High-efficiency single base editing system of salvia miltiorrhiza and application thereof

By constructing a single-base editing system for tanshinone, and utilizing the SmABE8e and SmAKBE fusion proteins to achieve efficient single-base editing, the problem of low base editing efficiency in tanshinone was solved, and the content of tanshinone and salvianolic acid in tanshinone was increased.

CN120290624BActive Publication Date: 2026-02-27INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510482384.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2026-02-27
Estimated Expiration
2045-04-17

AI Technical Summary

Technical Problem

Existing technologies for editing the bases of tanshinone are not very efficient and cannot achieve precise modification of single bases.

Method used

A single-base editing system for Danshen was constructed, including a 35SEN complex promoter, sgRNA, SmRPS5A promoter, and fusion proteins SmABE8e or SmAKBE. The SmABE8e fusion protein was used to achieve 100.0% editing efficiency and expand the editing window to 3–11 positions. The SmAKBE fusion protein enabled A:T-to-T:A and A:T-to-C:G base conversions.

Benefits of technology

Efficient single-base editing was achieved in Salvia miltiorrhiza, increasing the content of tanshinone and salvianolic acid. By editing the 5'UTR of SmMYB1 and the stop codon of SmKSL2, the uATG, ORF and protein structure were disrupted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290624B_ABST
    Figure CN120290624B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of efficient salvia miltiorrhiza single base editing system and its application, belong to base editing technical field.The present application provides a kind of salvia miltiorrhiza single base editing system, the salvia miltiorrhiza single base editing system includes 35SEN complex promoter, sgRNA, SmRPS5A promoter and fusion protein;The fusion protein is SmABE8e fusion protein or SmAKBE fusion protein.According to the present application, efficient salvia miltiorrhiza single base editing system SmABE8e-03 and SmAKBE-03 are successfully constructed, can edit the base of salvia miltiorrhiza, and salvia miltiorrhiza single base editing system can edit the 5'UTR of SmMYB1 gene and the termination codon of SmKSL2 protein, by destroying uATG, ORF and protein structure, can improve the content of tanshinone and salvianolic acid in salvia miltiorrhiza under the condition of not affecting its growth trait.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of base editing technology, and in particular to a high-efficiency salvia miltiorrhiza single-base editing system and application thereof. BACKGROUND

[0002] Salvia miltiorrhiza is an important traditional Chinese medicinal material for treating coronary heart disease, inflammatory response and tumors, and adjusting the nucleotide sequence of salvia miltiorrhiza can increase the content of effective components in salvia miltiorrhiza, although CRISPR / Cas-mediated gene knockout technology has realized random deletion or insertion of small fragments in salvia miltiorrhiza, but the gene knockout technology is to delete or insert genes, and cannot realize precise modification of single base, while the single-base editing technology can realize editing of base and mutation of single base pair, and is more precise, and at present, the single-base editing technology is less applied in salvia miltiorrhiza, and the editing efficiency is not high.

[0003] Therefore, the present application is provided. SUMMARY

[0004] The present application aims to provide a high-efficiency salvia miltiorrhiza single-base editing system and application thereof, so as to solve the problem of low base editing efficiency of salvia miltiorrhiza in the prior art.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions.

[0006] The present application provides a salvia miltiorrhiza single-base editing system, which comprises a 35SEN composite promoter, sgRNA, a SmRPS5A promoter and a fusion protein.

[0007] The fusion protein is a SmABE8e fusion protein or a SmAKBE fusion protein.

[0008] The nucleotide sequence for compiling the SmABE8e fusion protein is shown in SEQ ID NO. 1.

[0009] The nucleotide sequence for compiling the SmAKBE fusion protein is shown in SEQ ID NO. 2.

[0010] Preferably, the SmABE8e fusion protein comprises an adenine deaminase TadA8e and an nCas9 protein.

[0011] The nucleotide sequence of the adenine deaminase TadA8e is shown in SEQ ID NO. 3.

[0012] The nucleotide sequence of the nCas9 protein is shown in SEQ ID NO. 4.

[0013] Preferably, the SmAKBE fusion protein comprises adenine deaminase TadA8e, nCas9 protein, N-methyl purine DNA glycosylase, Salvia miltiorrhiza TLS polymerase η and hygromycin phosphotransferase II;

[0014] The nucleotide sequence of the adenine deaminase TadA8e is shown as SEQ ID NO. 3;

[0015] The nucleotide sequence of the nCas9 protein is shown as SEQ ID NO. 4;

[0016] The nucleotide sequence of the N-methyl purine DNA glycosylase is shown as SEQ ID NO. 5;

[0017] The nucleotide sequence of the Salvia miltiorrhiza TLS polymerase η is shown as SEQ ID NO. 6;

[0018] The nucleotide sequence of the hygromycin phosphotransferase II is shown as SEQ ID NO. 7.

[0019] Preferably, the nucleotide sequence of the 35SEN composite promoter is shown as SEQ ID NO. 8.

[0020] Preferably, the 35SEN composite promoter comprises CaMV 35S enhancer, CmYLCV promoter and AtU6-26 promoter;

[0021] The nucleotide sequence of the CaMV 35S enhancer is shown as SEQ ID NO. 9;

[0022] The nucleotide sequence of the CmYLCV promoter is shown as SEQ ID NO. 10;

[0023] The nucleotide sequence of the AtU6-26 promoter is shown as SEQ ID NO. 11.

[0024] Preferably, the nucleotide sequence of the SmRPS5A promoter is shown as SEQ ID NO. 12.

[0025] Preferably, the sgRNA targets Salvia miltiorrhiza SmMYB1 gene, SmHMGR1 gene or SmKSL2 gene.

