Recombinant goat pox virus, construction method and application thereof

Abstract

The invention belongs to the field of biology, and particularly relates to a recombinant goat pox virus as well as a construction method and application thereof. The method comprises the following steps: constructing a donor vector pGTPV-132LSDV-F2A-1322-P2A-GFP by utilizing a DNA (Deoxyribonucleic Acid) recombination technology, and then constructing a recombinant goat pox virus rGTPV-TK-750-1 (rGTPV-132) for stably expressing the LSDV 132 protein by taking a GTPV vaccine strain (AV41) as a framework and a TK gene as an insertion target spot through homologous recombination; the recombinant goat pox virus rGTPV-132 can stably express the LSDV 132 protein, has good hereditary stability and high virus titer, can be used as a strain for vaccine production, and lays a foundation for research, development and application of vaccines for preventing LSDV.

Description

Technical Field

[0001] The present invention belongs to the field of biology, and particularly relates to a recombinant goatpox virus, a construction method thereof and an application thereof. Background Art

[0002] Lumpy skin disease (LSD) is an acute and subacute infectious disease of cattle, caused by the lumpy skin disease virus (LSDV) of the genus Capripoxvirus in the family Poxviridae. The main clinical features are that diseased cattle have fever, swollen lymph nodes, and a large number of bumps appear on the skin surface, resulting in a sharp decline in the productivity of cattle and the milk production of dairy cows. In addition, if secondary bacterial infections occur, it is very likely to cause the death of cattle. Since LSD poses a great threat to the survival and production of cattle and will have a significant impact on the economy, it has been listed by the World Organization for Animal Health as one of the must-report diseases of cattle.

[0003] Currently, attenuated vaccines are generally used for prevention, but attenuated live vaccines cannot provide sufficient protection for all vaccinated animals, and often have adverse reactions. In addition, some attenuated live vaccines can proliferate and replicate in the vaccinated animals, increasing the risk of virus transmission in non-endemic areas.

[0004] Since LSDV has a high homology with the genomes of goatpox virus (GTPV) and sheeppox virus (SPPV), and the protein compositions are also basically the same, there are common antigens and extensive cross-neutralizing reactive antigens among the three. Therefore, in China, it is recommended to inoculate the goatpox virus vaccine strain GTPV-AV41 to prevent the transmission of LSDV.

[0005] The LSDV ORF132 gene is a unique gene of LSDV related to virulence and host range, and its encoded protein is in a significantly different branch from that of goatpox in the same genus. Considering specificity and linear epitope prediction, LSDV ORF132 is an ideal candidate antigen. Therefore, it is of great significance for the research and development of LSDV vaccines to construct a recombinant goatpox virus expressing LSDV 132 protein by using stable, efficient and safe DNA recombination technology.

[0006] Since the genome of goatpox virus is very large and its DNA is not infectious, it is not easy to ligate the corresponding gene into goatpox virus by direct restriction enzyme digestion and ligation methods. Therefore, selecting appropriate homologous recombination sites is the basis and key point for constructing a recombinant goatpox virus expressing LSDV132 protein. Although Chinese Patent No. 202110630538.0 uses the 132 gene of the goatpox virus vaccine strain GTPV-AV41 strain as a recombination arm to construct a recombinant goatpox virus expressing the LSDV ORF132 gene, its protective strength is reduced.

[0007] However, when goatpox virus undergoes in vitro DNA recombination, it is not easy to directly insert foreign genes at specific positions in its genome. It is necessary to construct a donor vector in vitro, and then transfect the recombinant donor vector into cells infected with the virus to obtain recombinant virus through homologous recombination. SUMMARY OF THE INVENTION

[0008] In view of the above technical problems, the present invention constructs a recombinant shuttle plasmid expressing LSDV 132 protein, then uses the GTPV vaccine strain (AV41) as a vector and the TK gene as an insertion target point, constructs a recombinant virus through homologous recombination, and then deletes the GFP gene in the recombinant virus through the Cre / loxp recombination system, and picks 4 monoclonal recombinant viruses; finally, the LSDV 132 gene and protein are identified by PCR and Western-blot to stably exist and express in the recombinant virus. Then the recombinant virus is inactivated and emulsified, and used to immunize cattle. The immunogenicity of the recombinant virus is evaluated by detecting the response level of sheeppox antibodies, and a recombinant goatpox virus rGTPV-TK-750-1 with a percentage protection is obtained.

