CRISPR / Cas9 library high-throughput screening method for lung cancer bone metastasis related genes
By constructing an sgRNA library of SLC and ABC transporter-related genes, screening lung cancer bone metastasis-related genes, solving the targeted and efficient screening in the existing technology, achieving accurate screening of key genes for lung cancer bone metastasis, and providing new targets for treatment.
Patent Information
- Application Number
- CN202510257709.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-07-04
AI Technical Summary
The existing technology has failed to effectively use the CRISPR/Cas9 library screening technology to screen lung cancer bone metastasis-related genes, which lacks targetedness and efficiency.
The sgRNA library of SLC transporter and ABC transporter related genes was constructed, host cells were packaged and infected by lentivirus, and inoculated in the left ventricle of athymic nude mice, tumor tissues of suprablastoma were screened, and candidate genes were screened through second-generation sequencing.
The scope of application of the CRISPR/Cas9 library has been broadened, and the key genes that regulate bone metastasis of lung cancer are accurately and efficiently screened out, providing new targets for the prevention and treatment of bone metastasis of lung cancer.
Smart Images

Figure CN120249395A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of high-throughput gene screening, and particularly to a high-throughput screening method for a CRISPR / Cas9 library of genes related to lung cancer bone metastasis. Background Art
[0002] The CRISPR / Cas9 gene editing technology designs an sgRNA of about 20 bp to guide the Cas9 protein to specifically cut the target DNA. Subsequently, the cell repairs the broken DNA through non-homologous end joining or homologous recombination, resulting in gene insertion or deletion, thereby achieving directional editing. The CRISPR / Cas9 library screening involves designing an sgRNA library targeting multiple genes and introducing it into host cells through lentivirus. Under specific screening conditions, some cells die due to gene mutations. The enriched sgRNAs in the surviving cells are analyzed by high-throughput sequencing to determine the corresponding genes, thereby identifying the key genes affecting the phenotype. This method is widely used in the screening of disease-related genes to support the study of disease mechanisms and the discovery of therapeutic targets.
[0003] To maintain survival and normal functions, cells must precisely monitor and control the material exchange within the cell. Transporters play a key role in this process. They allow specific molecules such as metabolites and ions to cross the lipid bilayer in and out of the cell, thereby regulating nutrient levels, removing waste, and maintaining cell volume. According to their structural and functional characteristics, transporters can be subdivided into four main superfamilies: ATP-binding cassette (ABC) transporters, ATPases, ion channels, and solute carrier proteins (SLC). Transporters, especially members of the SLC superfamily, play an indispensable role in regulating cell physiological functions and have become key targets for the treatment of various diseases.
[0004] However, currently, no researcher has proposed how to apply the CRISPR / Cas9 library screening technology to the study of lung cancer bone metastasis targeting transporters. Summary of the Invention
[0005] The purpose of the present invention is to provide a high-throughput screening method for a CRISPR / Cas9 library of genes related to lung cancer bone metastasis in view of the deficiencies in the prior art.
[0006] To achieve the above purpose, the technical solution adopted by the present invention is:
[0007] Provide a high-throughput screening method for a CRISPR / Cas9 library of candidate genes related to lung cancer bone metastasis, including the following steps:
[0008] Step 1, construct an sgRNA library of genes related to SLC transporters and ABC transporters; package the sgRNA library with lentivirus to obtain a plasmid library;
[0009] Step 2: Transduce the lentivirus into host cells using a low multiplicity of infection (MOI) to ensure that each cell takes in only one sgRNA on average, and screen to obtain cells stably expressing the sgRNA library.
[0010] Step 3: Inoculate the cells after lentivirus infection into the left ventricle of nude mice without thymus.
[0011] Step 4: Remove the tumor tissues that have formed tumors on the bone, extract genomic DNA, construct a library for second-generation sequencing of the targeting region of the sgRNA, and screen for candidate genes related to bone metastasis of lung cancer by comparing the abundance changes of sgRNAs before and after.
