Attenuated salmonella typhimurium and application thereof

Abstract

The invention provides attenuated salmonella typhimurium and application thereof, and the provided attenuated salmonella typhimurium is prepared by knocking out a relA gene, a manA gene and a sifA gene. According to the three-gene salmonella attenuated strain provided by the invention, an antigen is presented to a host cell through oral immunization, so that an organism is induced to generate immune response. The action mechanism of the salmonella as the live vector is that after carrying bacterial antigens to pass through intestinal epithelium, the bacterial antigens are transferred to immune cells through intestinal mucosa, and the immune response of a host is triggered. Safety detection shows that the attenuated strain constructed by the invention is high in safety, and can be used as a carrier to carry other pathogenic antigens or drugs to an action site so as to play a role of the carrier.

Description

Technical Field

[0001] The present invention belongs to the technical field of biopreparation, and particularly relates to an attenuated Salmonella typhimurium and its application. Background Art

[0002] Salmonella infection can cause acute and chronic clinical diseases in poultry. In recent years, due to the outbreak of human foodborne diseases caused by the pathogenic bacteria of this disease, it has received extensive attention on an international scale. Contaminated poultry meat and eggs are one of the most common food vectors in Salmonella infection. With the advent of the era of reducing and restricting the use of antibiotics, it has brought challenges to the prevention and control of livestock and poultry bacterial diseases. The main pathogens of avian paratyphoid are Salmonella typhimurium and Salmonella enteritidis.

[0003] Salmonella is a non-spore-forming Gram-negative straight bacillus, without a spore structure, usually without a capsule, and most strains have peritrichous flagella. The bacterium can colonize in the intestines of humans and animals, especially poultry, livestock and pets, and is mainly transmitted between humans and animals through the digestive tract directly or indirectly. According to statistics, there are more than 2,600 serotypes so far, and the vast majority of Salmonella types are potential pathogens for humans and various animals, capable of causing a series of clinical symptoms, triggering different infection responses in human and animal hosts, and Salmonella, as one of the most important foodborne pathogens globally, has important significance in medicine, veterinary medicine and public health.

[0004] As a widely distributed and non-specifically parasitic Salmonella species, Salmonella typhimurium is one of the species with the highest isolation rate in various countries. It can invade the body through various ways, and the most common way is to ingest contaminated food or water. In rare cases, vertical transmission can occur through the ovaries in chicken flocks. Humans and carriers of the bacteria are the main sources of infection. After animals or humans are infected with the bacterium, it can lead to the occurrence of paratyphoid, gastroenteritis and even septicemia. The pathogenic mechanism of Salmonella typhimurium is related to virulence factors. Among the current preventive measures against Salmonella infection, antibiotics and inactivated vaccines are widely used. However, live Salmonella vaccines can stimulate the body to produce cellular immunity, humoral immunity and local mucosal immune responses, and have better protective effects than inactivated vaccines.

[0005] Salmonella itself is pathogenic, and as a vaccine vector, it must have good safety. Therefore, the primary condition for being a live vaccine or vector vaccine is to attenuate Salmonella to lose its pathogenicity. Early attenuation methods mainly included screening natural mutants, mutagenesis with chemical substances or ultraviolet irradiation. With the continuous development of modern molecular biology and the in-depth study of bacterial virulence genes, invasion mechanisms, and expression regulation, it has become possible to perform multiple, precise, and irreversible gene deletions for attenuation at the bacterial genome level. The gene-deleted attenuated Salmonella produced by modern genetic engineering technology has a clear genetic background and greatly guaranteed safety, making it a prerequisite for being a vaccine or a carrier of the vaccine. Summary of the Invention

[0006] The object of the present invention is to provide an attenuated Salmonella typhimurium and its application, which can have better safety on the basis of ensuring immunogenicity.

[0007] The attenuated Salmonella typhimurium provided by the present invention is prepared by knocking out the relA gene, manA gene, and sifA gene;

[0008] Among them, the nucleotide sequence of the relA gene is SEQ ID NO:1, the nucleotide sequence of the manA gene is SEQ ID NO:2, and the nucleotide sequence of the sifA gene is SEQ ID NO:3.