[0009] Specifically, it includes the following content:

[0010] In the first aspect, the present invention provides a recombinant goatpox virus, which is obtained by using the TK gene of the goatpox virus vaccine strain GTPV-AV41 as a target point and inserting a gene fragment encoding LSDV 132 protein.

[0011] Preferably, the gene fragment encoding LSDV 132 protein is inserted and replaces the nucleotide sequence from position 56185 to position 56718 of the goatpox virus vaccine strain GTPV-AV41.

[0012] Preferably, the amino acid sequence of the LSDV 132 protein is as shown in SEQ SI NO.1.

[0013] Preferably, the nucleotide sequence of the LSDV 132 protein is as shown in SEQ SI NO.2.

[0014] Preferably, the gene fragment encoding LSDV 132 protein includes two tandem LSDV 132 gene expression cassettes; the LSDV 132 gene expression cassette includes a poxvirus promoter, two copies of the tandem LSDV 132 gene, and a transcription terminator.

[0015] Preferably, the two copies of the LSDV 132 gene in the LSDV 132 gene expression cassette are tandemly connected by 5 EAAAK motifs.

[0016] Preferably, the gene fragment encoding LSDV 132 protein includes in order: poxvirus promoter, two copies of LSDV 132 tandem gene, transcription terminator, poxvirus promoter, two copies of LSDV 132 tandem gene, transcription terminator, and Loxp sequence in the same direction.

[0017] Preferably, the poxvirus promoter is the poxvirus universal early and late promoter PE / L.

[0018] Preferably, the gene fragment encoding LSDV 132 protein is as shown in SEQ ID NO.3.

[0019] In a second aspect, the present invention provides a use of the recombinant goatpox virus described in the first aspect in the preparation of LSDV vaccine.

[0020] Preferably, the vaccine is an inactivated vaccine.

[0021] In a third aspect, the present invention provides a method for preparing the recombinant goatpox virus described in the first aspect, the preparation method comprising:

[0022] (1) synthesizing a gene fragment encoding LSDV 132 protein, and ligating it to the pVAX1 vector after restriction digestion to form a goatpox virus shuttle vector;

[0023] (2) Using the upstream and downstream sequences of the TK gene as the left and right homologous arms, the goatpox virus shuttle vector was recombined with the goatpox virus by homologous recombination technology;

[0024] (3) Screening and obtaining recombinant goatpox virus.

[0025] Preferably, the gene fragment encoding the LSDV 132 protein further comprises a screening gene expression frame, and the screening gene expression frame comprises a poxvirus promoter, a screening marker gene, and a transcription terminator.

[0026] Preferably, the gene fragment encoding LSDV 132 protein includes, in sequence: a poxvirus promoter, two copies of the LSDV 132 tandem gene, a transcription terminator, a poxvirus promoter, two copies of the LSDV 132 tandem gene, a transcription terminator, a co-directional Loxp sequence, a screening gene expression frame, and a co-directional Loxp sequence.

[0027] Preferably, the poxvirus promoter is the poxvirus universal early and late promoter PE / L.

[0028] Preferably, the gene fragment encoding LSDV 132 protein is shown as SEQ DI NO.4.

[0029] Preferably, the sequence of the left homologous arm is as shown in SEQ ID NO.5, and the sequence of the right homologous arm is as shown in SEQ ID NO.6.

[0030] Preferably, the Cre / loxp recombination system is used to remove the screening gene expression cassette of the recombinant goatpox virus obtained by screening in step (3) to obtain the recombinant goatpox virus.

[0031] The beneficial effects of the present invention are as follows: First, the present invention constructs a recombinant shuttle plasmid expressing LSDV 132 protein, then uses the GTPV vaccine strain (AV41) as a vector and the TK gene as an insertion target point, and constructs a recombinant virus through homologous recombination. On this basis, the GFP gene in the recombinant virus is deleted through the Cre / loxp recombination system, and 4 monoclonal recombinant viruses are selected; finally, the LSDV 132 gene and protein are identified by PCR and Western-blot to stably exist and express in the recombinant virus. Then, the recombinant virus is inactivated and emulsified, and immunized into cattle. The immunogenicity of the recombinant virus is evaluated by detecting the response level of sheeppox antibodies, and a recombinant goatpox virus rGTPV-TK-750-1 with percentage protection is obtained; second, the recombinant goatpox virus rGTPV-TK-750-1 has a high virus content and genetic stability; the attenuated vaccine prepared can produce a high antibody level after immunizing animals, has a percentage of protection after immunization and challenge, and has no virus excretion phenomenon, and has good safety, laying a foundation for the development of an efficient vaccine against bovine nodular dermatitis. Brief Description of the Drawings