[0012] Furthermore, the SLC transporter-related genes are: SLC1A1, SLC1A2, SLC1A3, SLC1A4, SLC1A5, SLC1A6, SLC1A7, SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A6, SLC2A7, SLC2A8, SLC2A9, SLC2A10, SLC2A11, SLC2A12, SLC2A13, SLC2A14, SLC3A1, SLC3A2, SLC4A1, SLC4A2, SLC4A3, SLC4A4, SLC4A5, SLC4A7, SLC4A8, SLC4A9, SLC4A10, SLC4A11, SLC5A1, SLC5A2, SLC5A3, SLC5A4, SLC5A5, SLC5A6, SLC5A7, SLC5A8, SLC5A9, SLC5A10, SLC5A11, SLC5A12, SLC6A1, SLC6A2, SLC6A3, SLC6A4, SLC6A5, SLC6A6, SLC6A7, SLC6A8, SLC6A9, SLC6A11, SLC6A12, SLC6A13, SLC6A14, SLC6A15, SLC6A16, SLC6A17, SLC6A18, SLC6A19, SLC6A20, SLC7A1, SLC7A2, SLC7A3, SLC7A4, SLC7A5, SLC7A6, SLC7A7, SLC7A8, SLC7A9, SLC7A10, SLC7A11, SLC7A13, SLC7A14, SLC8A1, SLC8A2, SLC8A3, SLC8B1, SLC9A1, SLC9A2, SLC9A3, SLC9A4, SLC9A5, SLC9A6, SLC9A7, SLC9A8, SLC9A9, SLC9B1, SLC9B2, SLC9C1, SLC9C2, SLC10A1, SLC10A2, SLC10A3, SLC10A4, SLC10A5, SLC10A6, SLC10A7, SLC11A1, SLC11A2, SLC12A1, SLC12A2, SLC12A3, SLC12A4, SLC12A5, SLC12A6, SLC12A7, SLC12A8, SLC12A9, SLC13A1, SLC13A2, SLC13A3, SLC13A4, SLC13A5, SLC14A1_UT-B1, SLC14A1_UT-B2, SLC14A2_UT-A2, SLC15A1, SLC15A2, SLC15A3, SLC15A4, SLC16A1, SLC16A2, SLC16A3, SLC16A4, SLC16A5,SLC16A6, SLC16A7, SLC16A8, SLC16A9, SLC16A10, SLC16A11, SLC16A12, SLC16A13, SLC16A14, SLC17A1, SLC17A2, SLC17A3, SLC17A4, SLC17A5, SLC17A6, SLC17A7, SLC17A8, SLC17A9, SLC18A1, SLC18A2, SLC18A3, SLC18B1, SLC19A1, SLC19A2, SLC19A3, SLC20A1, SLC20A2, SLCO2A1, SLCO4A1, SLCO5A1, SLCO3A1, SLCO6A1, SLCO1A2, SLCO2B1, SLCO1B1, SLCO1B3, SLCO4C1, SLCO1C1, SLC22A1, SLC22A2, SLC22A3, SLC22A4, SLC22A5, SLC22A6, SLC22A7, SLC22A8, SLC22A9, SLC22A10, SLC22A11, SLC22A12, SLC22A13, SLC22A14, SLC22A15, SLC22A16, SLC22A17, SLC22A18, SLC22A23, SLC22A24, SLC22A25, SLC22A31, SLC23A1, SLC23A2, SLC23A3, SLC24A1, SLC24A2, SLC24A3, SLC24A4, SLC24A5, SLC25A1, SLC25A2, SLC25A3, SLC25A4, SLC25A5, SLC25A6, SLC25A7, SLC25A8, SLC25A9, SLC25A10, SLC25A11, SLC25A12, SLC25A13, SLC25A14, SLC25A15, SLC25A16, SLC25A17, SLC25A18, SLC25A19, SLC25A20, SLC25A21, SLC25A22, SLC25A23, SLC25A24, SLC25A25, SLC25A26, SLC25A27, SLC25A28, SLC25A29, SLC25A30, SLC25A31, SLC25A32, SLC25A33, SLC25A34, SLC25A35, SLC25A36, SLC25A37, SLC25A38, SLC25A39, SLC25A40, SLC25A41, SLC25A42, SLC25A43, SLC25A44, SLC25A45, SLC25A46, SLC25A47, SLC25A48, SLC25A49SLC25A50, SLC25A51, SLC25A52, SLC25A53, SLC26A1, SLC26A2, SLC26A3, SLC26A4, SLC26A5, SLC26A6, SLC26A7, SLC26A8, SLC26A9, SLC26A10, SLC26A11, SLC27A1, SLC27A2, SLC27A3, SLC27A4, SLC27A5, SLC27A6, SLC28A1, SLC28A2, SLC28A3, SLC29A1, SLC29A2, SLC29A3, SLC29A4, SLC30A1, SLC30A2, SLC30A3, SLC30A4, SLC30A5, SLC30A6, SLC30A7, SLC30A8, SLC30A9, SLC30A10, SLC31A1, SLC31A2, SLC32A1, SLC33A1, SLC34A1, SLC34A2, SLC34A3, SLC35A1, SLC35A2, SLC35A3, SLC35A4, SLC35A5, SLC35B1, SLC35B2, SLC35B3, SLC35B4, SLC35C1, SLC35C2, SLC35D1, SLC35D2, SLC35D3, SLC35E1, SLC35E2B, SLC35E3, SLC35E4, SLC35F1, SLC35F2, SLC35F3, SLC35F4, SLC35F5, SLC35F6, SLC35G1, SLC35G2, SLC35G3, SLC35G4, SLC35G5, SLC35G6, SLC36A1, SLC36A2, SLC36A3, SLC36A4, SLC37A1, SLC37A2, SLC37A3, SLC37A4, SLC38A1, SLC38A2, SLC38A3, SLC38A4, SLC38A5, SLC38A6, SLC38A7, SLC38A8, SLC38A9, SLC38A10, SLC38A11, SLC39A1, SLC39A2, SLC39A3, SLC39A4, SLC39A5, SLC39A6, SLC39A7, SLC39A8, SLC39A9, SLC39A10, SLC39