A SNP molecular marker affecting immunoglobulin m and immunoglobulin a of yaks and application thereof
By detecting SNP molecular marker sites on chromosome 21 of the yak reference genome, the lack of research on yak immune characteristics has been addressed, enabling more precise and efficient yak breeding and improving yak immunity and production performance.
Patent Information
- Application Number
- CN202510654520.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-05-21
AI Technical Summary
Current technologies lack research on molecular markers related to yak immune characteristics and immune genes, resulting in a lack of precision and efficiency in yak disease-resistant breeding and posing challenges to traditional prevention and control methods.
This study provides a SNP molecular marker that affects immunoglobulin M and immunoglobulin A in yaks, located at 43,165,308 bases on chromosome 21 of the yak reference genome LU_Bosgru_v3.0. By detecting the genotype at this locus, amplification and genotype analysis are performed using primer pairs to correlate immunoglobulin levels in yaks, leading to the development of detection products and breeding aid kits.
By detecting the bases at the 43,165,308th nucleotide site on chromosome 21 of yaks, the immunoglobulin content of individual yaks can be determined, providing a basis for breeding yaks with high immunity and improving the overall health and production performance of yaks.
Smart Images

Figure CN120272612B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection technology, and in particular to a SNP molecular marker that affects yak immunoglobulin M and immunoglobulin A and its application. Background Technology
[0002] Yaks are widely distributed in the Qinghai-Tibet Plateau and its adjacent areas, and are a unique cattle breed and dominant livestock species in high-altitude pastoral regions. Due to the scarcity of forage resources, outdated production methods, and inadequate disease prevention and control technologies in these areas, healthy yak farming faces significant risks. With advancements in science and technology and the development of industrial techniques, utilizing molecular marker technology to explore genetic markers closely related to yak disease resistance, thereby assisting in disease-resistant yak breeding, is a forward-looking and innovative research direction.
[0003] With the increasing resistance and mutations of infectious pathogens to antibiotics, traditional methods of infectious disease control, such as vaccination and antibiotic use, face increasingly severe challenges in modern livestock farming. The pathogenesis of yak diseases is not only influenced by external environmental pollutants but also closely related to their own gene regulation. An animal's resistance to many diseases largely depends on genetic factors. Therefore, by identifying disease-resistance-related genes and conducting targeted disease-resistant breeding, it is possible to effectively improve animal immunity, reduce drug dependence, and thus promote the healthy and sustainable development of animal husbandry.
[0004] DNA molecular markers are DNA fragments that can directly reflect genetic differences between the same or different species. With the rapid development of DNA molecular marker technology, a foundation has been laid for studying the genetic mechanisms of yak disease resistance at the molecular level. However, research on molecular markers related to yak immune characteristics and immune genes remains relatively scarce. Therefore, further strengthening basic and applied research, and utilizing DNA molecular marker technology to screen for SNP molecular markers related to yak disease resistance, holds promise for achieving more precise and efficient yak breeding goals in the future, thereby improving the overall health and production performance of yaks. Summary of the Invention
[0005] The purpose of this invention is to provide an SNP molecular marker that affects yak immunoglobulin M and immunoglobulin A and its application.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides an SNP molecular marker that affects yak immunoglobulin A and immunoglobulin M. The SNP molecular marker is located at the 43,165,308th base on chromosome 21 of the yak reference genome LU_Bosgru_v3.0, and the mutated base is C or T.
[0008] Preferably, the genotype of yaks with a mutated base C is CC or CT; the genotype of yaks with a mutated base T is TT.
[0009] The levels of immunoglobulin M in yak individuals with genotypes CC and CT were significantly higher than those in yak individuals with genotype TT, and the levels of immunoglobulin A in yak individuals with genotype CC were significantly higher than those in yak individuals with genotype TT.
[0010] This invention also provides the application of the aforementioned SNP molecular marker in the preparation of products for detecting yak immunity or yak assisted breeding.
[0011] The present invention also provides primer pairs for amplifying the SNP molecular markers, the sequences of which are shown in SEQ ID NO: 1-2.
[0012] The present invention also provides the application of the primer pair described herein in the preparation of products for detecting yak immunity or products for yak assisted breeding.
[0013] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0014] The present invention also provides a kit for yak assisted breeding, comprising reagents for detecting the SNP molecular markers or the primer pairs described herein.