[0032] Figure 1 Schematic diagram of the construction of four recombinant goatpox viruses;

[0033] Figure 2 Construction framework of the donor vector;

[0034] Figure 3 Screening results after transfection of the recombinant goatpox virus;

[0035] Figure 4 Results of recombinant goatpox virus clone selection;

[0036] Figure 5 Purified recombinant goatpox virus without GFP tag;

[0037] Figure 6 Results of indirect immunofluorescence detection of recombinant goatpox virus;

[0038] Figure 7 Amplification results of the 132 gene of the fourth generation of recombinant goatpox virus;

[0039] Figure 8 Results of genetic stability analysis of recombinant goatpox virus;

[0040] Figure 9 Detection results of immune bovine antibodies against four recombinant goatpox viruses;

[0041] Figure 10 Detection results of immune bovine antibodies against recombinant goatpox virus rGTPV-TK-750-1;

[0042] Figure 11 Virus challenge evaluation of four recombinant goatpox viruses rGTPV-132 in immunized animals. Specific implementation manners

[0043] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0044] The following embodiments are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the embodiments are carried out under conventional experimental conditions or according to the conditions recommended in the manufacturer's instructions.

[0045] The virus strains, plasmids and cells in the following embodiments are as follows: The goatpox virus vaccine strain GTPV-AV41 and the plasmid pVAX1-TK were provided by the Academy of Military Medical Sciences, and the OEF cells and Escherichia coli JM109 were constructed and preserved by this laboratory according to general methods.

[0046] The enzymes and reagents in the following embodiments: The indirect ELISA antibody detection kit for sheep pox was purchased from Biovetest; The DH5α competent cells and DL2000 DNA Marker were purchased from TaKaRa Biotechnology Co., Ltd. in Dalian; The DS15000 DNA Marker was purchased from TransGen Biotech Co., Ltd.; The restriction endonucleases HindⅢ, AvrⅡ, SalⅠ, SacⅠ, XhoⅠ, NheⅠ, NotⅠ, SacⅡ, SbfⅠ, SpeⅠ, AscⅠ, BamHⅠ, and T4 DNA ligase were products of NEB; HS DNA Polymerase is a product of TaKaRa; the genomic DNA extraction kit and the endotoxin-free plasmid extraction kit are purchased from Axygen; the vector pVAX1 is a product of Invitrogen; pRES2-AcGFP1 is a product of Clontech; the rabbit polyclonal antibody against LSDV 132 protein and the ovine embryo fibroblast (OEF) sheeppox indirect ELISA antibody detection kit are purchased from Biovetest; the DH5α competent cells and DL2000 DNA Marker are purchased from Dalian Takara Biotechnology Co., Ltd.; the DS15000 DNA Marker is purchased from TransGen Biotech Co., Ltd.; the restriction endonucleases HindⅢ, AvrⅡ, SalⅠ, SacⅠ, XhoⅠ, NheⅠ, NotⅠ, SacⅡ, SbfⅠ, SpeⅠ, AscⅠ, BamHⅠ, and T4 DNA ligase are products of NEB. HS DNA Polymerase is a product of TaKaRa; the genomic DNA extraction kit and the endotoxin-free plasmid extraction kit are purchased from Axygen; the vector pVAX1 is a product of Invitrogen; pRES2-AcGFP1 is a product of Clontech; the rabbit polyclonal antibody against LSDV 132 protein and the ovine embryonic fibroblast (OEF) are prepared in our laboratory; the goat anti-rabbit IgG-HRP is purchased from Abcam; Lipofectamine TM 2000 Transfection Reagent is purchased from Invitrogen; DMEM, OPTI-MEM culture medium, and fetal bovine serum are products purchased from Gibco. Fetal bovine serum is purchased from Gibco; MPA, Hypoxanthine, and Xanthine are purchased from Sigma. ) are prepared in our laboratory; the goat anti-rabbit IgG-HRP is purchased from Abcam; Lipofectamine TM 2000 Transfection Reagent is purchased from Invitrogen; DMEM, OPTI-MEM culture medium, and fetal bovine serum are products purchased from Gibco. Fetal bovine serum is purchased from Gibco; MPA, Hypoxanthine, and Xanthine are purchased from Sigma.