A11, SLC39A12, SLC39A13, SLC39A14, SLC40A1, SLC41A1, SLC41A2, SLC41A3, SLC42A1, SLC42A2, SLC42A3, SLC43A1, SLC43A2, SLC43A3, SLC44A1, SLC44A2, SLC44A3, SLC44A4, SLC44A5SLC45A1, SLC45A2, SLC45A3, SLC45A4, SLC46A1, SLC46A2, SLC46A3, SLC47A1, SLC47A2, SLC48A1, SLC49A1, SLC49A2, SLC49A3, SLC49A4, SLC50A1, SLC51A, SLC51B, SLC52A1, SLC52A2, SLC52A3, SLC53A1, SLC54A1, SLC54A2, SLC55A1, SLC55A2, SLC55A3, SLC56A1, SLC56A2, SLC56A3, SLC56A4, SLC56A5, SLC57A1, SLC57A2, SLC58A1, SLC58A2, SLC62A1, SLC65A1, SLC65A2, SLC66A1, SLC66A2, SLC66A3, SLC66A4, SLC66A5; the ABC transporter-related genes are ABCA1, ABCA2, ABCA3, ABCA4, ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCA10, ABCA12, ABCA13, ABCB1, ABCB2, ABCB3, ABCB4, ABCB5, ABCB6, ABCB7, ABCB8, ABCB9, ABCB10, ABCB11, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5, ABCC6, ABCC7, ABCC8, ABCC9, ABCC10, ABCC11, ABCC12, ABCD1, ABCD2, ABCD3, ABCD4, ABCE1, ABCF1, ABCF2, ABCF3, ABCG1, ABCG2, ABCG4, ABCG5, ABCG8.
[0013] Further, the specific steps of step one are as follows:
[0014] (1) Provide nucleic acid construct A-B-C;
[0015] Wherein, A is a left homologous arm sequence upstream of the coding sequence of the sgRNA of the SLC transporter and ABC transporter-related genes; B is the coding sequence of the sgRNA of the SLC transporter and ABC transporter-related genes; C is a right homologous arm sequence downstream of the coding sequence of the sgRNA of the SLC transporter and ABC transporter-related genes;
[0016] (2) Using the nucleic acid construct A-B-C as a template, perform PCR amplification to obtain an amplification product;
[0017] (3) Cloning the amplified product into an expression vector, linearizing the expression vector, and then introducing it into competent Escherichia coli cells by electroporation technology, and screening positive clones to obtain a plasmid library of SLC transporter and ABC transporter related genes.
[0018] Furthermore, the nucleotide sequence of the left homology arm A is shown as SEQ ID NO:1, and the nucleotide sequence of the right homology arm C is shown as SEQ ID NO:2.
[0019] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:
[0020] The present invention targets the blank area of high-throughput screening of genes related to lung cancer bone metastasis. For the first time, cells infected with sgRNA libraries of SLC transporter and ABC transporter related genes are injected into the left ventricle to form tumors, so as to screen key genes that promote bone metastasis of lung cancer tumor cells. This broadens the scope of use of CRISPR / Cas9 libraries, and can accurately and efficiently mine key genes that regulate lung cancer bone metastasis, providing new targets for the prevention and treatment of lung cancer bone metastasis. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Schematic diagram of the high-throughput screening method of the present invention.
[0022] Figure 2 This is the distribution diagram of RRA scores of genes in the library in negative screening. DETAILED DESCRIPTION
[0023] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but is not intended to be limiting of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention may be combined with each other without conflict.