[0015] This invention also provides a method for non-diagnostic selection of yak immune trait markers, comprising the following steps:
[0016] (1) Extracting yak genomic DNA;
[0017] (2) Using the yak genomic DNA obtained in step (1) as a template, amplification is performed using the primer pair to obtain the amplification product;
[0018] (3) Genotyping of the amplification products was performed to obtain yaks with different genotypes; the genotypes of yaks were correlated with immune indicators; the immunoglobulins were immunoglobulin A and immunoglobulin M.
[0019] Preferably, the amplification system in step (2) is: 12.5 μL of 2×L-Exp Taq MasterMix, 8.5 μL of RNase-free water, 1 μL of upstream primer, 1 μL of downstream primer and 2 μL of template.
[0020] Preferably, the amplification program in step (2) is: 98℃ for 2 min, 98℃ for 10 s, 58.0℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] This invention provides the cloning and application of SNP molecular markers related to yak immunoglobulins. Through research, this invention discovered that the SNP locus related to yak immunity is located at the 43,165,308th base on chromosome 21 of the yak reference genome LU_Bosgru_v3.0, with a C / T variant and three genotypes. When the 43,165,308th base on chromosome 21 is C, the genotype is CC or CT; when the 43,165,308th base on chromosome 21 is T, the genotype is TT. Association analysis between different genotypes and the levels of immunoglobulin A, immunoglobulin G, and immunoglobulin M revealed that the levels of immunoglobulin M in yak individuals with genotypes CC and CT were significantly higher than those in yak individuals with genotype TT (p<0.05), and the levels of immunoglobulin A in yak individuals with genotype CC were significantly higher than those in yak individuals with genotype TT (p<0.05). There was no significant difference in immunoglobulin G among individuals with the CT genotype (p>0.05).
[0023] This invention determines the immunoglobulin content of individual yaks by detecting the bases at nucleotide site 43,165,308 on chromosome 21. This invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and provides a basis for breeding yaks with high immunity. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0025] Figure 1 The product is a PCR amplification product: where M represents the marker; 1 and 2 represent the product bands.
[0026] Figure 2 The image shows the peak pattern and sequence obtained after sequencing the PCR product. Detailed Implementation
[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1
[0029] 1 Sample Collection
[0030] This invention uses Nya yaks as the testing subject. 5 mL of blood samples were collected from 189 fasting yaks in a pasture in Jiali County, Nagqu City, Tibet Autonomous Region, and placed in clean, anticoagulant vacuum blood collection tubes. The samples were allowed to stand for 30 minutes, then centrifuged at 3500 rpm for 10 minutes. The supernatant was collected into PE tubes, sealed, and stored at -20°C. Separately, 5 mL of blood samples were collected and added to blood collection tubes containing EDTA-K2 anticoagulant. The blood samples were quickly mixed after collection, placed in a sampling box containing ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for genomic DNA extraction.
[0031] 2. Main Reagents and Instruments
[0032] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; the PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme-Label Biotechnology Co., Ltd.
[0033] 3 methods
[0034] 3.1 Detection of immunoglobulins IgA, IgG, and IgM
[0035] The IgA, IgG, and IgM detection kits from Jiangsu Enzyme Biotechnology Co., Ltd. were used for assays using a one-step sandwich method with double antibodies. First, the required strips were removed from the aluminum foil bag after equilibration at room temperature for 20 minutes. The remaining strips were sealed in a resealable bag and returned to 4°C. Standard and sample wells were prepared. 50 μL of different concentrations of standard were added to each standard well. 10 μL of the test sample was added to each sample well, followed by 40 μL of sample diluent. No diluent was added to the blank wells. Except for the blank wells, 100 μL of horseradish peroxidase (HRP)-labeled detection antibody was added to each of the standard and sample wells. The reaction wells were sealed with sealing film and incubated at 37°C in a water bath or incubator for 60 minutes. The liquid was discarded, and the plates were patted dry on absorbent paper. Washing buffer was added to each well, and the plates were allowed to stand for 1 minute. The washing buffer was then discarded, and the plates were patted dry on absorbent paper. This washing process was repeated 5 times (or a plate washer could be used). 50 μL each of substrates A and B were added to each well, and the plates were incubated at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and measure the OD value of each well at 450 nm within 15 min. Finally, plot the standard curve: In an Excel worksheet, plot the standard concentration on the x-axis and the corresponding OD value on the y-axis to create a linear regression curve of the standard. Calculate the IgA, IgG, and IgM concentrations of each sample according to the curve equation.
