, vanX, vanZ; 2 kinds of rifampicin resistance genes arr-3, rpoB. The detected virulence genes of hypervirulent Klebsiella pneumoniae include 9 kinds of rmpA, rmpA2, iucA, iucB, iucC, iucD, iroB, iroC, peg344. Finally, it covers 12 categories, 80 important resistance genes and 9 virulence genes of hypervirulent Klebsiella pneumoniae, a total of 89 kinds. Among them, bla KPC and bla NDM The primer amplification regions of the genes basically cover the full length of the gene sequences, monitoring the SNPs of the genes, and adding the distinction of different subtypes on the basis of identification; for the rpoB gene, the rifampicin resistance-determining region (RRDR) is selected as the amplification region to monitor the mutation of the rpoB gene, so as to more accurately judge whether rifampicin resistance is generated. One pair of primers or multiple pairs of primers are designed according to the length and characteristics of the gene.
[0039] The present invention provides a total of 104 pairs of primers, and the size range of the amplified fragment corresponding to each pair of primers is 100-200 bp, which can efficiently and specifically target-amplify the resistance genes and virulence genes involved in the invention.
[0040] The purpose of the present invention is to use targeted resequencing technology to analyze the distribution and genetic evolution characteristics of important resistance genes carried by multidrug-resistant pathogenic bacteria, and at the same time realize the synchronous monitoring of virulence genes of hypervirulent Klebsiella pneumoniae. It does not rely on traditional bacterial separation methods, is applicable to various types of samples, has a wide range of applications, and closely links resistance genes / virulence genes, priority pathogens carrying relevant genes, and the environment, patients / sick animals, etc. This set of detection schemes is conducive to predicting and analyzing the drug resistance and virulence characteristics of multidrug-resistant pathogenic bacteria in different environments, and has important public health significance.
[0041] The present invention establishes a high-throughput targeted amplification sequencing detection and analysis method for multiple drug resistance genes and virulence genes carried by multi-drug resistant pathogenic bacteria. This method has technical advantages such as rapidity, high efficiency, strong targeting, and strong specificity. It is applicable to the prevalence and differential analysis of various important drug resistance genes and virulence genes carried by metagenomic samples from various environments or diseased materials, and on this basis, the risk of the relevant environment is evaluated, and it can also further guide the prevention and clinical treatment of drugs. Brief Description of the Drawings
[0042] Figure 1 It is a distribution map of drug resistance genes and virulence genes carried by multi-drug resistant pathogenic bacteria involved in the present invention.
[0043] Figure 2 It is a high-throughput targeted sequencing detection workflow diagram applied in the embodiment of the present invention (refer to the MGISEQ-200 sequencing operation manual of BGI MFG Co., Ltd., Shenzhen, China).
[0044] Figure 3 It is a result quality assessment map of MGISEQ-200 sequencing for the samples in Example 4.
[0045] Figure 4 It is an abundance map of drug resistance genes and virulence genes detected in 8 samples sequenced in Example 4. Detailed Embodiments
[0046] Table 3 Main Reagents and Instruments
[0047]
[0048]
[0049] Instruments
[0050]
[0051] Example 1 Establishment of a Targeted Detection Method for Drug Resistance Genes and Virulence Genes of Multi-Drug Resistant Pathogenic Bacteria
[0052] Priority pathogens are selected with reference to the "List of Priority Bacterial Pathogens 2024" released by the World Health Organization (WHO). A targeted detection method is established for important drug resistance genes and virulence genes that may be carried by multi-drug resistant pathogenic bacteria such as third-generation cephalosporin-resistant Enterobacteriaceae bacteria, carbapenem-resistant Enterobacteriaceae bacteria, carbapenem-resistant Acinetobacter baumannii, rifampicin-resistant Mycobacterium tuberculosis, and hypervirulent Klebsiella pneumoniae. Finally, 80 important drug resistance genes and 9 virulence genes are covered (Table 4), and the complete gene sequences are downloaded from NCBI, and a specialized sequence database of important drug resistance genes and virulence genes of multi-drug resistant pathogenic bacteria is constructed.