[0009] Furthermore, the primer pair for amplifying the relA gene knockout fragment has the following sequence information:

[0010] Forward primer (SEQ ID NO:4):

[0011] GGAGTGATGCGACATATTATAAAATTAAAACCTATTCGCATTGTTTATGTGTGTAGGCTGGAGCTGCTTC;

[0012] Reverse primer (SEQ ID NO:5):

[0013] GGCTTTGCTGAACGAGTAGCAAAGCCGCTACATGATTACTGTCTGGGGTTCATATGAATATCCTCCTTAG.

[0014] Furthermore, the primer pair for amplifying the manA gene knockout fragment has the following sequence information:

[0015] Forward primer (SEQ ID NO:6):

[0016] AAAGGGTCGATTTAATCAATTATGTAGTCATTTTTACTCAGTATAAGTGAGATTAATGTGTAGGCTGGAGCTGCTTC;

[0017] Reverse primer (SEQ ID NO:7):

[0018] CTGGCAAGAGTTACTCAGTAGGCAAACAGGAAGTACGTGTAAACCTGAACGTGACGTCCATATGATATCCTCCTTA。

[0019] Furthermore, the primer pair for amplifying the sifA gene knockout fragment has the following sequence information:

[0020] Forward primer (SEQ ID NO:8):

[0021] TTCATGCGGGTTTCTTGGTTTAATACCTCCCATTGATCTCCACATTGAAAGTGTAGGCTGGAGCTGCTTC;

[0022] Reverse primer (SEQ ID NO:9):

[0023] TTACGTCTGTTATAAGCTTAGCAAGAGTTGTTAAAAAATTCAGTACGTTGCATATGAATATCCTCCTTAG。

[0024] The present invention also provides a use of the attenuated Salmonella typhimurium, which is an application in the preparation of vaccines.

[0025] Another aspect of the present invention also provides a vaccine, wherein the antigen uses the above-mentioned attenuated Salmonella typhimurium.

[0026] The triple-gene Salmonella attenuated strain provided by the present invention presents the antigen to host cells through oral immunization, thereby inducing an immune response in the body. The mechanism of action of Salmonella as a live vector is that after carrying bacterial antigens through the intestinal epithelium, it transports them to immune cells through the intestinal mucosa, triggering the host's immune response. The attenuated strain constructed by the present invention is found to be highly safe through safety detection and can be used as a vector to transport other pathogenic antigens or drugs to the site of action, thus playing a carrier role. Description of the Drawings

[0027] Figure 1: PCR amplification of the targeting fragment diagram; in the figure, M: DNA marker (DL2000); 1: targeting fragment of relA gene; 2: targeting fragment of sifA gene; 3: targeting fragment of manA gene;

[0028] Figure 2 : PCR identification of plasmid pKD46 diagram; in the figure, M: DNA marker (DL2000); 1: ΔrelA-ΔAsd-pKD46 PCR detection;

[0029] Figure 3 : PCR identification diagram of the gene deletion strain ΔrelA-ΔmanA-ΔsifA-SM14028; in the figure, M: DNA marker (DL2000); 1: detection outside ΔmanA; 2: detection inside ΔmanA; 3: positive control for detection outside ΔmanA; 4: positive control for detection inside ΔmanA; 5: detection outside ΔsifA; 6: detection inside ΔsifA; 7: positive control for detection outside ΔsifA; 8: positive control for detection inside ΔsifA; 9: detection outside ΔrelA; 10: detection inside ΔrelA; 11: positive control for detection outside ΔrelA; 12: positive control for detection inside ΔrelA;

[0030] Figure 4 : PCR identification diagram of the attenuated strain eliminating plasmid pKD46; in the figure, M: DNA marker (DL2000); 1-2: detection of ΔrelA-ΔmanA-ΔsifA eliminating plasmid pKD46; 3: positive control;

[0031] Figure 5 : PCR identification (B) diagram of eliminating chloramphenicol resistance gene (A) and plasmid pCP20; in the figure, M: DNA marker (DL2000); 1-2: ΔrelA-ΔmanA-ΔsifA; 3: positive control;