[0036] 3.2 Extraction of genomic DNA from blood
[0037] Genomic DNA was extracted from blood samples using the blood genomic extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The extracted DNA was then analyzed for concentration and purity using a UV spectrophotometer. Concentrations >20 ng / μL and OD values >20 were acceptable. 260 / OD 280 A pH between 1.7 and 1.9 is sufficient for experimental needs; store at -20°C for future use.
[0038] 3.3 Primer Design
[0039] Based on the sequence of chromosome 21 of the yak genome LU_Bosgru_v3.0, specific primers containing the g43165308C>TSNP site were designed using the Primers online tool provided by NCBI.
[0040] Primer sequence
[0041] F: TGATGAGAGACCTCACA (SEQ ID NO: 1);
[0042] R: AGCATTCCTGACTTCTTCTT (SEQ ID NO: 2).
[0043] The amplified fragment was 501 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0044] 3.4 PCR Amplification and Sequencing
[0045] PCR amplification system 25μL: 2×L-Exp Taq MasterMix (dye plus) 12.5μL, RNase freewater 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.
[0046] PCR amplification program: 98℃ for 2 min, 98℃ for 10 s, 58.0℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.
[0047] PCR products were detected by 1% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The agarose gel electrophoresis results are as follows: Figure 1 As shown. Figure 1 The PCR amplification yielded a 501 bp sequence. Sequencing revealed a C / T mutation at position 501 of the amplified product (nucleotide 43,165,308 on chromosome 21 of the LU_Bosgru_v3.0 genome). The amplified product band was clear and free of extraneous bands, demonstrating good specificity. This site was preliminarily identified as a yak SNP marker, named g43165308C>T SNP. The PCR amplified sequence is shown in SEQ ID NO: 3, with a C mutation at position 388. The PCR amplified product fragment size met expectations and is ready for further experiments.
[0048] SEQ ID NO: 3
[0049] TGATGACGAGACCTCACAACGTGGCTGTTTCTTTCACAGCAGAGAAGACGTATCAGGAATGAAATGGGATTTTAAGATGATTGTACCCGATAAGTAAGAGTGAGTACCTGATTTCAAAGCAGCTGTCACATGACCCGACCCTCCATGCCCCCATGCCATTCAGTCACCTGTCAGGCAGCATGAGCTAAGCAG GCGGGGGCCAGAAACCGCTGCCTCTTTTGCTTCTCCCACTTTCCAGGGTTCTTGATATACCCCTCTTCCTTCCCTCTGTCCCTCCTTCTTTCCTTCAGATACCTTGCTAACCCTATGGTACAGGCATATATTCACTATTGTAAGGTATACAAAACTACCTTTCTCAGACAGATTTAGCCCCACCACCGTCTTCC C CCATCATTGGAGCACAACCCTCACCTGAGTCTTCTACTGCAGTCTTTGAAGTTGCCAGTTTCACAAAAAGCTGTGAGGACCAGAAAAAAAACAAGAAGAAGTCAGGAATGCT
[0050] The sequencing results of PCR products were compared using the bioanalysis software MEGA 11.0, and the sequencing peak diagrams were analyzed to complete the typing.
[0051] 4. Statistical Analysis
[0052] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the gene frequency, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. Polymorphism information content (PIC) was calculated using PIC software. IBM SPSS Statistics 26 software was used to analyze the association between different genotypes in yaks and immunoglobulins IgA, IgG, and IgM using a general linear model. Results are expressed as mean ± standard error.
[0053] 5 Results
[0054] 5.1 PCR amplification and sequencing results
[0055] The amplification products of the g43165308C>T SNP locus on chromosome 21 of yaks were detected using 1% agarose gel (see Figure 1 ), with clear bands and no background bands, indicating good specificity. The size of the PCR product fragment was 501 bp, which was consistent with the expected size, allowing for the next step of the experiment.
[0056] The peak graphs and sequences obtained after purifying and sequencing the PCR products are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g43165308C>T SNP locus, and there were three genotypes: CC, CT, and TT.
