Visual detection primer probe set, kit and detection method for aquatic animal source trypanosomes

Abstract

The invention provides an aquatic animal source trypanosomes visual detection primer probe set, a kit and a detection method, and belongs to the technical field of parasite detection. The invention provides a detection reagent for aquatic animal source trypanosomes. The detection reagent comprises a recombinase polymerase amplification primer pair and a probe which are designed according to an SSU rDNA gene conserved region of the aquatic animal source trypanosomes. Aiming at SSU rDNA sequence conserved regions of multiple aquatic animal trypanosomes, the invention develops a detection method and a kit based on recombinase polymerase amplification combined with a lateral flow test strip technology, and the detection method and the kit have the advantages of strong specificity, high sensitivity, short time consumption, result visualization and the like, and have low requirements on detection sites, instruments and personnel; the method is suitable for rapid detection of trypanosomes in basic laboratories and farms, and has important significance on prevention and control of trypanosomes of aquatic animals.

Description

Technical Field

[0001] The present invention belongs to the technical field of parasite detection, and particularly relates to a primer-probe set, a kit and a detection method for visual detection of Trypanosoma from aquatic animals. Background Art

[0002] Trypanosoma is a hemoflagellate protozoan. Up to now, more than 200 species of Trypanosoma have been reported to exist in various freshwater and seawater fish, which can infect various aquatic animals such as crucian carp, largemouth bass, tilapia, and large yellow croaker, causing parasitemia. The symptoms of infected hosts include anorexia, hypoxia, lethargy, splenomegaly, etc., and the morbidity and mortality rate is as high as 100%, causing serious economic losses to the aquaculture industry.

[0003] Timely diagnosis of Trypanosoma infection is a necessary prerequisite for effective treatment. Blood smear microscopy, as the "gold standard" method, has been widely used for the diagnosis of this parasite infection. However, the detection sensitivity of this method is usually low, and it usually requires a relatively high level of Trypanosoma parasitism in the host body to be detected. Ordinary PCR methods are often used for Trypanosoma detection, but they are time-consuming and have certain requirements for instruments and operators, which is not conducive to rapid on-site diagnosis. Olga Barranco Gómez et al. established a fluorescence quantitative PCR detection method for Trypanosoma from insects, Lu Shaohong et al. established a method for rapid detection of Trypanosoma evansi using loop-mediated isothermal amplification technology, and Liu Yongjie et al. developed primers and a kit for real-time fluorescence PCR detection of Trypanosoma nucleic acid, but none of them proposed a general detection method for Trypanosoma from aquatic animals. Summary of the Invention

[0004] The present invention provides a primer-probe set, a kit and a detection method for visual detection of Trypanosoma from aquatic animals, which have the advantages of strong specificity, high sensitivity, short time consumption and result visualization, and are suitable for rapid on-site detection of Trypanosoma in basic laboratories and farms.

[0005] The present invention provides a detection reagent for Trypanosoma from aquatic animals, including a recombinase polymerase amplification primer pair and a probe designed for the conserved region of the SSUrDNA gene of Trypanosoma from aquatic animals.

[0006] In a preferred embodiment of the present invention, the recombinase polymerase amplification primer pair includes an upstream primer and a downstream primer;

[0007] The upstream primer is selected from any one of the following: zc-ssu-F1, zc-ssu-F2, zc-ssu-F3 and zc-ssu-F4;

[0008] The downstream primer is selected from any one of the following: zc-ssu-R1, zc-ssu-R2 and zc-ssu-R3;

[0009] The nucleotide sequences of zc-ssu-F1, zc-ssu-F2, zc-ssu-F3, zc-ssu-F4, zc-ssu-R1, zc-ssu-R2 and zc-ssu-R3 are shown in SEQ ID No.1 to SEQ ID No.7.

[0010] In a preferred embodiment of the present invention, the nucleotide sequence of the probe is shown in SEQ ID No.8.

[0011] In a preferred embodiment of the present invention, the detection reagent comprises the following combinations: the combination of zc-ssu-F1, zc-ssu-R2 and the probe, the combination of zc-ssu-F2, zc-ssu-R2 and the probe, the combination of zc-ssu-F3, zc-ssu-R1 and the probe.