[0032] Figure 6 : Growth curves of the triple gene deletion strains ΔrelA-ΔmanA-ΔsifA-SM14028-1 and ΔrelA-ΔmanA

[0033] -ΔsifA-SM14028-2, SM14028;

[0034] Figure 7 : Phenotypic identification diagram of the triple gene deletion strain ΔrelA-ΔmanA -ΔsifA-SM14028;

[0035] Figure 8Genetic stability analysis diagram of gene deletion strain ΔrelA-ΔmanA-ΔsifA-SM14028: In the figure, 1-6: Detection of the outside of the relA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 8-13: Detection of the outside of the sifA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 15-20: Detection of the outside of the manA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 22-27: Detection of the inside of the relA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 29-34: Detection of the inside of the sifA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 36-41: Detection of the inside of the manA gene of the F2, F4, F6, F8, F10 and F15 generations of the ΔrelA-ΔmanA-ΔsifA strain; 7: Positive control for outside detection of relA; 14: Positive control for outside detection of sifA; 21: Positive control for outside detection of manA; 28: Positive control for inside detection of relA; 35: Positive control for inside detection of sifA; 42: Positive control for inside detection of manA

[0036] Figure 9 : Diagram of mouse status; In the figure, 7-12: Group challenged with ΔrelA-ΔmanA-ΔsifA (10 6 →10 1 ) group; 2: Group challenged with ΔrelA-ΔmanA-ΔsifA 10 10 group; 3: Group challenged with ΔrelA-ΔmanA-ΔsifA 10 8 group; 21: PBS group

[0037] Figure 10 : Diagram of average mouse body weight;

[0038] Figure 11 : Diagram of mouse survival curve;

[0039] Figure 12 : Average mouse body weight. Detailed implementation methods

[0040] Salmonella typhimurium ATCC SM14028 (abbreviated as SM14028), plasmid pKD46, plasmid pKD3 and plasmid pCP20 used in the examples of the present invention are stored in the laboratory where the inventors are located; BALB / c female mice are purchased from Qingdao Yunshan Biotechnology Co., Ltd.

[0041] The present invention will be described in detail below in conjunction with specific embodiments and the accompanying drawings.

[0042] Example 1: Design of primers related to homologous recombination

[0043] 1. Design of primers related to λRed homologous recombination

[0044] According to the relA gene of the standard strain of Salmonella typhimurium ATCCSM14028 (GenBank accession number: CP102669.1) published in GenBank, its nucleotide sequence is SEQ ID NO:1,

[0045]

[0046] The manA gene, whose nucleotide sequence is SEQ ID NO:2,

[0047]

[0048] The sifA gene, whose nucleotide sequence is SEQ ID NO:3,

[0049]

[0050] Specific primers were designed according to the gene sequences and synthesized by Ruibo Kexing. The primer sequences are shown in Table 3 (in the table, KD represents the knockout primer for the target gene; jd-N represents the inner identification primer for the target gene; jd-W represents the outer identification primer for the target gene);

[0051] Deletion primer design: Approximately 50 bp before and after the relA, manA, and sifA genes were selected as the homologous fragments of the primers (50 bp upstream and downstream each), and the upstream and downstream primer sequences of the chloramphenicol resistance gene of the amplification plasmid pKD3 were added to the 3' ends of the deletion primers respectively.

[0052] Deletion internal detection primer design: Primer sequences of about 20 bp upstream and downstream were designed on the sequences of the deleted genes (relA, manA, and sifA genes).

[0053] Deletion external detection primer design: Primer sequences of about 20 bp upstream and downstream were respectively selected from 200 - 300 bp upstream and downstream of the deleted genes (relA, manA, and sifA genes).