[0024] Example 1
[0025] 1) Construction of sgRNA libraries for SLC transporter and ABC transporter related genes
[0026] SLC transporter-related genes are: SLC1A1, SLC1A2, SLC1A3, SLC1A4, SLC1A5, SLC1A6, SLC1A7, SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A6, SLC2A7, SLC2A8, SLC2A9, SLC2A10, SLC2A11, SLC2A12, SLC2A13, SLC2A14, SLC3A1, SLC3A2, SLC4A1, SLC4A2, SLC4A3, SLC4A4, SLC4A5, SLC4A7, SLC4A8, SLC4A9, SLC4A10, SLC4A11, SLC5A1, SLC5A2, SLC5A3, SLC5A4, SLC5A5, SLC5A6, SLC5A7, SLC5A8, SLC5A9, SLC5A10, SLC5A11, SLC5A12, SLC6A1, SLC6A2, SLC6A3, SLC6A4, SLC6A5, SLC6A6, SLC6A7, SLC6A8, SLC6A9, SLC6A11, SLC6A12, SLC6A13, SLC6A14, SLC6A15, SLC6A16, SLC6A17, SLC6A18, SLC6A19, SLC6A20, SLC7A1, SLC7A2, SLC7A3, SLC7A4, SLC7A5, SLC7A6, SLC7A7, SLC7A8, SLC7A9, SLC7A10, SLC7A11, SLC7A13, SLC7A14, SLC8A1, SLC8A2, SLC8A3, SLC8B1, SLC9A1, SLC9A2, SLC9A3, SLC9A4, SLC9A5, SLC9A6, SLC9A7, SLC9A8, SLC9A9, SLC9B1, SLC9B2, SLC9C1, SLC9C2, SLC10A1, SLC10A2, SLC10A3, SLC10A4, SLC10A5, SLC10A6, SLC10A7, SLC11A1, SLC11A2, SLC12A1, SLC12A2, SLC12A3, SLC12A4, SLC12A5, SLC12A6, SLC12A7, SLC12A8, SLC12A9, SLC13A1, SLC13A2, SLC13A3, SLC13A4, SLC13A5, SLC14A1_UT-B1, SLC14A1_UT-B2, SLC14A2_UT-A2, SLC15A1, SLC15A2, SLC15A3, SLC15A4, SLC16A1, SLC16A2, SLC16A3, SLC16A4, SLC16A5, SLC16A6,SLC16A7, SLC16A8, SLC16A9, SLC16A10, SLC16A11, SLC16A12, SLC16A13, SLC16A14, SLC17A1, SLC17A2, SLC17A3, SLC17A4, SLC17A5, SLC17A6, SLC17A7, SLC17A8, SLC17A9, SLC18A1, SLC18A2, SLC18A3, SLC18B1, SLC19A1, SLC19A2, SLC19A3, SLC20A1, SLC20A2, SLCO2A1, SLCO4A1, SLCO5A1, SLCO3A1, SLCO6A1, SLCO1A2, SLCO2B1, SLCO1B1, SLCO1B3, SLCO4C1, SLCO1C1, SLC22A1, SLC22A2, SLC22A3, SLC22A4, SLC22A5, SLC22A6, SLC22A7, SLC22A8, SLC22A9, SLC22A10, SLC22A11, SLC22A12, SLC22A13, SLC22A14, SLC22A15, SLC22A16, SLC22A17, SLC22A18, SLC22A23, SLC22A24, SLC22A25, SLC22A31, SLC23A1, SLC23A2, SLC23A3, SLC24A1, SLC24A2, SLC24A3, SLC24A4, SLC24A5, SLC25A1, SLC25A2, SLC25A3, SLC25A4, SLC25A5, SLC25A6, SLC25A7, SLC25A8, SLC25A9, SLC25A10, SLC25A11, SLC25A12, SLC25A13, SLC25A14, SLC25A15, SLC25A16, SLC25A17, SLC25A18, SLC25A19, SLC25A20, SLC25A21, SLC25A22, SLC25A23, SLC25A24, SLC25A25, SLC25A26, SLC25A27, SLC25A28, SLC25A29, SLC25A30, SLC25A31, SLC25A32, SLC25A33, SLC25A34, SLC25A35, SLC25A36, SLC25A37, SLC25A38, SLC25A39, SLC25A40, SLC25A41, SLC25A42, SLC25A43, SLC25A44, SLC25A45, SLC25A46, SLC25A47, SLC25A48, SLC25A49, SLC25A50SLC25A51, SLC25A52, SLC25A53, SLC26A1, SLC26A2, SLC26A3, SLC26A4, SLC26A5, SLC26A6, SLC26A7, SLC26A8, SLC26A9, SLC26A10, SLC26A11, SLC27A1, SLC27A2, SLC27A3, SLC27A4, SLC27A5, SLC27A6, SLC28A1, SLC28A2, SLC28A3, SLC29A1, SLC29A2, SLC29A3, SLC29A4, SLC30A1, SLC30A2, SLC30A3, SLC30A4, SLC30A5, SLC30A6, SLC30A7, SLC30A8, SLC30A9, SLC30A10, SLC31A1, SLC31A2, SLC32A1, SLC33A1, SLC34A1, SLC34A2, SLC34A3, SLC