[0012] The present invention also provides a detection kit for Trypanosoma from aquatic animals, comprising the above detection reagent.

[0013] In a preferred embodiment of the present invention, the detection kit further comprises a strip-type nucleic acid amplification reagent and a lateral flow detection strip.

[0014] The present invention also provides a method for detecting Trypanosoma from aquatic animals, comprising the following steps: using the recombinase polymerase amplification primer pairs and probe combinations in the above detection reagent, or the primer-probe combinations in the above detection kit to mix with the genomic DNA of the aquatic animal to be tested to prepare a recombinase polymerase amplification system, adding the recombinase polymerase amplification system and an activator to the strip-type nucleic acid amplification reagent for recombinase polymerase amplification reaction, diluting the reaction product and placing it in the lateral flow detection strip, and evaluating the presence or absence of Trypanosoma in the aquatic animal to be tested according to the color change of the detection line.

[0015] In a preferred embodiment of the present invention, the recombinase polymerase amplification system is 50 μL in volume and comprises: 1.68 μL of upstream primer zc-ssu-F1 (10 μM), 1.68 μL of downstream primer zc-ssu-R2 (10 μM), 0.48 μL of probe zc-ssu-P (10 μM), 3 μL of genomic DNA (1 pg / μL to 200 ng / μL), and 43.16 μL of ddH2O.

[0016] In a preferred embodiment of the present invention, the temperature of the recombinase polymerase amplification reaction is 45 °C and the reaction time is 15 min.

[0017] In a preferred embodiment of the present invention, it includes putting the diluted reaction product into the sample end of the lateral flow detection strip, standing and observing the result;

[0018] When the quality control line shows a blue line and the test line does not show a red line, the result is negative; when the quality control line shows a blue line and the test line shows a red line, the result is positive; when the quality control line does not show a blue line, the result is invalid.

[0019] Beneficial effects: The present invention provides a detection reagent for Trypanosoma from aquatic animals, including a recombinase polymerase amplification primer pair and a probe designed for the conserved region of the SSU rDNA gene of Trypanosoma from aquatic animals. According to the published SSU rDNA gene sequences of Trypanosoma from aquatic animals in GenBank, the present invention uses the software MegAlign to analyze the homology between each sequence, selects the conserved region, and designs the upstream primer, downstream primer, and probe targeting the conserved region with the primer premier 5 software according to the primer design requirements of the recombinase polymerase amplification technology.

[0020] The present invention develops a detection method and kit based on recombinase polymerase amplification combined with lateral flow strip technology for the conserved regions of the SSU rDNA sequences of multiple Trypanosoma from aquatic animals, which has the advantages of strong specificity, high sensitivity, short time consumption, and visual results, and has low requirements for the detection site, instrument, and personnel, and is suitable for the rapid detection of Trypanosoma in basic laboratories and farms, and has important significance for the prevention and control of Trypanosoma diseases in aquatic animals. Description of the Drawings

[0021] Figure 1 It is a diagram of the negative verification result of the downstream primer. In the figure, F1+R1+P is the combination of primer zc-ssu-F1, zc-ssu-R1, and probe zc-ssu-P, F1+R2+P is the combination of primer zc-ssu-F1, zc-ssu-R2, and probe zc-ssu-P, F1+R3+P is the combination of primer zc-ssu-F1, zc-ssu-R3, and probe zc-ssu-P, N is the negative control with ddH2O as the template, and P is the positive control with the DNA of Trypanosoma sanguinis of Larimichthys crocea as the template;

[0022] Figure 2 It is a diagram of the screening result of the upstream primer. In the figure, N is the negative control with ddH2O as the template, and P is the positive control with the DNA of Trypanosoma sanguinis of Larimichthys crocea as the template;

[0023] Figure 3 It is a diagram of the screening result of the primer and probe combination. In the figure, N is the negative control with ddH2O as the template, 10 0 ~10 -5 are respectively 10 0 ~10 -5 times diluted DNA of Trypanosoma sanguinis of Larimichthys crocea;