[0026] Preferably, the nucleotide sequence of the sgRNA targeting Salvia miltiorrhiza SmMYB1 gene is shown as SEQ ID NO. 13;

[0027] The nucleotide sequence of the sgRNA targeting Salvia miltiorrhiza SmHMGR1 gene is shown as SEQ ID NO. 14;

[0028] The nucleotide sequence of the sgRNA targeting the Danshen SmKSL2 gene is as shown in SEQ ID NO. 15.

[0029] The application provides application of the Danshen single-base editing system in Danshen base editing.

[0030] The application provides application of the Danshen single-base editing system in cultivating high-quality Danshen plants.

[0031] The application has the following technical effects and advantages:

[0032] The application successfully constructs efficient Danshen single-base editing systems SmABE8e-03 and SmAKBE-03, wherein the Danshen single-base editing system SmABE8e-03 can achieve an editing efficiency of 100.0% at most, and can realize simultaneous editing of multiple sites; the Danshen single-base editing system SmAKBE-03 expands the editing window of ABE to 3-11 sites, and realizes base conversion of A:T-to-T:A and A:T-to-C:G, so that different forms of base editing can be realized in Danshen.

[0033] The application edits the 5'UTR of SmMYB1 and the stop codon of SmKSL2 through the Danshen single-base editing systems SmABE8e-03 and SmAKBE-03 respectively, and improves the content of tanshinone and salvianolic acid by destroying uATG, ORF and protein structure. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 FIG. 1 is a structural diagram of the Danshen single-base editing system SmABE8e-01 editing system;

[0035] Figure 2 FIG. 2 is a structural diagram of the Danshen single-base editing system SmABE8e-02 editing system;

[0036] Figure 3 FIG. 3 is a structural diagram of the Danshen single-base editing system SmABE8e-03 editing system;

[0037] Figure 4 FIG. 4 is editing efficiency of sgRNA of the Danshen single-base editing system SmABE8e-01 / 02 / 03 targeting SmMYB1, SmKSL2 and SmHMGR1 genes;

[0038] Figure 5 FIG. 5 is base substitution efficiency of different sites of the Danshen single-base editing system SmABE8e-03;

[0039] Figure 6 FIG. 6 is a result of base editing on Danshen plants by the Danshen single-base editing system SmABE8e-03.

[0040] Figure 7 transcription levels of SmMYB1 in plants #1 and #18 in T0 generation edited strains;

[0041] Figure 8 metabolite contents of wild type Salvia miltiorrhiza plants and base edited Salvia miltiorrhiza plants;

[0042] Figure 9 phenotypes of wild type Salvia miltiorrhiza plants and T0 generation edited strain #1;

[0043] Figure 10 structure diagram of a Salvia miltiorrhiza base editing system SmABE8e-03-Dual;

[0044] Figure 11 editing efficiencies of sgRNAs targeting SmKSL2, SmHMGR1 and SmKSL2+SmHMGR1 genes of a Salvia miltiorrhiza base editing system SmABE8e-03-Dual;

[0045] Figure 12 structure diagram of a Salvia miltiorrhiza single base editing system SmAKBE-03;

[0046] Figure 13 editing efficiencies of sgRNAs targeting SmMYB1 and SmKSL2 genes of a Salvia miltiorrhiza single base editing system SmAKBE-03;

[0047] Figure 14 base substitution efficiencies of different sites of a Salvia miltiorrhiza single base editing system SmAKBE-03;

[0048] Figure 15 base editing results of a Salvia miltiorrhiza single base editing system SmAKBE-03 targeting SmKSL2 gene on Salvia miltiorrhiza plants;

[0049] Figure 16 transcription levels of SmKSL2 in plants #9 and #35 in T0 generation edited strains;

[0050] Figure 17 metabolite contents of wild type Salvia miltiorrhiza plants and base edited Salvia miltiorrhiza plants;

[0051] Figure 18 phenotypes of wild type Salvia miltiorrhiza plants and T0 generation edited strain #1. DETAILED DESCRIPTION

[0052] The application provides a Salvia miltiorrhiza single base editing system, which comprises a 35SEN composite promoter, sgRNA, a SmRPS5A promoter and a fusion protein.

[0053] the fusion protein is a SmABE8e fusion protein or a SmAKBE fusion protein;

[0054] The nucleotide sequence of the SmABE8e fusion protein is shown as SEQ ID NO. 1;

[0055]

[0056] The nucleotide sequence of the SmAKBE fusion protein is shown in SEQ ID NO. 2;

[0057]

[0058] In the present application, the SmABE8e fusion protein comprises adenine deaminase TadA8e and nCas9 protein;

[0059] Preferably, the SmABE8e fusion protein is composed of nuclear localization sequence NLS-1, adenine deaminase TadA8e (V106W), Linker-1 sequence, nCas9 (D10A), nuclear localization sequence NLS-2 in order;

[0060] The nucleotide sequence of the nuclear localization sequence NLS-1 is shown in SEQ ID NO. 19;

[0061] The nucleotide sequence of SEQ ID NO. 19 is: ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTC;

[0062] The nucleotide sequence of the adenine deaminase TadA8e (V106W) is shown in SEQ ID NO. 3;

[0063] The nucleotide sequence of SEQ ID NO. 3 is: TCTGAGGTGGAGTTCAGCCACGAGTACTGGATGAGGCACGCCCTGACCCTGGCAAAGCGGGCCAGAGACGAGAGAGAGGTGCCCGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCTACAGCACACGCAGAGATCATGGCACTGAGGCAGGGAGGCCTGGTCATGCAGAATTACCGCCTGATCGATGCCACCCTGTATGTGACATTCGAGCCATGCGTGATGTGCGCAGGAGCAATGATCCACAGCAGGATCGGCCGCGTGGTGTTTGGATGGAGGAACTCCAAGAGGGGAGCAGCAGGCTCTCTGATGAACGTGCTGAATTACCCAGGCATGAATCACCGGGTGGAGATCACCGAGGGCATCCTGGCAGACGAGTGCGCCGCCCTGCTGTGCGATTTCTATCGGATGCCCAGACAGGTGTTTAACGCCCAGAAGAAGGCCCAGAGCAGCATCAAC;