35A1, SLC35A2, SLC35A3, SLC35A4, SLC35A5, SLC35B1, SLC35B2, SLC35B3, SLC35B4, SLC35C1, SLC35C2, SLC35D1, SLC35D2, SLC35D3, SLC35E1, SLC35E2B, SLC35E3, SLC35E4, SLC35F1, SLC35F2, SLC35F3, SLC35F4, SLC35F5, SLC35F6, SLC35G1, SLC35G2, SLC35G3, SLC35G4, SLC35G5, SLC35G6, SLC36A1, SLC36A2, SLC36A3, SLC36A4, SLC37A1, SLC37A2, SLC37A3, SLC37A4, SLC38A1, SLC38A2, SLC38A3, SLC38A4, SLC38A5, SLC38A6, SLC38A7, SLC38A8, SLC38A9, SLC38A10, SLC38A11, SLC39A1, SLC39A2, SLC39A3, SLC39A4, SLC39A5, SLC39A6, SLC39A7, SLC39A8, SLC39A9, SLC39A10, SLC39A11, SLC39A12, SLC39A13, SLC39A14, SLC40A1, SLC41A1, SLC41A2, SLC41A3, SLC42A1, SLC42A2, SLC42A3, SLC43A1, SLC43A2, SLC43A3, SLC44A1, SLC44A2, SLC44A3, SLC44A4, SLC44A5, SLC45A1SLC45A2, SLC45A3, SLC45A4, SLC46A1, SLC46A2, SLC46A3, SLC47A1, SLC47A2, SLC48A1, SLC49A1, SLC49A2, SLC49A3, SLC49A4, SLC50A1, SLC51A, SLC51B, SLC52A1, SLC52A2, SLC52A3, SLC53A1, SLC54A1, SLC54A2, SLC55A1, SLC55A2, SLC55A3, SLC56A1, SLC56A2, SLC56A3, SLC56A4, SLC56A5, SLC57A1, SLC57A2, SLC58A1, SLC58A2, SLC62A1, SLC65A1, SLC65A2, SLC66A1, SLC66A2, SLC66A3, SLC66A4, SLC66A5;
[0027] The ABC transporter-related genes are ABCA1, ABCA2, ABCA3, ABCA4, ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCA10, ABCA12, ABCA13, ABCB1, ABCB2, ABCB3, ABCB4, ABCB5, ABCB6, ABCB7, ABCB8, ABCB9, ABCB10, ABCB11, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5, ABCC6, ABCC7, ABCC8, ABCC9, ABCC10, ABCC11, ABCC12, ABCD1, ABCD2, ABCD3, ABCD4, ABCE1, ABCF1, ABCF2, ABCF3, ABCG1, ABCG2, ABCG4, ABCG5, ABCG8.
[0028] According to the online sgRNA design software (http: / / crispr.mit.edu / ), 5 sgRNAs were designed for each of the above genes, totaling 2300, to ensure screening coverage and reliability. Homologous arms were added to both the left and right sides of the sgRNA. The nucleotide sequence of the left homologous arm is gtttattacagggacagcagagatccagtttggttaattaa (SEQ ID NO:1), and the nucleotide sequence of the right homologous arm is gcgctgccaccatggacaagaagtacagcatcggcctgga (SEQ ID NO:2).
[0029] 2) Construct a plasmid library of SLC transporter and ABC transporter-related genes
[0030] Primer sequences designed for PCR amplification. The upstream primer is gtttattacagggacagcagagatccagtt (SEQ ID NO:3), and the downstream primer is tccaggccgatgctgtacttcttgt (SEQ ID NO:4). Using Max Master Mix (Vazyme, P515-01) for PCR amplification, with the template being the sgRNA library synthesized in the previous step.
[0031] Clone the above amplification product into the pLentiCRISPR v2 vector. The restriction enzyme sites are KpnI-XbaI. After linearizing the vector, introduce it into competent Escherichia coli cells (Endura) by electroporation technology, and screen for positive clones to obtain a plasmid library of genes related to SLC transporters and ABC transporters.