[0057] 5.2 Statistical analysis results [[ID=…]]From the perspective of population genetics, the genotypes and allele frequencies of the g.43165308C>T SNP locus on chromosome 21 of yaks were analyzed. As shown in Table 1, at the g.43165308C>T SNP locus, the frequency of the C allele was 72%, showing a dominant allele. The chi-square 2 goodness-of-fit test indicated that the SNP locus was in Hardy-Weinberg equilibrium (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.41, and the PIC was 0.32. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.
[0059] Table 1 Polymorphism of the g43165308A>G SNP locus on chromosome 21 of yaks
[0060]
[0061] 5.3 Association analysis of different genotypes with immunoglobulins IgA, IgG, and IgM. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the content of immunoglobulin M in yak individuals with genotypes CC and CT was significantly higher than that in yak individuals with genotype TT (p<0.05). The content of immunoglobulin A in yak individuals with genotype CC was significantly higher than that in yak individuals with genotype TT (p<0.05). There was no significant difference in immunoglobulin G among CT genotype individuals (p>0.05). The results are shown in Table 2.
[0062] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM
[0063]
[0064] Note: Different lowercase letters in the superscript of the same row of data indicate significant differences (P<0.05).
[0065] Table 2 shows that the levels of immunoglobulin M in yak individuals with genotypes CC and CT were significantly higher than those in yak individuals with genotype TT (p<0.05), and the levels of immunoglobulin A in yak individuals with genotype CC were significantly higher than those in yak individuals with genotype TT (p<0.05). This indicates that the bases at the g43165308C>TSNP site on yak chromosome 21 are significantly correlated with yak IgA and IgM (p<0.05), and are SNP markers related to yak IgA and IgM.
[0066] The SNP molecular marker described in this invention is located at the 43,165,308th base on chromosome 21 of the reference yak genome LU_Bosgru_v3.0. The variant type is C / T, named g43165308C>T, and there are three genotypes. When the 43165308th base on chromosome 21 is C, the genotype is CC or CT; when the 43165308th base on chromosome 21 is T, the genotype is TT. Through association analysis between different genotypes and the contents of IgA, IgG, and IgM, it was found that the content of immunoglobulin M in yak individuals with genotypes CC and CT was significantly higher than that in yak individuals with genotype TT (p<0.05), and the content of immunoglobulin A in yak individuals with genotype CC was significantly higher than that in yak individuals with genotype TT (p<0.05). By detecting the bases at the 43,165,308th nucleotide site on chromosome 21 of yaks, the IgA and IgM content of individual yaks can be determined. This invention provides a new SNP molecular marker resource for assisted selection of yak immune trait markers for non-diagnostic purposes.
[0067] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A primer pair for detecting SNP molecular markers in the preparation of an in vitro detection reagent for immune traits of yaks or an assisted breeding detection reagent for immune traits of yaks, characterized in that, The SNP molecular marker is located at the 43165308th base of chromosome 21 of the yak reference genome LU_Bosgru_v3.0 version, and the mutation base is C or T. The content of immunoglobulin M in the yak individual with the genotype CC and CT is significantly higher than that in the yak individual with the genotype TT, and the content of immunoglobulin A in the yak individual with the genotype CC is significantly higher than that in the yak individual with the genotype TT.
2. Use according to claim 1, characterized in that, The sequence of the primer pair for detecting the SNP molecular marker is shown in SEQ ID NO. 1-2.
3. A method for marker assisted selection of immune traits in Bos indicus for non-diagnostic purposes, characterized by, The method comprises the following steps: (1) extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, amplifying by using the primer pair shown in SEQ ID NO. 1-2 to obtain an amplification product; (3) performing genotype analysis on the amplification product to obtain yaks with different genotypes, and correlating the genotype of the yak with an immune index; the immunoglobulin is immunoglobulin A and immunoglobulin M; The primer pair is used for amplifying the SNP molecular marker, the SNP molecular marker is located at the 388th base shown in SEQ ID No. 3, the mutation base is C or T, the content of immunoglobulin M in the yak individual with the genotype CC and CT is significantly higher than that in the yak individual with the genotype TT, and the content of immunoglobulin A in the yak individual with the genotype CC is significantly higher than that in the yak individual with the genotype TT.
4. The method of claim 3, wherein, The amplification system in step (2) is: 2x L-Exp Taq Master Mix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.
5. The method of claim 3, wherein, The amplification program in step (2) is: 98℃ 2 min; 98℃ 10 s, 58.0℃ 30 s, 72℃ 10 s, a total of 35 cycles; 72℃ extension for 2 min.