[0054] Table 1: Primer design information table

[0055]

[0056]

[0057] 2. Amplification of the targeting fragment

[0058] Using plasmid pKD3 as the template, the targeting fragments were amplified with the specific knockout primers for the relA, sifA, and manA genes (relA-KD-F, relA-KD-R; manA-KD-F, manA-KD-R; sifA-KD-F, sifA-KD-R, as shown in Table 1). The PCR amplification system and amplification program for the targeting fragments are shown in Table 2 and Table 3

[0059] Table 2: PCR amplification system table for the targeting fragments of relA, Asd, and manA genes

[0060]

[0061] Table 3: PCR amplification program table for preparing the targeting fragments

[0062]

[0063]

[0064] Using plasmid pKD3 as a template, PCR amplification of the targeting fragments was performed with relA-KD, manA-KD, and sifA-KD primers respectively. The fragment sizes were: 1072bp, 1035bp, and 1114bp. The obtained PCR products ( Figure 1 ) were sequenced and aligned to confirm that the sequences were consistent with the standard sequences, and then gel extraction was performed for standby.

[0065] Example 2: Construction of a triple-gene deletion strain

[0066] 1. Electroporation of plasmid pKD46 into SM14028 competent cells and verification

[0067] Pick a single colony of SM14028 into antibiotic-free LB liquid medium, culture overnight at 37°C with 220 r / min. The next day, transfer the bacterial solution to antibiotic-free LB liquid medium at a ratio of 1:100 to prepare competent cells. After pipetting and mixing evenly with a pre-cooled Pasteur pipette, aliquot the competent cells into 1.5 mL EP tubes, 100 μL per tube.

[0068] Add 10 μL of pKD46 to the aliquoted competent cells, incubate on ice for 30 min; then transfer them to a pre-cooled 1 mm Bio-Rad electroporation cuvette, perform electroporation using a Bio-Rad electroporator, and then place them on a shaker at 28°C for 1.5 h. After incubation, centrifuge at 5000 r / min for 5 min, discard the supernatant, leave 100 μL of the bacterial solution, spread it on LB / Amp solid medium, and culture overnight in an incubator at 28°C.

[0069] The next day, perform PCR identification with pKD46 discrimination primers, using plasmid pKD46 as a positive control. The strain containing plasmid pKD46 with correct identification was named SM14028-pKD46, and stored with 50% glycerol at -20°C in the refrigerator for standby.

[0070] 1.4.4 Electroporation of the targeting fragments into SM14028-pKD46 competent cells and verification

[0071] Pick a single colony of SM14028-pKD46 into LB / Amp liquid medium to prepare competent cells. Add the prepared relA, manA, and sifA targeting fragments to the aliquoted SM14028-pKD46 competent cells respectively. Immediately after electroporation, add 900 μL of antibiotic-free LB liquid medium containing 1 mol / L arabinose in a laminar flow hood, and culture overnight in an incubator at 28°C.

[0072] Pick a single colony and inoculate it into 1 mL of LB / Cm liquid medium. Culture it at 28 °C and 220 r / min until the bacterial solution becomes turbid. Perform bacterial solution PCR identification using the identification primers (relA-jd-N, relA-jd-W; manA-jd-N, manA-jd-W; sifA-jd-N, sifA-jd-W) in Table 3, and use the SM14028-pKD46 bacterial solution as a positive control. Screen the recombinant strains, purify the bacterial solution with no band detected inside and the correct band size detected outside, and preserve the strains with correct purification verification results for future use.

[0073] 2. Elimination and verification of plasmid pKD46

[0074] Transfer the strain with correct purification verification results to LB / Cm liquid culture medium, shake and culture it at 42 °C and 220 r / min for 15 h, then pick the bacterial solution and streak it on LB / Cm solid medium, and culture it in an incubator at 37 °C overnight. Finally, preserve the strain with successfully eliminated plasmid pKD46 for future use.

[0075] 3. Elimination and verification of chloramphenicol resistance gene

[0076] Prepare competent cells from the recombinant strain with eliminated plasmid pKD46, add 10 μL of plasmid pCP20 to this competent cell, and perform electrotransformation. Finally, preserve the bacterial solution with completely eliminated chloramphenicol resistance gene for future use.

[0077] 4. Elimination and verification of plasmid pCP20

[0078] Transfer the strain with correct identification to antibiotic-free LB liquid culture medium, culture it at 42 °C and 220 r / min for 15 h, then streak it on antibiotic-free LB solid medium, and culture it in an incubator at 37 °C overnight. Pick single colonies and inoculate them on LB / Amp solid medium and antibiotic-free LB solid medium respectively, and culture them overnight at 37 °C for resistance screening. Finally, preserve the correctly identified deletion strain for future use.