[0047] Example 1 Design of the recombinant shuttle vector

[0048] In combination with the needs of the present invention, a plasmid for virus recombination was designed. This plasmid contains the left and right homologous arms of the capripoxvirus TK gene, and in the middle position between the left and right homologous arms, there are vaccinia virus promoter sequences p7.5 and p11 (PE / L), and a multiple cloning site. Since there is no template for the promoter p7.5 and p11 genes and they cannot be obtained by PCR amplification, and the multiple cloning site in the vector also needs to be obtained by gene synthesis; therefore, the DNA synthesis method was used to concatenate these key elements. The construction strategies of four recombinant capripoxviruses (rGTPV-132-1, rGTPV-132-2, rGTPV-TK-750-1, rGTPV-TK-750-2) are as Figure 1 shown.

[0049] Among them, rGTPV-132-1 inserts the gene fragment shown in SEQ ID NO.7 into positions 130781 to 131698 of the nucleotide sequence of the capripoxvirus vaccine strain GTPV-AV41 by homologous recombination technology;

[0050] rGTPV-132-2 inserts the gene fragment shown in SEQ ID NO.4 into positions 130781 to 131698 of the nucleotide sequence of the capripoxvirus vaccine strain GTPV-AV41 by homologous recombination technology;

[0051] rGTPV-TK-750-1 inserts the gene fragment shown in SEQ ID NO.4 into positions 56185 to 56718 of the nucleotide sequence of the capripoxvirus vaccine strain GTPV-AV41 by homologous recombination technology;

[0052] rGTPV-TK-750-2 inserts the gene fragment shown in SEQ ID NO.7 into positions 56185 to 56718 of the nucleotide sequence of the capripoxvirus vaccine strain GTPV-AV41 by homologous recombination technology;

[0053] Endonuclease AvrⅡ and HindⅢ sequences were introduced at both ends of the synthetic gene, and after digestion with enzymes and ligation to the pVAX1 vector, the donor vector pGTPV-132LSDV-F2A-132-P2A-GFP was formed. The synthesis of the recombinant plasmid was completed by Wuhan Kingcare Bio-Tech Co., Ltd., as Figure 2 shown.

[0054] Finally, the Cre / loxp recombination system was removed through the Cre / loxp recombination system, and the corresponding recombinant capripoxviruses (rGTPV-132-1, rGTPV-132-2, rGTPV-TK-750-1, rGTPV-TK-750-2) were obtained.

[0055] Example 2 Construction of Recombinant Capripoxvirus

[0056] 1. Extraction of GTPV genome

[0057] Culture OEF cells in a cell flask until a monolayer is formed. Inoculate GTPV and incubate at 5% CO2 and 37 °C until 90% of the cells show cytopathic effect (CPE). Harvest the virus, freeze-thaw it three times at -80 °C. Take an appropriate amount of the virus suspension, extract the viral genomic DNA according to the instructions of the AxyPrep Genomic DNA Extraction Kit, measure its concentration, and store it at -20 °C for later use.

[0058] 2. Co-transfection of recombinant plasmid and GTPV genome into OEF cells

[0059] Culture OEF cells in a 6-well plate. After the cells grow into a monolayer, inoculate GPV onto the OEF cells in the 6-well plate at a multiplicity of infection (MOI) of 1 and adsorb at 37 °C for 2 h. Transfect the prepared recombinant transfer plasmid pftkpgigpi-132 using the liposome transfection method according to the instructions of the Lipofectamine TM 2000 Transfection Reagent Kit. Use 3 μg of the recombinant plasmid per well of cells, and simultaneously add 0.2 μg of GTPV genomic DNA. The amount of liposome used is approximately 3 times that of the DNA (mass / volume ratio), and dilute it with about 100 - 200 μL of OPTI-MEM. Observe under a fluorescence microscope after transfection. The appearance of fluorescence indicates that the plasmid has been transfected into the cells. At the same time, observe the occurrence of CPE in the cells. When obvious CPE appears in the cells and there is still fluorescence, freeze-thaw it three times, harvest the virus, and store it at -70 °C for use as the seed virus for subsequent screening.

[0060] The results are as Figure 3 shown. Transfect the recombinant donor plasmids pGTPV-132LSDV-F2A-132-P2A-GFP expressing recombinant goatpox virus (rGTPV-132-1, rGTPV-132-2, rGTPV-TK-750-1, rGTPV-TK-750-2) into OEF cells infected with GTPV. After 48 h of transfection, green fluorescence can be observed in all cases. At the same time, CPE occurs and gradually expands. The diseased cells with green fluorescence are mostly scattered, and the peak can be reached at about 72 - 96 h.