[0053] Table 4 Genes and Their Accession Numbers
[0054]
[0055]
[0056]
[0057] To ensure the best amplification efficiency and optimal combination effect of the primers, the amplification length of each pair of primers was controlled between 100 and 200 bp during design. According to important information such as the sequence length and genetic characteristics of different genes, after repeated comparison and analysis, except for the β-lactam resistance genes bla KPC and bla NDM , one pair of primers was designed for each of the 78 resistance genes, and the amplification region was the conserved region of the gene; while for the 2 resistance genes such as bla KPC and bla NDM , 4 pairs of primers were designed for each, and the amplification region basically covered the full-length sequence of the gene, involving SNP detection and different subtype monitoring of the above 2 resistance genes, and identifying their subtypes while detecting. In addition, one pair of primers designed for the gene rpoB mainly covered the rifampicin resistance-determining region (RRDR) to effectively achieve the purpose of monitoring rifampicin resistance. For 9 virulence genes, except that only one pair of primers was designed for the rmpA2 gene, 2 - 3 pairs of primers were designed for the remaining genes, and the amplification regions were located in different regions of the gene, and their epidemic characteristics could also be analyzed while identifying the gene. Finally, a total of 104 pairs of primers were designed (as shown in Table 2), and the average amplification length of the primers was 138.74 bp. There was no homologous amplification region between the primers, and there was no cross between them.
[0058] The primer set was applied to the MGISEQ-200 sequencing platform of Shenzhen BGI Manufacturing Co., Ltd. and synthesized by Shenzhen BGI Genomics Co., Ltd. Linker and other base sequences were added to the primer set in combination with the company's specific barcode sequence. The sequence "GACATGGCTACGATCCGACTT" was added to the 5' end of each Primer 1, and the sequence "CGCTTGGCCTCCGACTT" was added to the 5' end of each Primer 2, which did not conflict with the content of the present invention. Finally, the "primer pool for multi-drug resistant pathogen resistance genes and virulence genes" applied in the following examples was formed, hereinafter referred to as the primer pool.
[0059] Example 2 Enrichment of Target Regions in Aquaculture Environment Samples
[0060] The "primer pool for multi-drug resistant pathogen resistance genes and virulence genes" designed in Example 1 was applied to the detection of aquaculture environment samples. The samples were from Beijing area and were litter samples in the environment of a dairy farm. The specific numbers are shown in Table 5.
[0061] I. Microbial DNA Extraction of Samples
[0062] Use a fecal DNA miniprep kit to extract the microbial DNA from fecal samples, ensuring that the total amount of extracted microbial DNA is not less than 10 μL. And use Nanodrop to perform quality control on the genome to ensure successful extraction.
[0063] Table 5 Sample Information
[0064]
[0065] II. Amplification of Target Regions
[0066] Using the microbial DNA extracted from a single sample as a template, perform the first-round PCR amplification with the primer pool designed and synthesized in Example 1 above. The reaction reagents used are the PCR Enzyme Mix and PCRClean Enzyme in the ATOPlex DNA Multiplex PCR Amplification Module. The reaction system is shown in Table 6, and the reaction program is shown in Table 7.
[0067] Table 6 First-round PCR Reaction System
[0068]
[0069] Table 7 First-round PCR Reaction Program
[0070]
[0071]
[0072] III. Purification of Amplification Products
[0073] After the first-round PCR reaction, it is necessary to purify the PCR products. The reagents used include the DNA Clean Beads in the MGIEasy DNA Purification Magnetic Bead Kit and TE buffer. In addition, 80% ethanol needs to be prepared. Note that the sample numbers, PCR reaction numbers, and PCR product purification numbers should be corresponding, that is, one sample corresponds to one PCR reaction and one PCR product purification.
[0074] The specific steps are as follows: Purify the 25 μL PCR product of the first round using 30 μL DNAClean Beads. Transfer the two to a 1.5 mL centrifuge tube and gently pipette to mix well. After mixing, incubate at room temperature for 5 min. After incubation, centrifuge briefly to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on a magnetic stand and let it stand for 4 min until the liquid is clear. Carefully pipette and discard the supernatant; Keep the 1.5 mL centrifuge tube on the magnetic stand, add 200 μL of 80% ethanol to wash the magnetic beads and the tube wall, let it stand for 30 s, then carefully pipette and discard the supernatant, and repeat once. Ensure that the liquid in the tube is completely dried for the second time; Keep the 1.5 mL centrifuge tube on the magnetic stand, open the tube cap and dry at room temperature until the surface of the magnetic beads has no reflection and no cracking; Remove the 1.5 mL centrifuge tube, add 6.5 μL TE Buffer for DNA elution, gently pipette to mix completely, then incubate at room temperature for 5 min and centrifuge briefly. This step does not remove the magnetic beads.