[0064] The nucleotide sequence of the Linker-1 sequence is shown as SEQ ID NO. 20;

[0065] The nucleotide sequence of SEQ ID NO. 20 is: TCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGGGGATCC;

[0066] The nucleotide sequence of the nCas9(D10A) protein is shown as SEQ ID NO. 4;

[0067]

[0068] The nucleotide sequence of the nuclear localization sequence NLS-2 is shown as SEQ ID NO. 21;

[0069] The nucleotide sequence of SEQ ID NO. 21 is: AAAAGAACCGCCGACGGCAGCGAATTCGAGCCCAAGAAGAAGAGGAAAGTC.

[0070] In the present application, the SmAKBE fusion protein comprises adenine deaminase TadA8e, nCas9 protein, N-methyl purine DNA glycosylase, Danshen TLS polymerase η and hygromycin phosphotransferase II;

[0071] Preferably, the SmAKBE fusion protein is composed of nuclear localization sequence NLS-1, TadA8e (V106W), Linker-1 sequence, nCas9 (D10A), nuclear localization sequence NLS-2, Linker-2 sequence, N-methyl purine DNA glycosylase, nuclear localization sequence biNLS, Danshen TLS polymerase η, hygromycin phosphotransferase II, sequentially connected;

[0072] The nucleotide sequence of the nuclear localization sequence NLS-1 is shown as SEQ ID NO. 19;

[0073] The nucleotide sequence of the adenine deaminase TadA8e (V106W) is shown as SEQ ID NO. 3;

[0074] The nucleotide sequence of the Linker-1 sequence is shown as SEQ ID NO. 20;

[0075] The nucleotide sequence of the nCas9 (D10A) protein is shown as SEQ ID NO. 4;

[0076] The nucleotide sequence of the nuclear localization sequence NLS-2 is shown as SEQ ID NO. 21;

[0077] The nucleotide sequence of the Linker-2 sequence is shown as SEQ ID NO. 22;

[0078] The nucleotide sequence of SEQ ID NO. 22 is: TCAGGGGGAAGTGGTGGTTCTGGTGGATCG;

[0079] The nucleotide sequence of the N-methyl purine DNA glycosylase is shown as SEQ ID NO. 5;

[0080] The nucleotide sequence of SEQ ID NO. 5 is: GTGACCCCAGCTCTCCAGATGAAGAAGCCGAAGCAATTCTGTAGAAGGATGGGCCAGAAAAAGCAGAGGCCGGCCAGGGCTGGGCAACCTCATTCCTCGTCCGATGCGGCACAAGCCCCAGCAGAACAGCCTCATTCTTCCTCTGACGCCGCCCAAGCGCCCTGTCCACGTGAAAGATGTCTCGGACCTCCTACCACGCCAGGTCCATACCGCAGCATCTACTTTAGCTCGCCCAAGGGCCATTTGACGAGGTTGGGGCTGGAGTTCTTTGATCAACCGGCCGTTCCACTCGCAAGAGCGTTCTTGGGGCAAGTGCTGGTTAGGAGGTTGCCTAACGGAACGGAATTGCGCGGACGCATCGTTGAGACAGAGGCCTACCTGGGTCCTGAGGATGAAGCTGCGCATAGCCGGGGAGGCAGGCAAACACCTAGGAATAGAGGAATGTTCATGAAGCCAGGGACGCTGTACGTCTACATAATATACCGCATGTACTTTTGTATGTCGATCAGCAGTCAGGGCGACGGAGCGTGCGTTCTTCTTAGAGCCCTCGAGCCTCTGGAAGGCCTGGAGACGATGAGACAGCTTAGGGCCACATTGCGGGCTGCTACTGCTGCAAGGGTACTCGCGGACCGTGAACTCTGTTCTGGTCCTTCCAAGCTGTGCCAGGCATTGGCCATAAATAAGAGCTTTGACCAGAGAGACCTCGCTCAGGACGAAGCAGTTTGGCTCGAACGCGGACCCCTGGAACCAAGCGAACCAGCTGTTGTTGCAGCAGCGAGAGTTGGAGTGGGTCATGCGGGAGAATGGGCCAGGAAACCCCTGCGTTTTTATGTACGTGGGTCACCGTGGGTGTCAGTGGTTGATCGCGTCGCCGAACAGGATACTCAAGCG;

[0081] The nucleotide sequence of the nuclear localization sequence biNLS is shown in SEQ ID NO. 23;

[0082] The nucleotide sequence of SEQ ID NO. 23 is: AGTGGAGGTTCGAAACGGACAGCAGACGGAAGCGAGTTTGAGCCGAAGAAGAAAAGAAAAGT G;

[0083] The nucleotide sequence of the Salvia miltiorrhiza TLS polymerase η is shown as SEQ ID NO. 6;

[0084]

[0085] The nucleotide sequence of the hygromycin phosphotransferase II is shown as SEQ ID NO. 7;

[0086]

[0087] In the present application, the nucleotide sequence of the 35 SEN composite promoter is shown as SEQ ID NO. 8;

[0088]

[0089] In the present application, the 35 SEN composite promoter comprises a CaMV 35S enhancer, a CmYLCV promoter and an AtU6-26 promoter;

[0090] The nucleotide sequence of the CaMV 35S enhancer is shown as SEQ ID NO. 9;

[0091] The nucleotide sequence of SEQ ID NO. 9 is: ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAT;

[0092] The nucleotide sequence of the CmYLCV promoter is shown as SEQ ID NO. 10;

[0093] The nucleotide sequence of SEQ ID NO. 10 is: TGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAGTCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGACGACGAAAACAGGTAAGAGCTAAGC;

[0094] The nucleotide sequence of the AtU6-26 promoter is shown as SEQ ID NO. 11.