[0024] Figure 4It is a graph of the optimized results of reaction conditions and systems. In the graph, A is the temperature condition, B is the time condition, C is the reaction system, N is the negative control with ddH2O as the template, and 1 0-3 ~10 -5 are respectively 10 -3 ~10 -5 times diluted DNA of Trypanosoma sanguinis in Larimichthys crocea;

[0025] Figure 5 It is a graph of the results of the specificity test. In the graph, 1-8 are Caligus elongatus, Chilodonella hexasticha, Cryptocaryon irritans, Ichthyophthirius multifiliis, Anisakis pegreffii, Hysterothylacium aduncum, Enterocytozoon hepatopenaei, and Gyrodactylus sp. respectively, N is the negative control with ddH2O as the template, and P is the positive control with DNA of Trypanosoma sanguinis in Larimichthys crocea as the template;

[0026] Figure 6 It is a graph of the results of the sensitivity test. In the graph, A is the recombinase polymerase-based detection method, B is the ordinary PCR detection method, N is the negative control with ddH2O as the template, and 10 0 ~10 -5 are respectively 10 0 ~10 -5 times diluted DNA of Trypanosoma sanguinis in Larimichthys crocea, and M is DNAmaker DL2000;

[0027] Figure 7 It is a graph of the detection results of trypanosomes in different tissues. In the graph, A is the recombinase polymerase-based detection method, B is the ordinary PCR detection method, 1 is gill mucus, 2 is blood, 3 is kidney, 4 is spleen, and N is the negative control with ddH2O as the template. Specific implementation mode

[0028] The present invention provides a detection reagent for trypanosomes from aquatic animals, including a recombinase polymerase amplification primer pair and a probe designed for the conserved region of the SSUrDNA gene of trypanosomes from aquatic animals.

[0029] The present invention obtains the SSU rDNA gene sequences of various trypanosomes from aquatic animals from GeneBank, analyzes the homology between the sequences using the software MegAlign, and screens the conserved regions. The nucleotide sequence of a conserved region in the embodiment of the present invention is shown in SEQ ID No.9:

[0030] ATTGACGGAATGGCACCACAAGACGTGGAGCGTGCGGTTTAATTTGACTCAACACGGGGAACTTTACCAGATCCGGACAGGGTGAGGATTGACAGATTGAGTGTTCTTTCTCGATCCCCTGAATGGTGGTGCATGGCCGCTTTTGGTCGGTGGAGTGATTTGTTTGGTTGATTCCGTCAACGGACGAGATCCAAGCTGCCCAGTAGGATTCAGAATTGCCCATAGGATAGCAATCCCTTCCGCGGGTTTTACCCTAAGGGGGGGCGGTATTCGTTTGTATCCTTCTCTGCGGGATTCCTTGACTTTGCACAAGGTGAGATTTTGGGCAACAGCAGGTCTGTGATGCTCCTCAATGTTCTGGGCGACACGCGCACTACAATGTCAGTGAGAACAAGAA。

[0031] Table 1 Sequence information of SSU rDNA gene of Trypanosoma from aquatic animals

[0032] Trypanosome name Isolate Host GENEID T.carassii TrCa-karas Carp / goldfish OL963934 T.carassii MARV Carp / goldfish OL963935.1 T.sp. El-CP Freshwater fish L14841 T.sp. Freshwater fish MH635421 T.boissoni Sea slug U39580 T.triglae Gurnard U39584.1 T.rajae CD8 Cod MG878996 T.sp. TS2 Crucian carp KJ601715.1 T.sp. TS8 Yellow catfish KJ601724.1 T.sp. Largemouth bass MN831479.1 T.sp. G Large yellow croaker OR934686.1 T.sp. K Large yellow croaker OR934688.1 T.sp. S Large yellow croaker PQ273017.1 T.ophiocephali European eel EU185634.1 T.granulosum European eel AJ620552.1 T.siniperca Chinese perch DQ494415.1 T.sp. R6 Bream AJ620554.1 T.sp. CLAR Clarias anguillaris AJ620555.1 T.sp. Ts-Ab-TB Bream AJ620556.1 T.sp. pseudobagri Yellow catfish EF375884.1 T.sp. Ts-Tt-HOD Tench AJ620553 T.sp. TS4 Roach KJ601718 T.sp. Ts-Se-BL Roach AJ620550.1 T.granulosum European eel AJ620551.1 T.pleuronectidium TLW Scaldfish DQ016617.1 T.haploblephari 93 Shark MZ061638.1 T.haploblephari morphotypeB Shark MZ061641.1