[0061] 3. Screening and purification of recombinant goatpox virus (rGTPV-132-GFP)

[0062] The recombinant goatpox virus was screened by a screening method combining the limiting dilution method and drug pressure. OEF cells were seeded on 96-well plates. After the cells grew into a monolayer, the selection culture medium (2.5% FBS, MPA 25 μg / mL, Xanthine 250 μg / mL, Hypoxanthine 15 μg / mL) was added and incubated for 16 - 24 h, and then the culture medium was discarded. The virus seed obtained above was serially diluted 10-fold, i.e., 10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 , and each dilution was inoculated into the OEF cells in the treated 96-well plates. 16 wells were inoculated for each dilution. The cells were cultured in a 5% CO2 incubator at 37 °C for 2 h to adsorb the virus, and then the pressure screening medium was replaced for continuous culture. The cytopathic effect was continuously observed, and at the same time, the fluorescence in each well was observed under a fluorescence microscope. The wells with a single fluorescent virus plaque were screened out, and the virus suspension in these wells was diluted and purified by the same method. The higher the dilution, the easier it was to screen out the recombinant virus from the diseased wells with fluorescence. A virus suspension containing a large number of fluorescent virus plaques was obtained. At this time, the virus suspension was diluted and inoculated on a 6-well plate for expansion culture, and the virus suspension was collected.

[0063] The purified recombinant goatpox virus (rGTPV-132-GFP) was obtained as Figure 4 shown. At this time, the suspensions of the recombinant viruses rGTPV-132-GFP (rGTPV-132-1, rGTPV-132-2, rGTPV-TK-750-1, rGTPV-TK-750-2) were collected and stored at -70 °C or below for later use.

[0064] 4. Removal of the GFP tag in the recombinant goatpox virus (rGTPV-132-GFP)

[0065] The Cre / loxp recombination system is derived from the Escherichia coli plasmid p1. This system includes the Cre recombinase and the loxP site. The Cre recombinase consists of 343 amino acids with a molecular weight of 38.5 kDa. It can recognize a specific DNA sequence (loxp) and can invert, excise, and translocate the gene sequence between the loxP sites. The loxP site is 34 bp in total, i.e., ATAACTTCGTATAGCATACATTATACGAAGTTAT (shown in SEQ ID NO.8), including two 13-bp inverted repeat sequences and an 8-bp spacer region. The two loxP sites are located on the same DNA strand and have the same direction, and the Cre recombinase knocks out the sequence between loxP.

[0066] Resuscitate OEF cells. Inoculate the OEF cells into a 6-well cell culture plate. When the cell density reaches approximately 80%, transfect the Cre enzyme expression vector according to the instructions of the Lipofectamine TM 2000 Transfection Reagent kit. After 2 hours of transfection, inoculate the recombinant goatpox virus (rGTPV-132-GFP) at different MOI doses. After culturing in a 37°C, 5% CO2 incubator for 6 hours, supplement 1 mL of medium and continue culturing. Observe the fluorescence after 48 hours. On the 3rd day after transfection, collect the OEF cells with reduced green fluorescence. After one freeze-thaw cycle, aspirate the supernatant, dilute it at a certain ratio, and inoculate it into OEF cells with a cell density of 80% (96-well cell culture plate). After culturing for 3 days, continue to collect the OEF cells with reduced green fluorescence and purify and screen them by the limiting dilution method. After several rounds of limiting dilution, obtain the recombinant goatpox virus (rGTPV-132) without the GFP tag. Identify the recombinant goatpox virus rGTPV-132 without the GFP tag by PCR method.

[0067] The results are as Figure 5 shown. The above-mentioned recombinant goatpox virus (rGTPV-132-GFP) screened in item 4 is used to knockout the sequence between loxP by the Cre / loxp recombination system using Cre recombinase, that is, delete the GFP gene. Immediately obtain the recombinant goatpox virus (rGTPV-132), continue to passage, obtain the recombinant goatpox virus with stable lesions, and store it at -70°C and below for standby

[0068] Example 3 Identification of Recombinant Goatpox Virus rGTPV-132

[0069] 1. Indirect Immunofluorescence Detection of Virus Antigen

[0070] Inoculate the transfected recombinant goatpox virus rGTPV-132-GFP into OEF cells, fix with 4% paraformaldehyde for 30 minutes, wash thoroughly with PBS, dropwise add the rabbit positive serum against LSDV 132 protein, incubate in a 37°C wet box for 30 minutes, after rinsing with PBS, add FITC-labeled goat anti-rabbit IgG, incubate in the dark in a 37°C wet box for 30 minutes, and then observe under an inverted microscope. At the same time, set normal OEF cells as the negative control.