[0095] The nucleotide sequence of SEQ ID NO. 11 is: AAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATA CAGCTAGAGTCGAAGTAGTGATTG.

[0096] In the present application, the nucleotide sequence of the SmRPS5A promoter is shown as SEQ ID NO. 12.

[0097]

[0098] In the present application, the sgRNA targets Salvia miltiorrhiza SmMYB1 gene, SmHMGR1 gene or SmKSL2 gene.

[0099] In the present application, the nucleotide sequence of the sgRNA targeting Salvia miltiorrhiza SmMYB1 gene is as shown in SEQ ID NO. 13.

[0100] The nucleotide sequence of SEQ ID NO. 13 is: GGTCATGGGCAAAGTGTGTGTGG.

[0101] The nucleotide sequence of the sgRNA targeting Salvia miltiorrhiza SmHMGR1 gene is as shown in SEQ ID NO. 14.

[0102] The nucleotide sequence of SEQ ID NO. 14 is: CCTCCTTCATCTATCTCCTCGG.

[0103] The nucleotide sequence of the sgRNA targeting Salvia miltiorrhiza SmKSL2 gene is as shown in SEQ ID NO. 15.

[0104] The nucleotide sequence of SEQ ID NO. 15 is: CCTTCCTTGGCTTATGATTGTGA.

[0105] The present application provides application of the Salvia miltiorrhiza single base editing system in Salvia miltiorrhiza base editing.

[0106] The present application provides application of the Salvia miltiorrhiza single base editing system in cultivating high-quality Salvia miltiorrhiza plants.

[0107] The technical solutions provided by the present application will be described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the present application.

[0108] Example 1: Construction of Salvia miltiorrhiza single base editing system

[0109] 1. Construction of Salvia miltiorrhiza single base editing system

[0110] In order to explore whether single base editing can be carried out in Danshen, Arabidopsis AtU6 (NCBI genbank number: X52528.1) and CaMV 35S enhancer (35S) were used to drive sgRNA and editor table (fusion protein). Specifically, nuclear localization sequence NLS-1 (SEQ ID NO. 19), adenine deaminase TadA8e (V106W) (SEQ ID NO. 3), Linker-1 sequence (SEQ ID NO. 20), nCas9 (D10A) (SEQ ID NO. 4), and nuclear localization sequence NLS-2 (SEQ ID NO. 21) were sequentially linked by ShangHai Genechem Co., Ltd. to obtain SmABE8e fusion protein. The nucleotide sequence of SmABE8e fusion protein is shown in SEQ ID NO. 1. Then, Arabidopsis AtU6 promoter, sgRNA, 35S promoter and SmABE8e fusion protein were combined by enzyme digestion and ligation and seamless cloning to recombine the backbone vector pCambia1300 (Addgene global plasmid sharing platform) to obtain a Danshen single base editing system, named SmABE8e-01. The structure of SmABE8e-01 editing system is shown in Figure 1 The nucleotide sequence of 35S promoter is shown in Table 1.

[0111] Table 1 Nucleotide sequences of Arabidopsis AtU6 promoter and 35S promoter

[0112] Name Nucleotide sequence CaMV 35S enhancer (35S) SEQ ID NO. 9

[0113] 2. Verification of Danshen single base editing system

[0114] To verify whether the Danshen single base editing system can achieve single base editing of Danshen, sgRNA1 targeting SmMYB1, SmPAL, SmKSL2, SmHMGR1 and SmCPS2 was designed, and the results are shown in Table 2.

[0115] Table 2 sgRNA targeting different genes

[0116] Gene name sgRNA sequence SmMYB1 GGTCATGGGCAAAGTGTGTGTGG (SEQ ID NO. 13) SmPAL CCTCCTTCATCTATCTCCTCGG (SEQ ID NO. 16) SmKSL2 CCTTCCTTGGCTTATGATTGTGA (SEQ ID NO. 15) SmHMGR1 CGTCGATGAGATCCAATCAACGG (SEQ ID NO. 14) SmCPS2 CCAAGGCCTGCCCTATGATCATC (SEQ ID NO. 17)

[0117] Agrobacterium transformation of Danshen plants was used for verification, and the specific method was as follows:

[0118] 1. sgRNA sequences targeting different genes were added to the SmABE8e-01 editing system to obtain SmABE8e-01 editing systems targeting different genes. The SmABE8e-01 editing system includes the Arabidopsis thaliana AtU6 promoter (NCBI genbank number: X52528.1), CaMV 35S enhancer, sgRNA, and SmABE8e fusion protein. The nucleotide sequence of the CaMV 35S enhancer is shown in SEQ ID NO.9, and the nucleotide sequence of the SmABE8e fusion protein is shown in SEQ ID NO.1. The SmABE8e fusion protein includes adenine deaminase TadA8e (nucleotide sequence SEQ ID NO.3) and nCas9 protein (nucleotide sequence SEQ ID NO.4). The SmABE8e-01 editing system targeting different genes was transformed into Agrobacterium GV3101.