[0032] Example 2 Construction of stable cell lines
[0033] 1) Amplify the plasmid: Take 50 μl of E. coli DH5α (TIANGEN, Cat#CB101) and thaw it on ice. Add 1 - 2 μl of the library plasmid, place the mixture on ice for 30 min, then heat shock the mixture in a 42°C water bath for 90 s, and quickly place it on ice for 2 - 3 min. Add LB free, incubate it at 37°C with shaking at 220 rpm for 1 hour, then spread it evenly on an LB plate with ampicillin resistance, and use glass beads to spread it evenly. Incubate the plate overnight at 37°C. To ensure that the number of monoclonal colonies obtained > 1000 * the number of sgRNAs, so that each sgRNA can be effectively amplified, a total of 10 plates are spread. Finally, scrape off all the monoclonal colonies, perform a large-scale culture, and extract plasmid DNA using an endotoxin-free large-scale plasmid extraction kit (Tiangen, #DP117) to obtain the amplified sgRNA library.
[0034] 2) Lentivirus packaging: Passage 293T cells into 50 10-cm culture dishes in advance. When the cells reach about 70% density, perform lentivirus packaging. Sequentially add 10 μg of plasmid library, 10 μg of psPAX2 (Addgene, Cat#12260), and 5 μg of pMD2.G (Addgene, Cat#12259) into an EP tube containing 200 μl of DMEM free medium. In another EP tube containing 200 μl of DMEM free medium, add 50 μl of EZ (Heyuan LiJi, AC04L092). Add the latter to the former and mix evenly. After standing at room temperature for 15 min, slowly and evenly drip it into the medium of one dish of 293T cells, and then place it in a 37°C incubator. Replace the medium after 6 - 8 hours. After 48 hours, collect the medium supernatant with a 10-ml syringe and filter it through a 0.45-μm filter. Centrifuge the virus supernatant at 25,000 rpm for 2 hours with a refrigerated floor centrifuge, and concentrate the volume to about 1 / 100.
[0035] 3) Determine the multiplicity of infection (MOI) of the virus: Seed the host cells H441-luc at 50% density into a six-well plate. Add 20, 40, and 80 μl of the virus concentrate to each well respectively. After 24 hours of infection, passage the cells in each well at a ratio of 1 / 3 and 2 / 3 into two wells respectively. Add polybrene to the well with 2 / 3 of the cell number and screen for 3 days. The ratio of the remaining cell number in this well to the cell number after proliferation in the other well is the multiplicity of infection of the virus. Select the amount of the virus concentrate with an MOI of 0.3 to infect the host cells.
[0036] 4) Infect the host cells: To ensure that the finally obtained cells contain all 2300 sgRNAs, plate 3 million H441 cells at 50% density, add the virus concentrate, and after 24 hours of infection, screen and culture with polybrene for one week. After maintaining 7-day resistance screening, obtain the stable transfected strain.
[0037] Example 3 Negative Screening
[0038] Select the classical bone metastasis cancer animal model (left ventricular injection model): Inject 10 6 / 100 μl of H441-luc-sgRNA into the left ventricle of athymic nude mice. Observe the development of lung cancer in mice by photographing with a small animal in vivo imaging system every week. Approximately 30 days later, tumors form on the bones of the mice. The screening factor in this experiment is the survival ability of the cells themselves. The lung cancer bone metastasis cells with tumors on the bones are the cells after negative screening ( Figure 1 ).
[0039] Extract the genomic DNA of H441-luc-sgRNA cells and tumors using a genomic DNA extraction kit (TIANGEN, DP304). Use Perform PCR amplification using Max Master Mix (Vazyme, P515-01). If a PCR product is detected at around 200 bp by agarose gel electrophoresis, the amplification is successful.
[0040] The primers are as follows:
[0041] sgRNA-F: acactctttccctacacgacgctcttccgatctttggctttatatatcttgtggaaagga (SEQ ID NO:5)
[0042] sgRNA-R: gtgactggagttcagacgtgtgctcttccgatctgccttattttaacttgctatttctag (SEQ ID NO:6)
[0043] The product was purified using a gel extraction kit and sent for sequencing. The top ten SLC transporters related to bone metastasis of lung cancer screened in this experiment are: SLC17A3, SLC31A1, SLC38A2, SLC4A9, SLCO1B1, SLC14A2, SLC7A7, SLC2A2, SLC9A8, SLC22A6 ( Figure 2 ).
[0044] The above are only the preferred embodiments of the present invention, and do not limit the implementation manners and protection scope of the present invention. For those skilled in the art, it should be realized that all equivalent substitutions and obvious changes made by using the content of the present invention's specification and drawings should be included in the protection scope of the present invention.
Claims
1. A high-throughput screening method for a CRISPR / Cas9 library of candidate genes related to bone metastasis of lung cancer, characterized in that, It includes the following steps: Step 1: Construct an sgRNA library of genes related to SLC transporters and ABC transporters; perform lentiviral packaging on the sgRNA library to obtain a plasmid library; Step 2: Transduce the lentivirus into host cells using a low multiplicity of infection to ensure that on average each cell only takes in one sgRNA, and screen to obtain cells stably expressing the sgRNA library; Step 3: Inoculate the cells after lentivirus infection into the left ventricle of nude mice without thymus; Step 4: Take out the tumor tissues with bone metastases, extract genomic DNA, then construct a library for second-generation sequencing of the targeting regions of sgRNAs, and screen for candidate genes related to lung cancer bone metastasis by comparing the abundance changes of sgRNAs before and after.