[0071] Detect the OEF cells infected with the rGTPV-132-GFP strain and normal OEF cells by indirect immunofluorescence method. The results are as Figure 6As shown, specific green fluorescence was produced in OEF cells infected with the recombinant virus rGTPV-132-GFP strain, while no visible fluorescence was observed in the normal OEF cell control, indicating that the protein antigen component of 132 existed in the cells inoculated with the recombinant virus, further demonstrating the successful acquisition of the recombinant virus rGTPV-132-GFP.

[0072] 2. RT-PCR detection of the viral genome

[0073] On the basis of successfully obtaining the recombinant virus rGTPV-132-GFP verified in 1 above, the GFP tag was removed from the recombinant goatpox virus rGTPV-132-GFP according to Example 2 to obtain the recombinant goatpox virus rGTPV-132; the recombinant goatpox virus rGTPV-132 that had been continuously passaged to the fourth generation after transfection and the untransfected negative control cells were collected, total DNA was extracted, the 132 gene was amplified by PCR, and the sequencing was sent to Beijing Aoke Biotechnology Co., Ltd.

[0074] Amplification primers:

[0075] LSDV-132-F: 5'CATGACAAATACTTCCCTCC 3' (shown in SEQ ID NO.9);

[0076] LSDV-132-R: 5'TTATTTATAAAATATATGTTT 3' (shown in SEQ ID NO.10).

[0077] PCR identification of the recombinant goatpox virus rGTPV-132 After extracting the total DNA from the cell virus that had been continuously passaged to the 4th generation after transfection, the 132 gene was amplified by PCR. The results were as Figure 7 shown. The results after sequencing showed that the amplified gene fragment was contained in the obtained recombinant virus. No target fragment was amplified in the normal OEF cell control.

[0078] 3. TCID of the recombinant goatpox virus 50 Determination

[0079] The adapted and stable recombinant goatpox virus rGTPV-132 was serially diluted 10-fold with the maintenance solution. Take 10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 、10 -9A total of 6 dilutions were prepared. For each dilution, 8 wells of a 96-well plate were inoculated with 100 μl per well, and then 100 μl of cell suspension was added to each well. At the same time, 4 - 8 wells of normal cell control were set up. After inoculation, the cells were cultured in an incubator at 37 °C with 5% CO2 for 48 - 72 hours. The cytopathic effect was observed under a microscope daily. According to the number of wells showing cytopathic effect, the TCID was calculated using the Reed-Muench method. 50 。

[0080] The results are shown in Table 1. The recombinant goatpox virus rGTPV - 132 could induce typical and obvious CPE in OEF cells within 4 passages. The virus harvest time for BF5 - BF 10 cytotoxin was 48 - 60 hours, and the virus content in each milliliter of culture medium reached 10 7.0 TCID 50 . This indicates that the virus has good adaptability to OEF cells and a high virus content.

[0081] Table 1 Virus content of recombinant goatpox virus

[0082]

[0083] 4. Genetic stability of recombinant goatpox virus

[0084] After adapting the recombinant goatpox virus rGTPV - 132 to OEF cells, it was continuously passaged to 30 generations. The 132 sequences of BF5, BF 10 , BF 15 , BF 20 , BF 25 and BF 30 were detected, and the genetic stability of the virus strain was analyzed based on the homology of the 132 sequences of each generation.

[0085] The results are as Figure 8 shown, indicating that the recombinant virus was not lost in different generations, proving the stable existence of the 132 gene in the recombinant virus.

[0086] Example 4 Immunogenicity of recombinant goatpox virus rGTPV - 132 strain

[0087] 1. Inactivation and emulsification of recombinant goatpox virus rGTPV - 132

[0088] The obtained recombinant goatpox virus (rGTPV - 132 - 1, rGTPV - 132 - 2, rGTPV - TK - 750 - 1, rGTPV - TK - 750 - 2) liquid was inactivated with the inactivator divinylimine. After centrifugation at 8000 rpm / min for 10 min, it was emulsified with an equal volume of 206 adjuvant to prepare an inactivated goatpox vaccine.