[0079] 5. Construction of double-gene deletion strain

[0080] 1) Electrotransfer plasmid pKD46 into ΔrelA-SM14028 competent cells and verification

[0081] Pick single colonies of the single-gene deletion strain (ΔrelA-SM14028) to prepare competent cells, and electrotransfer 10 μL of pKD46 plasmid into ΔrelA-SM14028 competent cells. After culture and bacterial solution PCR identification, name the strain with correct identification containing plasmid pKD46 as ΔrelA-SM14028-pKD46, and preserve it for future use.

[0082] 1.4.7.2 Electroporation of the targeting fragment into competent cells of ΔrelA-SM14028-pKD46 and verification

[0083] The single-gene deletion strain (ΔrelA-SM14028-pKD46) carrying the pKD46 plasmid was prepared into competent cells. 10 μL of the manA targeting fragment was respectively electroporated into the competent cells of ΔrelA-SM14028-pKD46. After culturing and identification by colony PCR, the strains with correct verification results were purified and stored for later use.

[0084] 2) Elimination and verification of plasmid pKD46

[0085] The strains with correct verification were treated to remove pKD46 according to the above method, and the final bacterial solution was stored for later use.

[0086] 3) Elimination and verification of the chloramphenicol resistance gene

[0087] The recombinant strains with plasmid pKD46 eliminated were treated to remove the chloramphenicol resistance gene according to the method, and the bacterial solution was stored for later use.

[0088] 4) Elimination and verification of plasmid pCP20

[0089] The correctly identified strains were treated to remove plasmid pCP20, and finally the double-gene deletion strain: Salmonella typhimurium ΔrelA-ΔmanA-SM14028 was screened out. The correctly identified deletion strains were sent for further identification.

[0090] 6. Construction of the triple-gene deletion strain

[0091] 1) Electroporation of plasmid pKD46 into competent cells of ΔrelA-ΔmanA-SM14028 and verification

[0092] Single colonies of the obtained double-gene deletion strain ΔrelA-ΔmanA-SM14028 were picked and prepared into competent cells. 10 μL of pKD46 plasmid was electroporated into the competent cells of ΔrelA-ΔmanA-SM14028. After culturing and identification by colony PCR, the strains containing plasmid pKD46 with correct identification results were named ΔrelA-ΔmanA-SM14028-pKD46 and stored for later use.

[0093] Result: The obtained double-gene deletion strain ΔrelA-ΔmanA-SM14028 was prepared into competent cells, and plasmid pKD46 was electroporated into them. The pKD46 in the bacterial solution was identified, and the identification results showed that plasmid pKD46 had been successfully electroporated into the competent cells of the double-gene deletion strain ( Figure 2 ), and this strain was named: ΔrelA-ΔmanA-SM14028-pKD46 and stored for later use.

[0094] 2) Electroporation of the targeting fragment into competent cells of ΔrelA-ΔmanA-SM14028-pKD4 and verification

[0095] Prepare competent cells of the double-gene deletion strain ΔrelA-ΔmanA-SM14028-pKD46 carrying the pKD46 plasmid. Electroporate 10 μL of the sifA targeting fragment into the competent cells of ΔrelA-ΔmanA-SM14028-pKD46. After culturing, perform colony PCR verification on the grown single colonies, purify the strain with correct verification results, and preserve the bacteria for future use.

[0096] Results: The sifA targeting fragment was electroporated into ΔrelA-ΔmanA-SM14028-pKD46 according to the steps, and colony PCR verification was performed on the strain. The verification results showed that the sifA targeting fragment was electroporated into ΔrelA-ΔmanA-SM14028-pKD46( Figure 3 ).

[0097] 3) Elimination and verification of plasmid pKD46

[0098] Remove pKD46 from the strain with correct verification, and finally preserve the bacterial solution for future use.

[0099] Results: According to the experimental steps, the pKD46 plasmid of the deletion strain was removed. The PCR identification results showed that the pKD46 plasmid had been removed from the deletion strain.