[0075] After this round of PCR amplification and product purification, a specific product enriched in the target region is obtained, and the product contains magnetic beads. This product can be stored at -20 °C for a long time.
[0076] Example 3 Construction and Application of Sequencing Library on MGISEQ-200 Platform
[0077] To enable the specific product enriched in the target region obtained in Example 2 to be sequenced on the MGISEQ-200 platform and ensure that different samples can be correctly identified during the sequencing process, the following operations are carried out, including the steps of connecting adapters and barcodes in the target region, conventional circularization of the library, DNB preparation, and on-machine sequencing.
[0078] I. Connection of Adapters and Barcodes in the Target Region
[0079] Use the specific product (containing magnetic beads) enriched in the target region obtained in Example 2 as a template for the second round of PCR amplification. After amplification, purification of the amplification product is still required. For the second round of amplification, a customized specific splint oligo provided by Shenzhen MGI Tech Co., Ltd. is used, and a barcode that can be split by the MGISEQ-200 platform is added. The customized specific splint oligo can specifically bind to the primer pool of the present invention.
[0080] The reaction reagents used for the second round of PCR are the PCR Enzyme Mix, PCR Clean Enzyme, and Additive of the ATOPlex DNA Multiplex PCR Amplification Module. The reaction system is shown in Table 8, and the reaction procedure is shown in Table 9.
[0081] Table 8 Second Round of PCR Reaction System
[0082]
[0083] Table 9 The second-round PCR reaction procedure
[0084]
[0085] The purification reagents used for the second-round PCR products include DNA CleanBeads in the MGIEasy DNA Purification Magnetic Bead Kit and TE buffer. Additionally, 80% ethanol needs to be prepared. At this time, there is still one sample corresponding to one purified product, and it needs to correspond to the added barcode.
[0086] The specific steps are as follows: Use 25 μL of DNA Clean Beads to purify 25 μL of the second-round PCR products. Transfer the two to a 1.5 mL centrifuge tube and gently pipette to mix thoroughly. After mixing, incubate at room temperature for 5 min. After the incubation, centrifuge briefly to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on a magnetic stand and let it stand for 4 min until the liquid is clear. Carefully pipette and discard the supernatant; Keep the 1.5 mL centrifuge tube on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall, let it stand for 30 s, then carefully pipette and discard the supernatant, and repeat once. Ensure that the liquid in the tube is completely dried for the second time; Keep the 1.5 mL centrifuge tube on the magnetic stand, open the tube cap and dry at room temperature until there is no reflection and no cracking on the surface of the magnetic beads; Remove the 1.5 mL centrifuge tube, add 6.5 μL of TE Buffer for DNA elution, gently pipette to mix thoroughly, then incubate at room temperature for 5 min and centrifuge briefly. Then place the 1.5 mL centrifuge tube on the magnetic stand and let it stand for 4 min until the liquid is clear. Pipette 23 μL of the supernatant and transfer it to a new PCR tube. This step needs to remove the magnetic beads completely.
[0087] After the PCR amplification and product purification in this round, various tags that can be applied to subsequent on-machine sequencing were successfully added to the specific products obtained in Example 2, and the magnetic beads were removed, resulting in a double-stranded DNA library for a single sample. This library can be stored at -20 °C for a long time. According to the number of samples, a total of 8 double-stranded DNA libraries for samples were constructed, and this library enriched multiple drug-resistant pathogen resistance genes and virulence genes.
[0088] II. Conventional circularization of the library
[0089] To enable the 8 double-stranded DNA libraries for samples constructed in Step I to be successfully sequenced on the machine subsequently, circularization of the libraries is carried out. The experiments involved in this step include the mixing of double-stranded DNA libraries for individual samples and the conventional circularization of the mixed sample libraries.