[0033] Based on the screened conserved regions, the present invention designs a primer-probe set, and the specific sequences are shown in Table 2 as follows:

[0034] Table 2 Primer and probe sequences used in the kit

[0035]

[0036]

[0037] In a preferred embodiment of the present invention, the recombinase polymerase amplification primer pair includes an upstream primer and a downstream primer; the upstream primer is selected from any one of the following: zc-ssu-F1, zc-ssu-F2, zc-ssu-F3, and zc-ssu-F4; the downstream primer is selected from any one of the following: zc-ssu-R1, zc-ssu-R2, and zc-ssu-R3. In the examples of the present invention, the amplification capabilities of multiple primer-probe sets were verified, such as the combination of zc-ssu-F1, zc-ssu-R1, and probe zc-ssu-P (abbreviated as F1+R1+P), the combination of zc-ssu-F1, zc-ssu-R2, and probe zc-ssu-P (abbreviated as F1+R2+P), the combination of zc-ssu-F1, zc-ssu-R3, and probe zc-ssu-P (F1+R3+P), the combination of zc-ssu-F2, zc-ssu-R1, and probe zc-ssu-P (F2+R1+P), the combination of zc-ssu-F2, zc-ssu-R2, and probe zc-ssu-P (F2+R2+P), the combination of zc-ssu-F2, zc-ssu-R3, and probe zc-ssu-P (F2+R3+P), the combination of zc-ssu-F3, zc-ssu-R1, and probe zc-ssu-P (F3+R1+P), the combination of zc-ssu-F3, zc-ssu-R2, and probe zc-ssu-P (F3+R2+P), the combination of zc-ssu-F3, zc-ssu-R3, and probe zc-ssu-P (F3+R3+P), the combination of zc-ssu-F4, zc-ssu-R1, and probe zc-ssu-P (F4+R1+P), the combination of zc-ssu-F4, zc-ssu-R2, and probe zc-ssu-P (F4+R2+P), the combination of zc-ssu-F4, zc-ssu-R3, and probe zc-ssu-P (F4+R3+P); then the sensitivities of F1+R2+P, F2+R2+P, and F3+R1+P were verified, and it was found that the sensitivity of F1+R2+P was the highest, which could detect 8 pg / μL of Trypanosoma crocea DNA, and the specificity of F1+R2+P was verified.

[0038] The present invention also provides a detection kit for Trypanosoma from aquatic animals, including the above detection reagents.

[0039] In a preferred embodiment of the present invention, the detection kit further includes a strip-type nucleic acid amplification reagent and a lateral flow detection strip.

[0040] The strip-type nucleic acid amplification reagent of the present invention can be an ERA method strip-type nucleic acid amplification reagent. In one embodiment, the strip-type nucleic acid amplification reagent (ERA method) and the lateral flow detection strip are both purchased from Suzhou Xianda Gene Technology Co., Ltd., and the 2×HiAmp PCR Master Mix (Dye) used in the PCR amplification system is purchased from CW Biotech Co., Ltd.

[0041] The present invention also provides a method for detecting Trypanosoma in aquatic animals, which includes the following steps: Mix the recombinase polymerase amplification primer pair and probe combination in the above detection reagent, or the primer-probe combination in the above detection kit with the genomic DNA of the aquatic animal to be tested to prepare a recombinase polymerase amplification system, add the recombinase polymerase amplification system and the activator to the strip-type nucleic acid amplification reagent, perform a recombinase polymerase amplification reaction, dilute the reaction product and place it in the lateral flow detection strip, and evaluate whether Trypanosoma exists in the aquatic animal to be tested according to the color change of the test line.