[0089] 2. Immunization with recombinant goatpox virus rGTPV - 132

[0090] Twenty-three Holstein cows were purchased from a cattle farm in Wuwei City, Gansu Province. Serum was collected after blood sampling. The samples were detected negative by the indirect ELISA method for sheeppox antibody (NY / T 576-2002). The 23 cows were randomly divided into 5 groups, including 4 immunized groups with 5 cows in each group. The immunogens were inactivated recombinant goatpox virus rGTPV-132 (rGTPV-132-1, rGTPV-132-2, rGTPV-TK-750-1, rGTPV-TK-750-2); another group with 3 cows was the control group. The specific grouping, immunization route and dosage are shown in Table 2. Serum was collected on the 7th, 14th and 21st days after immunization with recombinant goatpox virus, and the antibody level in each group was detected by the indirect ELISA method for sheeppox antibody.

[0091] Table 2 Grouping, immunization route and dosage

[0092]

[0093] The detection results of antibody response levels are as Figure 9 shown. Compared with the control group, the antibody response levels of other immunized groups were all increased. And compared with rGTPV-132-1, rGTPV-132-2 and rGTPV-TK-750-2, the recombinant virus rGTPV-TK-750-1 described in this application had a higher antibody response level. Among them, the recombinant virus rGTPV-TK-750-1 (in subsequent studies, the recombinant virus rGTPV-TK-750-1 was named rGTPV-132) started to respond 7 days after immunization. After 14 days, the antibodies of all 5 experimental cows immunized turned positive, and then continued to increase ( Figure 10 shown).

[0094] 3. Viral challenge evaluation of animals immunized with recombinant goatpox virus rGTPV-132

[0095] Five cows from the immunized group in 2 and three cows from the control group, a total of 23 cows, were all injected with 2×10 6 TCID 50 / 2.0 ml of LSDV / Hainan / 2021 strain cytotoxicity; after viral challenge, nasal swabs, anal swabs and venous blood of the experimental cows were collected every 1 day, and the formation of skin nodules on the experimental cows was observed. Observation was continued for 28 days. All cows in the control group should develop the disease, and at least 4 cows in the immunized group should be protected. (Disease criteria: During the test period, the appearance of typical nodules in any part of the whole body skin and mucous membranes (conjunctiva, nasal mucosa and oral mucosa) caused by the virus of nodular dermatitis was judged as the onset of the disease). Immunization efficacy evaluation = comprehensive score. The integral ≥10 was determined as the onset of the disease and not protected.

[0096] The results are as Figure 11As shown, the immunoprotective efficacy of the recombinant goatpox virus rGTPV-132-1 was 60%, and the immunoprotective efficacies of the recombinant goatpox viruses rGTPV-132-2 and rGTPV-TK-750-2 were 80%. However, the recombinant goatpox virus rGTPV-TK-750-1 described in the present application had 100% protective efficacy against the challenge of the LSDV / Hainan / 2021 strain cytotoxin.

[0097] Among them, the statistical results of various indicators after the challenge of the recombinant goatpox virus rGTPV-TK-750-1 are shown in Table 3. No nodules formed on the body surfaces of the immunized cattle, there was no virus excretion, and transient nucleic acid positivity in the blood was occasionally seen. In contrast, the control cattle began to excrete the virus on the 12th day after the challenge, developed viremia, which lasted for more than 6 days, and systemic nodules appeared. Thus, it can be seen that the inactivated recombinant goatpox virus rGTPV-TK-750-1-immunized cattle can resist the attack of the lumpy skin disease virus.

[0098] Table 3 Statistical results of various indicators of experimental cattle after the challenge

[0099]

[0100] In summary, the present invention constructed a recombinant shuttle plasmid expressing the LSDV 132 protein, then used the GTPV vaccine strain (AV41) as a vector and the TK gene as an insertion target, and constructed a recombinant virus through homologous recombination. On this basis, the GFP gene in the recombinant virus was deleted through the Cre / loxp recombination system, and 4 monoclonal recombinant viruses were selected; finally, the LSDV 132 gene and protein were identified to be stably present and expressed in the recombinant virus by PCR and Western-blot. Then the recombinant virus was inactivated and emulsified, and cattle were immunized. The immunogenicity of the recombinant virus was evaluated by detecting the response level of sheeppox antibodies, and a recombinant goatpox virus rGTPV-TK-750-1 with percentage protection (subsequently named rGTPV-132) was obtained; the recombinant goatpox virus rGTPV-132 had a high virus content and genetic stability; the attenuated vaccine prepared produced a high antibody level after immunizing animals, had percentage protection after immunization and challenge, and had no virus excretion phenomenon, and had good safety, laying a foundation for the development of an efficient vaccine against lumpy skin disease.