[0119] 2. Select healthy Salvia miltiorrhiza seedlings that have grown for 3 weeks from tissue culture bottles. Cut off the terminal leaves in a clean bench and place them in a 10mL MS petri dish (PhytoTech Labs, catalog number M519). First, remove the leaf edges, then trim the leaves to 1cm lengths. 2 The cut leaves were placed in a square container of GV3101 bacterial suspension (cultured in YEB liquid medium containing Rif) with an OD600 value of 0.4, sealed, and incubated at 28°C and 160 rpm for 15 min on a shaker. The leaves were then removed from the clean bench and placed on absorbent paper to blot dry the bacterial suspension. The leaves were then placed in a petri dish of solid MS medium (purchased from Phyto Technology, M519 Murashige & Skoog Basal Medium with Vitamins), with the underside of the leaves facing up, and sealed. The leaves were then incubated in the dark for 36 h. After dark incubation, the leaves were transferred to a 100 mL Erlenmeyer flask and rinsed 6 times with sterile water until the liquid was clear. The leaves were then transferred to sterile absorbent paper (four layers at the bottom and three layers at the top) to blot dry. Finally, the leaves were transferred to a container containing 25 μg / mL Rif and 400 μg / mL Rif. After culturing on 1 / 2 MS differentiation medium (same as MS medium, but MS medium was used at half the dose) for 15 days, callus grew from the edge of the leaf wound. Then, the plants were transferred to MS differentiation medium containing 5 μg / mL Hyg and 400 μg / mL Cef for screening. The concentration of Cef was gradually reduced to obtain hygromycin-positive T0 tanshinone plants.

[0120] 3. The sgRNA sequences of the T0 salvia miltiorrhiza plants were amplified by PCR using primer pairs targeting different sgRNA sequences, and the amplified products were sequenced by Sanger sequencing to determine whether the T0 salvia miltiorrhiza plants had undergone base editing events. The results are shown in Table 3.

[0121] Table 3: Editing results of different SmABE8e-01 editing systems for different genes

[0122]

[0123]

[0124] According to Table 3, a total of 397 hygromycin-positive salvia miltiorrhiza T0 plants were obtained by Agrobacterium transformation of salvia miltiorrhiza, including 120 plants of SmMYB1 gene, 20 plants of SmPAL gene, 87 plants of SmKSL2 gene, 120 plants of SmHMGR1 gene, and 120 plants of SmCPS2 gene. Sanger sequencing of the T0 salvia miltiorrhiza plants showed that among the 397 transgenic plants at the 5 target points of the SmABE8e-01 editing system, only the A5 site of the sgRNA of the SmMYB1 gene showed a low degree of A to G editing, with an editing efficiency of 22 / 120 (18.3%), and the low editing efficiency may be related to the complexity of the salvia miltiorrhiza genome.

[0125] In summary, it is known that the salvia miltiorrhiza single base editing system SmABE8e-01 achieves single base editing of the sgRNA sequence of the SmMYB1 gene of salvia miltiorrhiza, but the editing efficiency is low.

[0126] Example 2: Optimization of salvia miltiorrhiza single base editing system

[0127] It has been shown that the expression of sgRNA and editor is the bottleneck limiting the editing efficiency. In order to develop a more efficient A to G editor, the present application optimizes the promoters regulating sgRNA and editor, adopts SmU6, composite promoter 35SEN (composed of CaMV 35S enhancer, CmYLCV promoter and shortened AtU6-26 promoter) and SmRPS5A promoter to regulate the expression of sgRNA and fusion protein, adopts SmU6, composite promoter 35SEN and SmRPS5A promoter to combine with sgRNA and SmABE8e fusion protein prepared in Example 1, and recombines on the backbone vector pCambia1300 (Addgene global plasmid sharing platform) by enzyme digestion, ligation and seamless cloning to obtain a salvia miltiorrhiza single base editing system, obtain a salvia miltiorrhiza single base editing system SmABE8e-02 combined with SmU6 and SmRPS5A promoter and a salvia miltiorrhiza single base editing system SmABE8e-03 combined with composite promoter 35SEN and SmRPS5A promoter, the structure of the salvia miltiorrhiza single base editing system SmABE8e-02 is as shown in Figure 2 the salvia miltiorrhiza single base editing system SmABE8e-03 is as shown in Figure 3 .

[0128] The nucleotide sequence of the SmU6 promoter is: AAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGATT (SEQ ID NO. 18).

[0129] The nucleotide sequence of the composite promoter 35SEN is as shown in SEQ ID NO. 8.

[0130] The nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO. 9.

[0131] The nucleotide sequence of the CmYLCV promoter is as shown in SEQ ID NO. 10.

[0132] The nucleotide sequence of the AtU6-26 promoter is as shown in SEQ ID NO. 11.

[0133] The nucleotide sequence of the SmRPS5A promoter is as shown in SEQ ID NO. 12.

[0134] The sgRNA sequences targeting SmMYB1, SmKSL2, SmHMGR1 genes in Example 1 were added to the SmABE8e-02 and SmABE8e-03 base editing systems to obtain the Salvia miltiorrhiza single base editing system SmABE8e-02 and the Salvia miltiorrhiza single base editing system SmABE8e-03 targeting different genes, respectively, and then the Agrobacterium transformation method of Salvia miltiorrhiza plants in Example 1 was used for verification, and the results are shown in Table 4, and then the editing efficiency of the sgRNA of the Salvia miltiorrhiza single base editing system SmABE8e-01 / 02 / 03 targeting SmMYB1, SmKSL2, SmHMGR1 genes was counted, and the results are shown in Figure 4

[0135] Table 4 Editing results of Salvia miltiorrhiza single base editing system SmABE8e-02 and SmABE8e-03 targeting different genes

[0136]

[0137]

[0138] According to Table 4 and Figure 4 It can be known that when Agrobacterium is transformed into Salvia miltiorrhiza, 162 hygromycin positive Salvia miltiorrhiza T0 plants are obtained by the Salvia miltiorrhiza single base editing system SmABE8e-02, and 95 hygromycin positive Salvia miltiorrhiza T0 plants are obtained by the Salvia miltiorrhiza single base editing system SmABE8e-03. By comparison with the Salvia miltiorrhiza single base editing system SmABE8e-01, the editing efficiency of the Salvia miltiorrhiza single base editing system SmABE8e-02 and SmABE8e-03 is improved to a certain extent. Among them, the Salvia miltiorrhiza single base editing system SmABE8e-03 has high A:T-to-G:C base substitution efficiency and T0 generation editing efficiency, and even pure editing occurs at three sites. The sgRNA fragment targeting SmMYB1, SmKSL2, SmHMGR1 genes has a base editing efficiency of 36.6%, 22.5% and 26.3% for the Salvia miltiorrhiza single base editing system SmABE8e-02, respectively, and a base editing efficiency of 100%, 58.3% and 81.0% for the Salvia miltiorrhiza single base editing system SmABE8e-03, respectively, indicating that the Salvia miltiorrhiza single base editing system SmABE8e-03 has high editing efficiency.