[0090] 1. Mixing of double-stranded DNA libraries for individual samples
[0091] The 8 - sample double - stranded DNA libraries constructed in Step 1 of this example were quality - inspected using a Qubit TM 4 Fluorometer. Samples with a concentration greater than 5 ng / μL were mixed and input. The input volume (μL) for each library was 400 (ng) / number of samples / C (ng / μL). Finally, a mixed library of samples was constructed, and the detailed concentrations are shown in Table 10. For convenient sampling, all samples can be scaled up proportionally according to the actual situation. In this example, sampling was carried out with a 10 - fold expansion.
[0092] Table 10 Input situation of double - stranded DNA libraries of individual samples
[0093]
[0094] 2. Conventional circularization of the mixed sample library
[0095] Using the mixed library of samples constructed in the previous step as a template, a third - round PCR reaction was carried out to denature the library. Since the input volume of the template was less than 48 μL, TE buffer was added to make up to 48 μL. No other reagents were used in the third - round PCR reaction, and the reaction program is shown in Table 11.
[0096] Table 11 Third - round PCR reaction program
[0097]
[0098] Then, using the product of the third - round PCR reaction as a template, conventional circularization of the samples was carried out. A total of two rounds of PCR reactions were carried out, namely the fourth - round and fifth - round PCR reactions. The reagents used in the fourth - round PCR reaction were Splint Buffer and DNARapid Ligase in the MGIEasy circularization module, and the reagents used in the fifth - round PCR reaction were Digestion Buffer and Digestion Enzyme in the MGIEasy circularization module. The reaction system of the fourth - round PCR reaction is shown in Table 12, and the reaction program is shown in Table 13; the reaction system of the fifth - round PCR reaction is shown in Table 14, and the reaction program is shown in Table 15.
[0099] Table 12 Fourth - round PCR reaction system
[0100]
[0101] Table 13 Fourth - round PCR reaction program
[0102]
[0103] Table 14 Fifth - round PCR reaction system
[0104]
[0105]
[0106] Table 15 The fifth round of PCR reaction program
[0107]
[0108] Immediately after the fifth round of PCR reaction, add 7.5 μL of Digestion Stop Buffer in the MGIEasy circularization module to the PCR tube and vortex thoroughly. The fifth-round PCR products after mixing need to be purified. The purification reagents used for purification include DNAClean Beads in the MGIEasy DNA Purification Magnetic Bead Kit and TE buffer. Additionally, 80% ethanol needs to be prepared.
[0109] The specific steps are as follows: Purify 71.5 μL of the fifth-round PCR products using 170 μL of DNA Clean Beads. Transfer the two to a 1.5 mL centrifuge tube and gently pipette to mix thoroughly. After mixing, incubate at room temperature for 10 min. After the incubation, centrifuge briefly to collect the liquid on the tube wall. Place the 1.5 mL centrifuge tube on the magnetic rack and let it stand for 4 min until the liquid is clear. Carefully pipette and discard the supernatant; Keep the 1.5 mL centrifuge tube on the magnetic rack, add 500 μL of freshly prepared 80% ethanol to wash the magnetic beads and the tube wall, let it stand for 30 s, then carefully pipette and discard the supernatant, and repeat once more. Ensure that the liquid in the tube is completely dried for the second time; Keep the 1.5 mL centrifuge tube on the magnetic rack, open the tube cap and dry at room temperature until the surface of the magnetic beads has no reflection and no cracking; Remove the 1.5 mL centrifuge tube, add 22 μL of TE Buffer for DNA elution, gently pipette to mix it completely, then incubate at room temperature for 10 min and centrifuge briefly. Then place the 1.5 mL centrifuge tube on the magnetic rack and let it stand for 4 min until the liquid is clear. Pipette 20 μL of the supernatant and transfer it to a new PCR tube. This step needs to remove the magnetic beads completely.
[0110] After the product purification is completed, use the standard product provided in the ssDNAAssay Kit to perform ssDNA quality inspection with a Qubit TM 4 Fluorometer. In this example, the ssDNA concentration of the circularized library is 0.833 ng / μL, meeting the requirement of concentration ≥ 0.4 ng / μL. Thus, the conventional circularization of the library is completed, and the circularized library can be stored at -20 °C for a long time.