2. The high-throughput screening method according to claim 1, wherein The SLC transporter-related genes are: SLC1A1, SLC1A2, SLC1A3, SLC1A4, SLC1A5, SLC1A6, SLC1A7, SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A6, SLC2A7, SLC2A8, SLC2A9, SLC2A10, SLC2A11, SLC2A12, SLC2A13, SLC2A14, SLC3A1, SLC3A2, SLC4A1, SLC4A2, SLC4A3, SLC4A4, SLC4A5, SLC4A7, SLC4A8, SLC4A9, SLC4A10, SLC4A11, SLC5A1, SLC5A2, SLC5A3, SLC5A4, SLC5A5, SLC5A6, SLC5A7, SLC5A8, SLC5A9, SLC5A10, SLC5A11, SLC5A12, SLC6A1, SLC6A2, SLC6A3, SLC6A4, SLC6A5, SLC6A6, SLC6A7, SLC6A8, SLC6A9, SLC6A11, SLC6A12, SLC6A13, SLC6A14, SLC6A15, SLC6A16, SLC6A17, SLC6A18, SLC6A19, SLC6A20, SLC7A1, SLC7A2, SLC7A3, SLC7A4, SLC7A5, SLC7A6, SLC7A7, SLC7A8, SLC7A9, SLC7A10, SLC7A11, SLC7A13, SLC7A14, SLC8A1, SLC8A2, SLC8A3, SLC8B1, SLC9A1, SLC9A2, SLC9A3, SLC9A4, SLC9A5, SLC9A6, SLC9A7, SLC9A8, SLC9A9, SLC9B1, SLC9B2, SLC9C1, SLC9C2, SLC10A1, SLC10A2, SLC10A3, SLC10A4, SLC10A5, SLC10A6, SLC10A7, SLC11A1, SLC11A2, SLC12A1, SLC12A2, SLC12A3, SLC12A4, SLC12A5, SLC12A6, SLC12A7, SLC12A8, SLC12A9, SLC13A1, SLC13A2, SLC13A3, SLC13A4, SLC13A5, SLC14A1 UT-B1, SLC14A1UT-B2, SLC14A2_UT-A2, SLC15A1, SLC15A2, SLC15A3, SLC15A4, SLC16A1, SLC16A2, SLC16A3, SLC16A4, SLC16A5,SLC16A6, SLC16A7, SLC16A8, SLC16A9, SLC16A10, SLC16A11, SLC16A12, SLC16A13, SLC16A14, SLC17A1, SLC17A2, SLC17A3, SLC17A4, SLC17A5, SLC17A6, SLC17A7, SLC17A8, SLC17A9, SLC18A1, SLC18A2, SLC18A3, SLC18B1, SLC19A1, SLC19A2, SLC19A3, SLC20A1, SLC20A2, SLCO2A1, SLCO4A1, SLCO5A1, SLCO3A1, SLCO6A1, SLCO1A2, SLCO2B1, SLCO1B1, SLCO1B3, SLCO4C1, SLCO1C1, SLC22A1, SLC22A2, SLC22A3, SLC22A4, SLC22A5, SLC22A6, SLC22A7, SLC22A8, SLC22A9, SLC22A10, SLC22A11, SLC22A12, SLC22A13, SLC22A14, SLC22A15, SLC22A16, SLC22A17, SLC22A18, SLC22A23, SLC22A24, SLC22A25, SLC22A31, SLC23A1, SLC23A2, SLC23A3, SLC24A1, SLC24A2, SLC24A3, SLC24A4, SLC24A5, SLC25A1, SLC25A2, SLC25A3, SLC25A4, SLC25A5, SLC25A6, SLC25A7, SLC25A8, SLC25A9, SLC25A10, SLC25A11, SLC25A12, SLC25A13, SLC25A14, SLC25A15, SLC25A16, SLC25A17, SLC25A18, SLC25A19, SLC25A20, SLC25A21, SLC25A22, SLC25A23, SLC25A24, SLC25A25, SLC25A26, SLC25A27, SLC25A28, SLC25A29, SLC25A30, SLC25A31, SLC25A32, SLC25A33, SLC25A34, SLC25A35, SLC25A36, SLC25A37, SLC25A38, SLC25A39, SLC25A40, SLC25A41, SLC25A42, SLC25A43, SLC25A44, SLC25A45, SLC25A46, SLC25A47, SLC25A48, SLC25A49SLC25A50, SLC25A51, SLC25A52, SLC25A53, SLC26A1, SLC26A2, SLC26A3, SLC26A4, SLC26A5, SLC26A6, SLC26A7, SLC26A8, SLC26A9, SLC26A10, SLC26A11, SLC27A1, SLC27A2, SLC27A3, SLC27A4, SLC27A5, SLC27A6, SLC28A1, SLC28A2, SLC28A3, SLC29A1, SLC29A2, SLC29A3, SLC29A4, SLC30A1, SLC30A2, SLC30A3, SLC30A4, SLC30A5, SLC30A6, SLC30A7, SLC30A8, SLC30A9, SLC30A10, SLC31A1, SLC31A2, SLC32A1, SLC33A1, SLC