[0139] The base substitution efficiency of the Salvia miltiorrhiza single base editing system SmABE8e-03 at different sites was determined, and the results are shown in Table 5. Figure 5

[0140] According to Figure 5 ​​It can be seen that the base substitution efficiency of different A sites of the Salvia miltiorrhiza single base editing system SmABE8e-03 is significantly different, the editing efficiency of the A5 site of the sgRNA fragment targeting the SmMYB1 gene of the Salvia miltiorrhiza single base editing system SmABE8e-03 reaches 100.0%, the editing efficiency of the A4 site of the sgRNA fragment targeting the SmHMGR1 gene is 58.3%, and the base editing event also occurs at the A9 site, and the base editing events occur at the A5 and A6 sites of the sgRNA fragment targeting the SmKSL2 gene, but the editing efficiency of the A6 site is significantly reduced, indicating that when there are two consecutive AAs, the efficiency at the second A site is significantly reduced. It is known that when the editing window covers the A4 to A9 positions of the protospacer, the A near the position 5 shows the highest editing frequency, indicating that the Salvia miltiorrhiza single base editing system SmABE8e-03 regulated by the combination of the composite promoter 35SEN and the SmRPS5A promoter can perform efficient A:T-G:C base substitution in Salvia miltiorrhiza.

[0141] Example 3: Base editing effect test

[0142] The periderm, phloem and xylem of the dried roots of Salvia miltiorrhiza contain rich tanshinones and salvianolic acid compounds, which are the key to the medicinal ingredients of Salvia miltiorrhiza, and transcription factors have important regulatory effects on the biosynthesis thereof, and MYB class transcription factors can positively regulate the synthesis of related compounds. Studies have shown that knocking out the upstream initiation codon (uATG) or the upstream open reading frame (uORF) in plants can regulate the translation and post-translational modification of related proteins, thereby improving the stability of protein expression.

[0143] The inventors found a uORF encoding 9 amino acids (MGKVCVGR*) in the 5'UTR of SmMYB1, and then designed a suitable sgRNA for the uORF, i.e., sgRNA1 targeting the SmMYB1 gene designed in Example 1, edited the uATG in the 5'UTR of SmMYB1 into uGTG, thereby destroying the uATG and uORF and improving the translation efficiency of pATG. The Salvia miltiorrhiza single base editing system SmABE8e-03 targeting the SmMYB1 gene in Example 2 was used to edit the Salvia miltiorrhiza plants, and the method referred to the method of transforming Salvia miltiorrhiza plants with Agrobacterium in Example 1, and wild-type Salvia miltiorrhiza plants were used as controls, and the editing results are shown in Table 5 and Figure 6 .

[0144] Table 5 Editing results of the Salvia miltiorrhiza single base editing system SmABE8e-03 on the uORF of SmMYB1 gene of Salvia miltiorrhiza

[0145]

[0146] According to Table 5 and Figure 6 It can be known that 43 hygromycin positive Salvia miltiorrhiza T0 plants were obtained by using the Salvia miltiorrhiza single base editing system SmABE8e-03 to edit the uORF of the Salvia miltiorrhiza SmMYB1 gene. Through genotype analysis of the T0 plants, it was found that the uATG-uGTG mutant material was successfully obtained, and the editing efficiency reached 100.0%, of which 4.7% were homozygous edited.

[0147] Then, the transcription level of SmMYB1 in T0 generation edited strains #1 and #18 was determined by qPCR, and the results are shown in Figure 7 .

[0148] According to Figure 7 It can be known that the expression level of the Salvia miltiorrhiza plant edited by the Salvia miltiorrhiza single base editing system SmABE8e-03 has no significant difference from that of the wild type Salvia miltiorrhiza plant.

[0149] The contents of related metabolites in all base edited Salvia miltiorrhiza plants and wild type Salvia miltiorrhiza plants were detected by ultra-high performance liquid chromatography-electrospray triple quadrupole mass spectrometry (UPLC-TQ-MS), and the results are shown in Figure 8 . By comparing the phenotype of the wild type Salvia miltiorrhiza plant and the T0 generation edited strain #1, the results are shown in Figure 9 .

[0150] According to Figure 8 It can be known that the content of tanshinone compounds in the base edited Salvia miltiorrhiza plant is significantly increased, wherein the total content of four main tanshinone compounds tanshinone I (Tan I), tanshinone IIA (Tan IIA), Dihydrotanshinone I (DHT), and cryptotanshinone (CPT) is increased by 1.6, 2.5, 1.9, and 2.1 times, respectively; the contents of salvianolic acid A (DFSA), salvianolic acid B (DFSB), and rosmarinic acid (RA) in salvianolic acid compounds are increased by 1.4, 1.5, and 3.3 times, respectively. Figure 9 It can be known that the base edited Salvia miltiorrhiza plant does not affect the normal growth of the Salvia miltiorrhiza plant in the case of increasing the content of effective components, which comprehensively indicates that the Salvia miltiorrhiza single base editing system SmABE8e-03 has important potential in improving Salvia miltiorrhiza metabolites.