[0100] 4) Elimination and verification of the chloramphenicol resistance gene

[0101] 5) Eliminate the chloramphenicol resistance gene from the recombinant strain with the plasmid pKD46 eliminated, and finally preserve the bacterial solution for future use.

[0102] Remove the plasmid pCP20 from the strain with correct identification according to the above method. Finally, screen out Salmonella typhimurium ΔrelA-ΔmanA-ΔsifA-SM14028, and send the correctly identified deletion strain for identification.

[0103] Results: The results showed that the three-gene deletion strain ΔrelA-ΔmanA-ΔsifA had successfully eliminated the chloramphenicol resistance gene fragment and the PCP20 plasmid( Figure 5 ).

[0104] Example 3: Analysis of the biological characteristics of the three-gene deletion strain and the parental strain

[0105] 1. Identification of growth characteristics

[0106] Pick single colonies of the triple-gene deletion strain ΔrelA-ΔmanA-ΔsifA-SM14028 and the Salmonella typhimurium parental strain SM14028, and culture them overnight in LB liquid medium. The next day, adjust the OD600 nm to 1.0, and then transfer them to a new 5 mL LB liquid medium at a ratio of 1:100. Transfer 18 tubes for each strain, culture them at 37 °C, take out 1.5 mL of the bacterial solution every 1 h, measure the absorbance of the bacterial solution at OD600 nm at different times, continuously measure for 18 h, and use Graphpad prism to plot the growth curve.

[0107] Results: Continuously culture the obtained ΔrelA-ΔmanA-ΔsifA-SM14028 (screening strains 1 and 2) and the SM14028 bacterial solution in a shaker at 37 °C for 18 h. Take 1.5 mL of the bacterial solution every 1 h to measure OD600 nm, and plot the growth curves of the two screening strains of the ΔrelA-ΔmanA-ΔsifA-SM14028 deletion strain and SM14028 ( Figure 6 ). The results show that there is little difference in the growth rates between the two screening strains and SM14028.

[0108] 2. Phenotypic identification after deletion of the manA gene

[0109] Run the extracted LPS on an SDS-PAGE protein gel, and then perform silver staining using the Pierce Silver Stain Kit LPS silver staining kit. The specific steps are as follows:

[0110] 1) After SDS gel electrophoresis is completed, cut off the excess gel, place it in ultrapure water and wash it twice, 5 min each time;

[0111] 2) Place the gel in the fixing solution, fix it for 15 min first, and then fix it for another 15 min. Preparation method of the fixing solution: composed of ultrapure water, ethanol and glacial acetic acid in a ratio of 6:3:1;

[0112] 3) Wash the gel twice in 10% ethanol, 5 min each time, and then wash it twice in ultrapure water, 5 min each time;

[0113] 4) Place the gel in the working solution of the silver staining sensitizer for 1 min, and strict timing is required at this time; then wash it twice with ultrapure water, 1 min each time (working solution of the silver staining sensitizer: add 25 μL of sensitizer to 12.5 mL of ultrapure water);

[0114] 5) Incubate the gel in the working solution of the developing solution for 30 min; quickly wash it twice in ultrapure water, 20 s each time (working solution of the developing solution: 0.5 mL of enhancer plus 25 mL of staining agent);

[0115] 6) Incubate in the developing working solution for 2 - 3 min, and quickly wash twice in ultrapure water, 20 s each time (developing working solution: 0.5 mL enhancer plus 25 mL developer);

[0116] 7) Immediately place it in 5% acetic acid termination solution for 10 min until clear bands appear, transfer to ultrapure water, and observe by photographing with a gel imager.

[0117] Results: When the manA gene is deleted, it will lead to the obstruction of the synthesis of the O - antigen side chain of LPS, and the LPS structure formed thereby has the characteristics of a smooth type ( Figure 7 ). The LPS silver staining results show that compared with the parental strain, the LPS layer of the ΔrelA - ΔmanA - ΔsifA - SM14028 deletion strain is significantly reduced.