[0042] In a preferred embodiment of the present invention, taking the recombinase polymerase amplification system as 50 μL, it includes: upstream primer (10 μM) 1.68 μL, downstream primer (10 μM) 1.68 μL, probe (10 μM) 0.48 μL, genomic DNA (1 pg / μL - 200 ng / μL) 3 μL, and ddH2O 43.16 μL.

[0043] After adding the configured reaction system into the dry powder tube in the present invention, it is fully dissolved and mixed evenly, then 2 μL of the activator is added, quickly mixed evenly and centrifuged, and then placed at 45 °C for reaction for 15 min. After the reaction is completed, 5 μL of the reaction product is taken and added to 195 μL of ddH2O for dilution. The sample end of the lateral flow detection strip is put into the diluted product, and left standing for 5 min to observe the result. When the control line (C) shows a blue line and the test line (T) does not show a red line, the result is negative; when the control line (C) shows a blue line and the test line (T) shows a red line, the result is positive; when the control line (C) does not show a blue line, the result is invalid.

[0044] In order to further illustrate the present invention, the following examples are used to describe in detail a primer-probe group, kit and detection method for visual detection of Trypanosoma in aquatic animals provided by the present invention, but they should not be construed as limiting the protection scope of the present invention.

[0045] In the embodiments of the present invention, the reagents and reagent kits used, unless otherwise specified, are all conventional commercially available products in the art. For example, the strip-type nucleic acid amplification reagent (ERA method) and the lateral flow detection strip are purchased from Suzhou Xianda Gene Technology Co., Ltd., the QIAamp DNA Mini Kit is purchased from Qiagen, Germany, and the 2×HiAmp PCR MasterMix (Dye) is purchased from ComWin Biotech Co., Ltd.

[0046] Example 1

[0047] 1. Design of primers and probes

[0048] According to the published SSU rDNA gene sequences of Trypanosoma from aquatic animals in GenBank (Table 1), the software MegAlign was used to analyze the homology among the sequences, and the conserved regions were selected. Referring to the primer design requirements of the recombinase polymerase amplification technology, 4 upstream primers, 3 downstream primers, and 1 probe targeting the conserved regions were designed using the primerprimier 5 software to screen the best primer-probe combination for detecting the SSU rDNA gene of Trypanosoma from aquatic animals. The primer and probe sequences are shown in Table 2.

[0049] 2. Negative verification of downstream primers

[0050] To verify whether the downstream primers would bind to the probe to form false positives, the upstream primer zc-ssu-F1 was paired with 3 downstream primers respectively, plus the probe zc-ssu-P, and the recombinase polymerase amplification reaction was carried out using ddH2O as the template. At the same time, a positive control using the DNA of Trypanosoma sanguinis of Larimichthys crocea as the template was set up. The reaction system for each sample was prepared. After adding the reaction system to the dry powder tube, it was fully dissolved and mixed evenly. Then, 2 μL of activator was added, and after rapid mixing and centrifugation, it was placed at 45 °C for reaction for 15 min. After the reaction, 5 μL of the reaction product was added to 195 μL of ddH2O for dilution. The sample end of the lateral flow detection strip was placed into the diluted product, and the result was observed after standing for 5 min. When the control line (C) showed a blue line and the test line (T) did not show a red line, the result was negative; when the control line (C) showed a blue line and the test line (T) showed a red line, the result was positive; when the control line (C) did not show a blue line, the results were all invalid.

[0051] Reaction system: 2.1 μL of upstream primer (10 μM), 2.1 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 40.2 μL of ddH2O, and 3.0 μL of DNA template.

[0052] The results of the negative verification of the downstream primers are as Figure 1 shown. None of the 3 downstream primers would bind to the probe to form false positives, and specific bands could be amplified from the DNA of Trypanosoma sanguinis of Larimichthys crocea.