[0151] The 35SEN-gRNA-gRNA-35SEN dual target was constructed by a bidirectional expression frame of sgRNA, and the 35SEN-gRNA-gRNA-35SEN dual target was combined with the SmABE8e fusion protein. Through enzyme digestion, ligation and seamless cloning, the SmABE8e-03-Dual salvia miltiorrhiza monobasic editing system was recombined into the backbone vector pCambia1300 (Addgene global plasmid sharing platform) to obtain the SmABE8e-03-Dual salvia miltiorrhiza monobasic editing system. The structure of the SmABE8e-03-Dual salvia miltiorrhiza monobasic editing system is shown in Figure 10 .

[0152] The sgRNA1 targeting SmKSL2 and SmHMGR1 genes was selected from the sgRNA1 targeting SmMYB1, SmPAL, SmKSL2, SmHMGR1 and SmCPS2 genes designed in Example 1, and the method of Example 1 for transforming salvia miltiorrhiza plants with agrobacterium was used for verification. The results are shown in Table 6, and then the editing efficiency of the salvia miltiorrhiza monobasic editing system SmABE8e-03-Dual targeting sgRNA of SmKSL2, SmHMGR1 and SmKSL2+SmHMGR1 genes was calculated, and the results are shown in Figure 11 .

[0153] Table 6: Results of the salvia miltiorrhiza monobasic editing system SmABE8e-03-Dual on the salvia miltiorrhiza plant

[0154]

[0155] According to Table 6 and Figure 11 , it can be seen that the salvia miltiorrhiza monobasic editing system SmABE8e-03-Dual was used to edit the salvia miltiorrhiza plant to obtain 177 hygromycin positive salvia miltiorrhiza T0 plants. Further analysis showed that the editing efficiency of the sgRNA1 targeting SmKSL2 and SmHMGR1 genes was lower than that of the single target, which was 19.2% and 3.4%, respectively, but we obtained 6 plants that simultaneously edited the sgRNA1 targeting SmKSL2 and SmHMGR1 genes, and the simultaneous editing efficiency was 3.4%, indicating that the salvia miltiorrhiza monobasic editing system SmABE8e-03 had the feasibility of multiple target editing.

[0156] Example 4: Construction of an AKBE editing system suitable for salvia miltiorrhiza

[0157] It has been shown that fusing mutant human n-methyl purine DNA glycosylase (mMPG) to the C-terminus of ABE can remove hypoxanthine (Hx) after the deamination of adenine to produce inosine (I), resulting in a purine / apyrimidine (AP) site, which leads to base substitution during DNA repair, thereby generating A-T / C editing. In addition, by co-delivering translesion DNA polymerase η (TLS Polη) with a preference for incorporating the opposite of A at AP sites, A-to-T editing results can be improved. The present application also provides a SmAKBE editing system suitable for Salvia miltiorrhiza. The nuclear localization sequence NLS-1 (SEQ ID NO. 19), TadA8e (V106W) (SEQ ID NO. 3), Linker-1 sequence (SEQ ID NO. 20), nCas9 (D10A) (SEQ ID NO. 4), nuclear localization sequence NLS-2 (SEQ ID NO. 21), Linker-2 sequence (SEQ ID NO. 22), N-methyl purine DNA glycosylase (SEQ ID NO. 5), nuclear localization sequence biNLS (SEQ ID NO. 23), Salvia miltiorrhiza TLS polymerase η (SEQ ID NO. 6), and hygromycin phosphotransferase II (SEQ ID NO. 7) are sequentially linked by Shengong Bioengineering (Shanghai) Co., Ltd. to obtain a SmAKBE fusion protein, and the overall sequence of the SmAKBE fusion protein is shown as SEQ ID NO. 2. Then, the composite promoter 35SEN, the SmRPS5A promoter, and the SmAKBE fusion protein are connected by enzyme digestion and seamless cloning, and are recombined into the backbone vector pCambia1300 (Addgene Global Plasmid Sharing Platform) to obtain a Salvia miltiorrhiza base editing system, named SmAKBE-03, and the structure thereof is shown as Figure 12 .

[0158] From the sgRNA1 targeting SmMYB1 and SmKSL2 genes selected from the sgRNA1 targeting the five genes of SmMYB1, SmPAL, SmKSL2, SmHMGR1, and SmCPS2 designed in Example 1, a Salvia miltiorrhiza base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes was constructed, and then the method of Example 1 for transforming Salvia miltiorrhiza plants with Agrobacterium was used for verification, and the results are shown in Table 7. Then, the editing efficiency of the sgRNA of the Salvia miltiorrhiza base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes was calculated, and the results are shown in Figure 13 . Figure 14

[0159] ​Table 7 Base editing results of Salvia miltiorrhiza plants by using the single base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes

[0160]

[0161] According to Table 7, Figure 13 and Figure 14 it can be seen that by using the base editing system SmAKBE-03 of Salvia miltiorrhiza, 39 hygromycin-positive T0 plants of Salvia miltiorrhiza targeting SmMYB1 gene were obtained, and 53 hygromycin-positive T0 plants of Salvia miltiorrhiza targeting SmKSL2 gene were obtained, among which 71.7% of the T0 plants targeting SmKSL2 gene had A-to-G editing, and A-to-Y editing products were also produced, among which A-to-T and A-to-C editing contained 7.5% and 3.8%, respectively, and the base conversion mainly occurred within A3-A11 (PAM position 21-23).