[0118] 3. Genetic stability detection of the triple - gene deletion strain

[0119] Pick a single colony of the ΔrelA - ΔmanA - ΔsifA - SM14028 triple - gene deletion strain and streak it on the corresponding antibiotic - free LB solid medium, and culture it overnight at 37°C. The next day, pick a single colony and streak it on the solid medium. After continuous passage for 15 generations, pick single colonies of the 2nd, 4th, 6th, 8th, 10th, and 15th generations respectively, and use the discriminatory primers in Table 3: relA - jd - N, relA - jd - W, manA - jd - N, manA - jd - W, sifA - jd - N, sifA - jd - W, to perform PCR identification on the bacterial liquid, and detect the genetic stability of the triple - gene deletion strain according to the band size.

[0120] Results: Pick a single colony of the ΔrelA - ΔmanA - ΔsifA - SM14028 and streak it on the corresponding antibiotic - free LB solid medium, and culture it overnight at 37°C. After continuous passage for 15 generations, pick single colonies of the F2, F4, F6, F8, F10, and F15 generations respectively, and perform bacterial liquid PCR verification. The verification results are as Figure 8 , and the results show that ΔrelA - ΔmanA - ΔsifA - SM14028 can still stably inherit in vitro after continuous passage for 15 generations.

[0121] Example 4: Safety evaluation of attenuated Salmonella

[0122] Randomly divide 150 6 - 8 - week - old Balb / c female mice into 15 groups, with 10 mice in each group. Pick a single colony of SM14028 into LB liquid medium and culture it overnight at 37°C. The next day, inoculate the bacterial liquid into LB liquid medium at a ratio of 1:100, and let it grow to the logarithmic growth phase, then centrifuge to collect the bacterial cells. Add an appropriate amount of PBS to resuspend the cells, and perform 10 - fold serial dilutions to make the bacterial liquid concentration 10 6CFU / mL, taking this as the highest bacterial suspension concentration, and the lowest bacterial suspension concentration is 10 1 CFU / mL. The bacterial suspension was inoculated orally. Each mouse in each experimental group was orally administered 100 μL of the bacterial suspension, and each mouse in each control group was orally administered 100 μL of PBS. The mortality rate was continuously recorded for 15 days, and finally the median lethal dose of the ΔrelA-ΔmanA-ΔsifA-SM1402 and the parental strain SM14028 strains was calculated using Reed-Muench method.

[0123] According to the plate colony counting, the challenge doses of each group were counted, and the LD of the SM14028 strain was calculated based on the number of surviving mice 50 was 9.55×10 1 CFU / mL, and the LD of the ΔrelA-ΔmanA-ΔsifA-SM14028 strain 50 was 4.79×10 7 CFU / mL. The LD of the strain 50 was 1.06×10 7 CFU / mL. The ΔrelA-ΔmanA-ΔsifA-SM14028 was 5.74×10 lower than the parental strain 6 times, and was 4 times lower than the ΔmanA-Δcrp-ΔrelA Salmonella choleraesuis (LD 50 1.4×10 7 ) of other experimental studies compared with its parental strain, indicating that the ΔrelA-ΔmanA-ΔsifA-SM14028 strain has extremely high safety. The specific challenge doses and the number of deaths are shown in Table 4 - Table 6.

[0124] Table 4: Results table of the LD of the SM14028 strain 50

[0125]

[0126] Table 5: Results table of the LD of the ΔrelA-ΔmanA-ΔsifA-SM14028 strain 50

[0127]

[0128] On the 2nd day after bacterial challenge: ΔrelA-ΔmanA-ΔsifA 10 6 , ΔrelA-ΔmanA-ΔsifA 10 8 , ΔrelA-ΔmanA -ΔsifA 10 10 In the challenged groups, individual mice showed disheveled hair and listlessness; on the 6th day after bacterial challenge, the status of each group of mice recovered; on the 14th day after bacterial challenge, no abnormalities were observed in each mouse (see Figure 9 ​​)。And the average body weight of ΔrelA-ΔmanA-ΔsifA-SM14028 mice challenged with each dose generally showed an upward trend (see Figure 10 ).

[0129] Example 5: Evaluation of the immunoprotective efficacy of attenuated Salmonella

[0130] Sixty 7-week-old female Balb / c mice were randomly divided into 6 groups of 10 mice each. They were divided into 3 immunization groups and 3 challenge control groups, and the bacterial solution was inoculated orally. The specific grouping is shown in the following table.