[0053] 3. Upstream primer screening

[0054] To screen out the upstream primer with the best reaction performance, four upstream primers were paired with three downstream primers in pairs, combined with the probe respectively, and a negative control with ddH2O as the template and a positive control with the DNA of Trypanosoma sanguinis of Larimichthys crocea as the template were set up. The reaction system was prepared according to step 2, and the results were observed after reacting at 45°C for 15 min.

[0055] The results are as Figure 2 shown. Three primer-probe combinations, such as F1+R2+P, F2+R2+P, and F3+R1+P, can amplify obvious specific bands from the positive control, and no false positives appear in the negative control.

[0056] 4. Primer and probe combination screening

[0057] Using the DNA of Trypanosoma sanguinis of Larimichthys crocea diluted in a 10-fold gradient (initial concentration: 80 ng / μL) as the template, recombinase polymerase amplification reaction was carried out with the three groups of primers and probe combinations screened, and a negative control with ddH2O as the template was set up at the same time. The reaction system, conditions, and result observation method were the same as those in step 2.

[0058] The results are as Figure 3 shown. The combination of F1+R2+P has the highest detection sensitivity, which is the DNA of Trypanosoma sanguinis diluted by -4 times, that is, 8 pg / μL of the DNA of Trypanosoma sanguinis of Larimichthys crocea.

[0059] 5. Optimization of reaction conditions and system

[0060] To determine the optimal reaction conditions, at different reaction temperatures (39°C, 42°C, 45°C, 48°C) and different reaction times (10 min, 15 min, 20 min), using the DNA of Trypanosoma sanguinis of Larimichthys crocea diluted by -3 ~ -5 times as the template, recombinase polymerase amplification reaction and result observation were carried out according to the system in step 2.

[0061] The results are as Figure 4 shown. The optimal reaction temperature is 45°C ( Figure 4 A in it), and the optimal reaction time is 15 min ( Figure 4 B in it).

[0062] To determine the optimal reaction system, the usage amounts of primers and probes in the reaction system were adjusted to 0.7, 0.8, and 1 times of those in step 2. Using the DNA of Trypanosoma sanguinis of Larimichthys crocea diluted by -3 ~ -5 times as the template, amplification was carried out with the optimized reaction conditions. The results showFigure 4 In C), the optimal reaction system is 0.8 times, that is, the upstream primer zc-ssu-F1 (10 μM) is 1.68 μL, the downstream primer zc-ssu-R2 (10 μM) is 1.68 μL, and the probe zc-ssu-P (10 μM) is 0.48 μL ， Genomic DNA (1 pg / μL - 200 ng / μL) is 3 μL, and ddH2O is 43.16 μL

[0063] 6. Specificity test

[0064] According to the instructions of the DNA extraction kit QIAamp DNA Mini Kit, extract the DNA of Argulus, Chilodonella, Cryptocaryon irritans, Ichthyophthirius multifiliis, Anisakis pegreffii, Hysterothylacium aduncum, Enterocytozoon hepatopenaei, and Gyrodactylus spp. respectively. Using the above DNA as templates, perform recombinase polymerase reaction under the optimized reaction system and conditions, and set up a negative control with ddH2O as the template and a positive control with the DNA of Trypanoplasma croceum of Larimichthys crocea as the template

[0065] The results are as Figure 5 shown, and the established detection method has good specificity

[0066] 7. Sensitivity test

[0067] Using the DNA of Trypanoplasma croceum of Larimichthys crocea (initial concentration of 80 ng / μL) diluted in a 10-fold gradient as the template, perform recombinase polymerase amplification reaction under the optimal reaction conditions and system. At the same time, detect different dilutions of DNA by the ordinary PCR method in the literature [Maslov DA, Lukes J, Jirku M, Simpson L. Phylogeny of trypanosomes as inferred from the small and large subunit rRNAs: implications for the evolution of parasitism in the trypanosomatid protozoa. Mol Biochem Parasitol. 1996 Jan;75(2):197 - 205. doi:10.1016 / 0166 - 6851(95)02526 - x. PMID:8992318.], and set up a negative control with ddH2O as the template

[0068] The results are as Figure 6 shown, and the sensitivity of the established detection method is 10 -4 times diluted DNA of Trypanoplasma croceum of Larimichthys crocea, that is, 8 pg / μL DNA of Trypanoplasma croceum of Larimichthys crocea, which is 10 3 times more sensitive than ordinary PCR