[0162] Example 5: Base editing effect test

[0163] SmKSL1 gene encodes a shell-like sylan synthase (SmKSL) that can cyclize copalyl pyrophosphate (CPP) into tanshinone diene, which is a key gene involved in tanshinone synthesis, and can also bind to various transcription factors to regulate the synthesis of other key compounds of Salvia miltiorrhiza. SmKSL2, as a homologous gene of SmKSL1, can competitively consume the precursor GGPP of CPP, leading to metabolic flow to non-tanshinone synthesis pathways. The purpose of the sgRNA targeting SmKSL2 gene in Example 1 is to introduce a base substitution at A9 of the SmKSL2 gene editing fragment, so that *252 (stop codon, TGA) is mutated to R (CGA), to destroy the normal protein structure of the gene and make it unable to function normally.

[0164] The Salvia miltiorrhiza plants were subjected to base editing by using the single base editing system SmAKBE-03 targeting SmKSL2 gene in Example 4, and the method referred to the method of Agrobacterium transformation of Salvia miltiorrhiza plants in Example 1, and wild-type Salvia miltiorrhiza plants were used as controls, and the editing results are shown in Figure 15 .

[0165] According to Figure 15 , #9 and #35 in the T0 generation editing lines had base substitution, so that *252 (stop codon, TGA) was mutated to R (CGA), destroying the normal protein structure of the gene.

[0166] Then the transcription level of SmKSL2 in #9 and #35 plants of the T0 generation editing lines was determined by qPCR, and the results are shown in Figure 16 .

[0167] According to Figure 16 It can be known that the expression levels of Salvia miltiorrhiza plants #9 and #35 edited by the Salvia miltiorrhiza single base editing system SmAKBE-03 are not significantly different from those of the wild type Salvia miltiorrhiza plants.

[0168] The contents of related metabolites of all the base edited Salvia miltiorrhiza plants and the wild type Salvia miltiorrhiza plants are detected by using ultra-high performance liquid chromatography-electrospray triple quadrupole mass spectrometry (UPLC-TQ-MS), and the results are shown in Figure 17 The phenotypes of the wild type Salvia miltiorrhiza plants and the T0 generation edited strain #1 are compared, and the results are shown in Figure 18 .

[0169] According to Figure 17 and Figure 18 It can be known that the contents of Tan I, Tan IIA and DFS A of the Salvia miltiorrhiza plant #9 edited by the Salvia miltiorrhiza single base editing system SmAKBE-03 are significantly improved, which are 1.4, 2.3 and 1.1 times of those of the wild type Salvia miltiorrhiza plants, respectively; the contents of Tan I, CPT and RA of the Salvia miltiorrhiza plant #9 are significantly improved, which are 1.6, 3.2 and 1.1 times of those of the wild type Salvia miltiorrhiza plants, respectively; compared with the wild type, the growth and development of the Salvia miltiorrhiza plant #9 do not have obvious deformities, and the metabolite contents of different edited plants have certain differences, which may be because there is a TGA (*254) of three bases next to the destroyed stop codon, resulting in that the structure of the SmKSL2 protein is not very strongly destroyed. Although the A-T / C efficiency of the Salvia miltiorrhiza single base editing system SmAKBE-03 is still relatively low, and A-Y editing cannot be achieved at some sites, the overall efficiency still needs to be further improved, but the wide editing window and the ability of A:T-to-T:A and A:T-to-C:G base conversion of the Salvia miltiorrhiza single base editing system SmAKBE-03 highlight its great potential in promoting the Salvia miltiorrhiza base editing technology.

[0170] It can be known from the above examples that the present application provides a high-efficiency Salvia miltiorrhiza single base editing system and its application. The present application successfully constructs the high-efficiency Salvia miltiorrhiza single base editing systems SmABE8e-03 and SmAKBE-03, wherein the Salvia miltiorrhiza single base editing system SmABE8e-03 can achieve an editing efficiency of 100.0% at most and can realize simultaneous editing of multiple sites; the Salvia miltiorrhiza single base editing system SmAKBE-03 expands the editing window of ABE to 3-11 sites and realizes A:T-to-T:A and A:T-to-C:G base conversion, so that we can realize different forms of base editing in Salvia miltiorrhiza.

[0171] The present application significantly improves the content of tanshinone and salvianolic acid by using the single base editing system SmABE8e-03 and SmAKBE-03 to edit the 5'UTR of SmMYB1 and the stop codon of SmKSL2 respectively, and does not affect the growth.

[0172] The above only describes the preferred embodiments of the present application, and it should be pointed out that those skilled in the art can make some improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A Salvia miltiorrhiza single base editing system, characterized in that, The Salvia miltiorrhiza single-base editing system is SmABE8e-03; The Salvia miltiorrhiza single-base editing system SmABE8e-03 comprises, in sequence, a 35SEN composite promoter, an sgRNA, a SmRPS5A promoter, a nucleotide sequence for compiling a SmABE8e fusion protein, a terminator NOS, a 2xS35 promoter, a hygromycin resistance gene HYG, and a polyadenylic acid polyA; The nucleotide sequence for compiling the SmABE8e fusion protein is shown as SEQ ID NO. 1; The nucleotide sequence of the 35SEN composite promoter is shown as SEQ ID NO. 8; The nucleotide sequence of the SmRPS5A promoter is shown as SEQ ID NO. 12; The sgRNA targets a Salvia miltiorrhiza SmMYB1 gene, a Salvia miltiorrhiza SmHMGR1 gene, or a Salvia miltiorrhiza SmKSL2 gene; The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmMYB1 gene is shown as SEQ ID NO. 13; The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmHMGR1 gene is shown as SEQ ID NO. 14; The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmKSL2 gene is shown as SEQ ID NO.

15.

2. Use of the Salvia miltiorrhiza single-base editing system of claim 1 in Salvia miltiorrhiza base editing.

3. Use of the Salvia miltiorrhiza single-base editing system of claim 1 in cultivating high-quality Salvia miltiorrhiza plants.

Citation Information

Patent Citations

  • Programmable adenine base editor and application thereof

    CN119630788A