[0101] Homologous recombination technology is to introduce homologous DNA fragments into recipient cells, viruses or plasmids. Constructing plasmids by homologous recombination method is to introduce the same specific sequences at both ends of the target DNA fragment and the vector DNA fragment, and through seamless cloning or recombinase cloning technology, an exchange occurs between two nucleotide sequences with exactly the same sequence, so as to achieve the recombination of the target gene and the vector. The recombination reaction does not require restriction enzyme digestion of the target gene, and any restriction enzyme site on the vector can be selected. Since this recombinant virus selects dominant genes and can modify the viral genome at the DNA level, the structure and function of the genome are studied through changes in the phenotype of the recombinant virus. To provide a theoretical basis for the development of new bovine nodule vaccines, existing research has confirmed that goatpox virus as a vector has been used in the research of recombinant animal disease vaccines such as influenza and pseudorabies. With the development in recent years, the research on animal diseases using DNA homologous recombination technology as an operation platform has become more and more extensive and in-depth, especially having unique advantages in the development of highly efficient vaccines.

Claims

1. A recombinant goatpox virus, characterized in that, The recombinant goatpox virus is obtained by targeting the TK gene of the goatpox virus vaccine strain GTPV-AV41 and inserting a gene fragment encoding the LSDV 132 protein.

2. The recombinant goatpox virus according to claim 1, characterized in that, The gene fragment encoding the LSDV 132 protein is inserted into and replaces the 56185th to 56718th positions of the nucleotide sequence of the goatpox virus vaccine strain GTPV-AV41.

3. The recombinant goatpox virus according to claim 2, wherein The gene fragment encoding the LSDV 132 protein includes two tandem LSDV 132 gene expression cassettes; the LSDV 132 gene expression cassette includes a poxvirus promoter, two copies of the tandem LSDV 132 gene, and a transcription terminator.

4. The recombinant goatpox virus according to claim 3, wherein The gene fragment encoding the LSDV 132 protein sequentially includes: a poxvirus promoter, two copies of the tandem LSDV 132 gene, a transcription terminator, a poxvirus promoter, two copies of the tandem LSDV 132 gene, a transcription terminator, and direct Loxp sequences; the gene fragment encoding the LSDV 132 protein is as shown in SEQ ID NO.

3.

5. Use of the recombinant goatpox virus according to any one of claims 1-4 in the preparation of an LSDV vaccine.

6. The preparation method of the recombinant goatpox virus according to any one of claims 1-4, characterized in that, The preparation method includes: (1) Synthesize a gene fragment encoding the LSDV 132 protein, digest it with enzymes and ligate it to the pVAX1 vector to form a goatpox virus shuttle vector; (2) Using the upstream and downstream sequences of the TK gene as the left and right homologous arms, recombine the goatpox virus shuttle vector with the goatpox virus by homologous recombination technology; (3) Screen to obtain the recombinant goatpox virus.

7. The preparation method according to claim 6, characterized in that, The gene fragment encoding the LSDV 132 protein further includes a selection gene expression cassette, and the selection gene expression cassette includes a poxvirus promoter, a selection marker gene, and a transcription terminator.

8. The preparation method according to claim 7, characterized in that, The gene fragment encoding the LSDV 132 protein sequentially includes: a poxvirus promoter, two copies of the tandem LSDV 132 gene, a transcription terminator, a poxvirus promoter, two copies of the tandem LSDV 132 gene, a transcription terminator, direct Loxp sequences, a selection gene expression cassette, and direct Loxp sequences; the gene fragment encoding the LSDV 132 protein is as shown in SEQ DINO.

4.

9. The preparation method according to claim 8, wherein, The sequence of the left homologous arm is as shown in SEQ ID NO.5, and the sequence of the right homologous arm is as shown in SEQ ID NO.

6.

10. The preparation method according to claim 9, characterized in that, Use the Cre / loxp recombination system to remove the selection gene expression cassette of the recombinant goatpox virus obtained by screening in step (3) to obtain the recombinant goatpox virus.

Images