[0111] III. DNB preparation
[0112] To ensure that the base distribution in the library can reach equilibrium and does not affect subsequent on-machine sequencing, a standard library needs to be added to the circularized library during DNB preparation. The addition ratio is circularized library:standard library = 7:3, and the total input amount is 60 fmol. The standard library used is the standard product in the standard library kit. The concentration of the standard library used this time is 1.93 ng / μL, and the length is 429 bp.
[0113] Convert the concentration unit ng / μL to fmol / μL. The conversion formula is C(fmol / μL) = 3030*C(ng / μL) / N, where N is the length of the library. Using the mixed library of circularized library and standard library as the template, use the MGISEQ-200RS high-throughput sequencing kit (FCLPE100) to prepare DNB. A total of two rounds of PCR reactions are carried out, namely the sixth round and the seventh round of PCR reactions. The reagents used in the sixth round of PCR reaction are TE Buffer and DNB preparation buffer in the MGISEQ-200RS high-throughput sequencing kit (FCLPE100). The reagents used in the seventh round of PCR reaction are DNB polymerase mixture Ⅰ and DNB polymerase mixture Ⅱ (LC) in the MGISEQ-200RS high-throughput sequencing kit (FCLPE100). The reaction system of the sixth round of PCR is shown in Table 16, and the reaction procedure is shown in Table 17; the reaction system of the seventh round of PCR is shown in Table 18, and the reaction procedure is shown in Table 19.
[0114] Table 16 Sixth-round PCR reaction system
[0115]
[0116] Table 17 Sixth-round PCR reaction procedure
[0117]
[0118] Table 18 Seventh-round reaction system
[0119]
[0120] Table 19 Seventh-round PCR reaction procedure
[0121]
[0122] Immediately after the seventh round of PCR reaction, add 20 μL of DNB stop buffer in the MGISEQ-200RS high-throughput sequencing kit (FCLPE100) to the PCR tube, and slowly pipette and mix 8 times with a wide-mouth pipette tip. To avoid breaking the DNB, do not pipette vigorously.
[0123] After the reaction, use The standard provided in the ssDNA Assay Kit was used for ssDNA quality inspection with a Qubit TM 4 Fluorometer. In this example, the ssDNA concentration of DNB was 8.49 ng / μL, with a concentration ≥ 8 ng / μL, meeting the requirements for loading onto the machine, indicating successful preparation of DNB. Then it was stored at 4°C for short-term preservation in preparation for loading onto the machine for sequencing.
[0124] IV. Loading onto the machine for sequencing
[0125] The DNB prepared in Step 3 was used for loading onto the machine for sequencing with the high-throughput (rapid) sequencing reagent kit (FCL PE100) from MGI. Before loading onto the machine, the instrument needed to be cleaned according to the MGISEQ-200 cleaning instructions. Then the specific operation steps for loading onto the machine were carried out according to the instructions of this kit. The sequencing strategy was selected as FCL, PE100, and the sequencing duration was 24 hours.
[0126] Example 4 Sequencing data download and bioinformatics analysis
[0127] After the sequencing was completed, the instrument needed to be cleaned again according to the MGISEQ-200 cleaning instructions. Then all the sequencing data of the samples were copied for analysis and statistical detection results. The downloaded sequencing report showed that the Q30 (%) of this loading onto the machine result was 94.6, the ESR (%) was 75.2, and the Split Rate (%) was 98.3, indicating that the data quality met the analysis requirements.
[0128] The above environmental sample data was processed by bioinformatics methods. After data quality control using fastq, sequence alignment analysis of the sample data was carried out using the pblat software and customized bioinformatics scripts. After analysis, all the sample barcodes input for detection were correctly identified, and the raw data reads of each sample in the example were not less than 3M, meeting the analysis requirements.
[0129] The data after bioinformatics analysis was subjected to data normalization, calculation of target gene abundance, statistical detection results of drug resistance genes and virulence genes, etc. Finally, the results were visually displayed. The results of this example were reliable, and the detection depth of some of the detected genes could reach 10,000X. Multiple drug resistance genes and virulence genes were detected in 8 samples of the example, and there were differences in the detection situations among the samples (Table 20), indicating that there were certain risks in the dairy farm breeding environment and attention should be paid.