34A1, SLC34A2, SLC34A3, SLC35A1, SLC35A2, SLC35A3, SLC35A4, SLC35A5, SLC35B1, SLC35B2, SLC35B3, SLC35B4, SLC35C1, SLC35C2, SLC35D1, SLC35D2, SLC35D3, SLC35E1, SLC35E2B, SLC35E3, SLC35E4, SLC35F1, SLC35F2, SLC35F3, SLC35F4, SLC35F5, SLC35F6, SLC35G1, SLC35G2, SLC35G3, SLC35G4, SLC35G5, SLC35G6, SLC36A1, SLC36A2, SLC36A3, SLC36A4, SLC37A1, SLC37A2, SLC37A3, SLC37A4, SLC38A1, SLC38A2, SLC38A3, SLC38A4, SLC38A5, SLC38A6, SLC38A7, SLC38A8, SLC38A9, SLC38A10, SLC38A11, SLC39A1, SLC39A2, SLC39A3, SLC39A4, SLC39A5, SLC39A6, SLC39A7, SLC39A8, SLC39A9, SLC39A10, SLC39A11, SLC39A12, SLC39A13, SLC39A14, SLC40A1, SLC41A1, SLC41A2, SLC41A3, SLC42A1, SLC42A2, SLC42A3, SLC43A1, SLC43A2, SLC43A3, SLC44A1, SLC44A2, SLC44A3, SLC44A4, SLC44A5SLC45A1, SLC45A2, SLC45A3, SLC45A4, SLC46A1, SLC46A2, SLC46A3, SLC47A1, SLC47A2, SLC48A1, SLC49A1, SLC49A2, SLC49A3, SLC49A4, SLC50A1, SLC51A, SLC51B, SLC52A1, SLC52A2, SLC52A3, SLC53A1, SLC54A1, SLC54A2, SLC55A1, SLC55A2, SLC55A3, SLC56A1, SLC56A2, SLC56A3, SLC56A4, SLC56A5, SLC57A1, SLC57A2, SLC58A1, SLC58A2, SLC62A1, SLC65A1, SLC65A2, SLC66A1, SLC66A2, SLC66A3, SLC66A4, SLC66A5; The ABC transporter-related genes are ABCA1, ABCA2, ABCA3, ABCA4, ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCA10, ABCA12, ABCA13, ABCB1, ABCB2, ABCB3, ABCB4, ABCB5, ABCB6, ABCB7, ABCB8, ABCB9, ABCB10, ABCB11, ABCC1, ABCC2, ABCC3, ABCC4, ABCC5, ABCC6, ABCC7, ABCC8, ABCC9, ABCC10, ABCC11, ABCC12, ABCD1, ABCD2, ABCD3, ABCD4, ABCE1, ABCF1, ABCF2, ABCF3, ABCG1, ABCG2, ABCG4, ABCG5, ABCG8.
3. The high-throughput screening method according to claim 1, wherein The specific content of Step 1 is as follows: (1) Provide nucleic acid construct A-B-C; Among them, A is the left homologous arm sequence upstream of the coding sequence of the sgRNA of genes related to SLC transporters and ABC transporters; B is the coding sequence of the sgRNA of genes related to SLC transporters and ABC transporters; C is the right homologous arm sequence downstream of the coding sequence of the sgRNA of genes related to SLC transporters and ABC transporters; (2) Use the nucleic acid construct A-B-C as a template for PCR amplification to obtain an amplification product; (3) Clone the amplification product into an expression vector, linearize the expression vector, and then introduce it into competent Escherichia coli cells by electroporation technology, and screen for positive clones to obtain a plasmid library of genes related to SLC transporters and ABC transporters.
4. The high-throughput screening method according to claim 3, wherein The nucleotide sequence of the left homologous arm A is as shown in SEQ ID NO:1, and the nucleotide sequence of the right homologous arm C is as shown in SEQ ID NO:2.