[0131] Table 7: Test plan and challenge situation table

[0132]

[0133] Observation of the clinical symptoms of mice after challenge and detection of the protection rate were as Figure 11 shown. On the 2nd day after challenge, all the mice in each group were normal; on the 6th day after challenge, the immunization groups were normal, and the mice in the SM14028 10000 CFU / mouse group of the challenge control group showed disheveled hair and listless state; on the 14th day after challenge, the immunization groups were normal, and all three challenge control groups (1000 CFU / mouse, 5000 CFU / mouse, and 10000 CFU / mouse) showed disheveled hair and listless state in the mice.

[0134] The protection rates of immunized ΔrelA-ΔmanA -ΔsifA SM14028 10 5 challenged with SM14028 at 1000 CFU / mouse, 5000 CFU / mouse, and 10000 CFU / mouse were all 100%; the mortality rate of the challenge control group with a challenge dose of 1000 CFU / mouse was 80%, and the mortality rates of the challenge doses of 5000 CFU / mouse and 10000 CFU / mouse were 100%. The results showed that ΔrelA -ΔmanA-ΔsifASM14028 could effectively resist the attack of the parental strain and could be used as a candidate vaccine strain or live vaccine vector of Salmonella.

[0135] Detection of the average body weight of mice after challenge was as Figure 12 shown. The average body weight of the immunized ΔrelA-ΔmanA-ΔsifA SM14028 immunization group was slightly higher than that of the mice in the challenge control group and tended to be stable.

[0136] In summary, the present invention uses the λ-Red homologous recombination technology to successfully construct an attenuated strain ΔrelA-ΔmanA-ΔsifA SM14028 of Salmonella typhimurium lacking three virulence factors, which can be stably inherited in vitro for 15 generations. Through safety evaluation tests, it is detected that the virulence reduction multiple of ΔrelA-ΔmanA-ΔsifA SM14028 compared with the parental strain is higher than that of ΔmanA-Δcrp-ΔrelA Salmonella choleraesuis compared with its parental strain. The virulence of this strain has significantly decreased, showing higher safety. To further evaluate whether ΔrelA-ΔmanA-ΔsifA SM14028 can resist the attack of the parental strain, an immune efficacy evaluation was carried out, and the results showed that ΔrelA-ΔmanA-ΔsifA SM14028 can provide effective immune protection.

[0137] In summary, the attenuated strain ΔrelA-ΔmanA-ΔsifA SM14028 of the present invention can be used as an effective live vaccine or live vector vaccine, laying a foundation for the prevention and control of animal diseases.

Claims

1. An attenuated Salmonella typhimurium, characterized in that, The attenuated Salmonella typhimurium described above is constructed by knocking out the relA gene, manA gene and sifA gene of Salmonella typhimurium.

2. The attenuated Salmonella typhimurium according to claim 1, characterized in that, The nucleotide sequence of the relA gene described above is SEQ ID NO:1, the nucleotide sequence of the manA gene is SEQ ID NO:2, and the nucleotide sequence of the sifA gene is SEQ ID NO:

3.

3. The attenuated Salmonella typhimurium according to claim 1, wherein For the relA gene described above, for the primer pair used to amplify the knockout fragment, the sequence of the forward primer is SEQ ID NO:4, and the sequence of the reverse primer is SEQ ID NO:

5.

4. The attenuated Salmonella typhimurium according to claim 1, wherein For the manA gene described above, for the primer pair used to amplify the knockout fragment, the sequence of the forward primer is SEQ ID NO:6, and the sequence of the reverse primer is SEQ ID NO:

7.

5. The attenuated Salmonella typhimurium according to claim 1, wherein For the sifA gene described above, for the primer pair used to amplify the knockout fragment, the sequence of the forward primer is SEQ ID NO:8, and the sequence of the reverse primer is SEQ ID NO:

9.

6. Use of the attenuated Salmonella typhimurium according to claim 1 in the preparation of a vaccine.

7. A vaccine, characterized in that, The antigen in the vaccine described above uses the attenuated Salmonella typhimurium according to claim 1.

Images