[0130] Table 20 Detection situations of 8 samples in the example
[0131]
[0132]
[0133] # Percentage of the number of detected gene species in the designed genes; *Percentage of the detected gene types in the designed genes
[0134] In summary, the applications in the examples show that the primer set provided by the present invention can simplify manual operations and improve the detection efficiency of drug-resistant genes and virulence genes in samples on the premise of non-interference. The primer set provided in the present invention has strong specificity (negative control does not meet the amplification requirements) and sensitivity (can enrich target genes from environmental samples with extremely low concentrations), and can accurately capture target genes from environmental samples, so as to assist in judging the risk of possible multi-drug resistant pathogenic bacteria in the environment according to the detection situation of the sequencing results. The present invention achieves the purpose of directly, quickly, accurately detecting various drug-resistant genes and virulence genes that multi-drug resistant pathogenic bacteria may carry in samples. This shows that a high-throughput targeted sequencing method for detecting drug-resistant genes and virulence genes of multi-drug resistant pathogenic bacteria provided by the present invention is successfully established. The above description is only a preferred embodiment of the present invention.
Claims
1. A primer combination for detecting drug resistance genes and virulence genes of multidrug-resistant pathogens, characterized in that: The following primer pairs composition: Table 1 As shown in SEQ ID NOs: 1-208.
2. The primer combination according to claim 1, characterized in that The 5' end of each Primer 1 primer in the primer combination is added with the sequence "GACATGGCTACGATCCGACTT", and the 5' end of each Primer 2 primer is added with the sequence "CGCTTGGCCTCCGACTT"; as shown in SEQ ID NOs: 209-210.
3. Use of the primer combination according to claim 1 or 2 in the preparation of a detection reagent for detecting drug resistance genes and virulence genes of multidrug-resistant pathogens.
4. A kit for detecting drug resistance genes and virulence genes of multi-drug resistant pathogens, characterized in that: Comprising the primer combination of claim 1 or 2.
5. A method for detecting drug resistance genes and virulence genes of multi-drug resistant pathogens, characterized in that: The following steps are involved: (1) extracting DNA from the sample to be tested; (2) performing multiplex PCR amplification on the obtained DNA sample using the primer combination described in claim 1 or 2; (3) purifying, library building and sequencing the amplified product obtained in step (2); (4) Performing bioinformatics analysis on the sequencing results obtained in step (3).
6. The detection method according to claim 5, characterized in that: In step (1), the sample to be tested is an environmental sample or a diseased sample, wherein the environmental sample is soil or intestinal feces; the diseased sample is alveolar lavage fluid, nasal swab, throat swab or diseased tissue.
7. The detection method according to claim 5, characterized in that: The sequencing platform in step (3) is MGISEQ-200, and the sequencing strategy is FCL, PE100.
8. The detection method according to claim 5, characterized in that: The system of the multiplex PCR amplification in step (2) is: 12.5 μL of PCR Enzyme Mix, 0.5 μL of PCR Clean Enzyme, 2 μL of primer pool, 10 μL of DNA template, and 25 μL of water.
9. The detection method according to claim 5, characterized in that: The program of the multiplex PCR amplification in step (2) is: 105°C hot cover, 37°C for 5 min, 95°C for 10 min; 95°C for 20 s, 64°C for 1 min, 60°C for 1 min, 72°C for 30 s, 13 cycles; and stored at 12°C.
10. A method for assessing the risk of multidrug-resistant pathogens in an environment, characterized in that: The following steps are involved: a. Detecting drug resistance genes and virulence genes in environmental samples using the detection method described in any one of claims 5 to 9; b. Assess the risk of multidrug-resistant pathogens in the environment based on the types and abundance of detected genes.
Citation Information
Patent Citations
Sequencing kit and detection method for Panel targeted amplicons with excessive pathogen infection
CN118813833A
Capture probe group for detecting pathogenic microorganisms and application of capture probe group
CN119662886A
Primer group for simultaneous detection of 15 porcine pathogens through high-throughput targeted amplicon sequencing and use thereof
US20240167106A1
Cited By
Reagent and kit for identifying respiratory pathogens and detecting drug resistance and toxicity of respiratory pathogens based on single molecule sequencing method and application of reagent and kit
CN120442830A
Primer group and kit for high-flux targeted detection of pathogens and drug-resistant genes of camel mastitis and application of primer group and kit
CN121160894A