[0069] 8. Detection of Trypanosoma in Different Tissues of Larimichthys crocea

[0070] According to the instructions of the DNA extraction kit QIAamp DNA Mini Kit, the DNA of the gill mucus, blood, kidney, and spleen tissues of Larimichthys crocea infected with Trypanosoma cruzi was extracted respectively. Using the screened primer and probe combination, the DNA of each tissue of Larimichthys crocea was detected according to the optimal reaction conditions and system, and compared with the conventional PCR method.

[0071] The results are as Figure 7 shown. Obvious bands can be detected in the DNA of the gill mucus and blood tissues of Larimichthys crocea by the established method, weak bands can be detected in the DNA of the kidney tissue, no positive results are detected in the DNA of the spleen tissue, while only positive results of Trypanosoma can be detected in the DNA of the blood tissue by conventional PCR, and the detection results in the remaining tissues are all negative.

[0072] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments according to this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A detection reagent for trypanosomes from aquatic animals, characterized in that, It includes a recombinase polymerase amplification primer pair and a probe designed for the conserved region of the SSU rDNA gene of Trypanosoma from aquatic animals.

2. The detection reagent according to claim 1, wherein The recombinase polymerase amplification primer pair includes an upstream primer and a downstream primer; The upstream primer is selected from any one of the following: zc-ssu-F1, zc-ssu-F2, zc-ssu-F3, and zc-ssu-F4; The downstream primer is selected from any one of the following: zc-ssu-R1, zc-ssu-R2, and zc-ssu-R3; The nucleotide sequences of zc-ssu-F1, zc-ssu-F2, zc-ssu-F3, zc-ssu-F4, zc-ssu-R1, zc-ssu-R2, and zc-ssu-R3 are shown as SEQ ID No.1 to SEQ ID No.

7.

3. The detection reagent according to claim 1, wherein The nucleotide sequence of the probe is shown as SEQ ID No.

8.

4. The detection reagent according to claim 3, wherein The detection reagent includes the following combinations: the combination of zc-ssu-F1, zc-ssu-R2, and the probe; the combination of zc-ssu-F2, zc-ssu-R2, and the probe; the combination of zc-ssu-F3, zc-ssu-R1, and the probe.

5. A detection kit for trypanosomes derived from aquatic animals, characterized in that, It includes the detection reagent according to any one of claims 1 to 4.

6. The detection kit according to claim 5, characterized in that, The detection kit further includes a strip-type nucleic acid amplification reagent and a lateral flow detection strip.

7. A method for detecting trypanosoma from aquatic animals, characterized in that, It includes the following steps: Using the recombinase polymerase amplification primer pair and probe combination in the detection reagent according to any one of claims 1 to 4, or the primer-probe combination in the detection kit according to claim 5 or 6, to mix and prepare a recombinase polymerase amplification system with the genomic DNA of the aquatic animal to be tested. Add the recombinase polymerase amplification system and an activator into the strip-type nucleic acid amplification reagent, perform a recombinase polymerase amplification reaction, dilute the reaction product, and place it in the lateral flow detection strip. Evaluate whether Trypanosoma exists in the aquatic animal to be tested according to the color change of the detection line.

8. The method according to claim 7, wherein Taking the recombinase polymerase amplification system as 50 μL, it includes: 1.68 μL of each of the upstream and downstream primers at 10 μM, 0.48 μL of the probe at 10 μM, 3 μL of genomic DNA, and the balance of ddH2O.

9. The method according to claim 7, wherein The temperature of the recombinase polymerase amplification reaction is 45 °C, and the reaction time is 15 min.

10. The method according to claim 7, wherein It includes putting the diluted reaction product into the sample end of the lateral flow detection strip, and observing the result after standing; When a blue line appears in the quality control line and no red line appears in the detection line, the result is negative; When a blue line appears in the quality control line and a red line appears in the detection line, the result is positive; When no blue line appears in the quality control line, the result is invalid.

Images