Application of Maize Nuclear Transcription Factor NF-YA9 in Improving Plant Stress Resistance

Abstract

In response to the current problem of "insufficient heat-resistant corn germplasm resources and limited location and cloning of key genes", the present invention provides an application of corn nuclear transcription factor NF-YA9 in improving plant stress resistance, including high temperature stress, salt stress and cold stress, and the plants include corn, Arabidopsis, rice, etc. <h2 style=";text-align:left;direction:ltr">zmnf‑ya9 Mutant and overexpressing transgenic Arabidopsis lines were validated <h2 style=";text-align:left;direction:ltr"> ZmNF‑YA9 The function of regulating high temperature stress in maize was analyzed preliminarily. <h2 style=";text-align:left;direction:ltr"> ZmNF‑YA9 The molecular mechanism of regulating high temperature stress in corn provides genetic resources and theoretical basis for the creation of new germplasm of heat-resistant corn and the cultivation of new varieties. <h2 style=";text-align:left;direction:ltr"> ZmNF‑YA9 It also has the function of positively regulating salt stress and cold stress in corn.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering breeding of crops and relates to the application of corn nuclear transcription factor NF-YA9 in improving plant stress resistance. Background Art

[0002] As part of the ecological ecosystem, plants are inevitably affected by external environmental factors. To cope with various stresses, plants have evolved a complex array of response mechanisms, and transcription factors play a crucial role in plant stress responses. NF-Y is a transcription factor that has been extensively studied in recent years. NF-Y regulates processes throughout plant development, such as hypocotyl length, flowering, and fruit ripening. It plays a particularly important role in stress regulation. In plants, NF-Y typically functions as a heterotrimer (NF-YA-YB-YC) (Calvenzani et al., 2012). All three NF-Y subunits share a highly conserved domain that plays a role in DNA interaction (Gusmaroli et al., 2001).

[0003] Whether as part of a trimer or as individual subunits, NF-YA members play an essential role in regulating plant growth, development, and stress tolerance. The conserved domain of the NF-YA subunit consists of 53 amino acids and contains two α-helices: a DNA-binding domain at the N-terminus and a subunit-interaction domain at the C-terminus (Coustry et al., 1996). The conserved α-helix at the N-terminus specifically recognizes the CCAAT box of downstream genes, while the α-helix at the C-terminus is responsible for binding to the NF-YB / C dimer (Hackenberg et al., 2012).

[0004] Arabidopsis NF-YA regulates embryonic development and seed germination. It also plays a role in fruit ripening and plant-microbe symbiosis. NF-YA is also involved in plant responses to various abiotic stresses, including drought, salt, and heat.

[0005] NF-YA5 plays an important role in controlling stomatal aperture and drought response in plants. miR169a Down-regulation of NF-YA5 expression significantly increased the expression level of NF-YA5, thereby improving plant drought resistance (Li et al., 2008); over-expression of soybean in Arabidopsis GmNF-YA3 It can reduce leaf water loss and enhance the plant's resistance to drought (Ni et al., 2013). ZmNF-YA3 By interacting with three downstream genes ( ZmMYC4、ZmbHLH92 and ZmFAMA ) promoter region, which can significantly improve the drought and high temperature resistance of maize (Su et al., 2018); ZmNF- YA1 / 7 It can interact with ZmNF-YB16-ZmNF-YC17 to promote maize root development and improve plant drought tolerance (Yang et al., 2022); rice OsNF-YA7 Positively regulates the plant's response to drought stress, and this regulatory pathway is independent of ABA (Lee et al., 2015).

[0006] Overexpression AtNF-YA1 It can enhance the tolerance of Arabidopsis seedlings to high salt stress and negatively regulate seed germination and post-germination growth under stress (Li et al., 2013); overexpression of wheat TaNF-YA10 Arabidopsis plants also have a higher tolerance to high salt stress and negatively regulate stress-related genes AtRAB18 、 AtRD29B 、 AtABI5 、 AtCBF1 and AtCBF3 expression of maize (Ma et al., 2015). ZmNF-YA1 Can promote development-related genes under salt stress ZmbHLH116 、 ZmPOD64 、 ZmLOX5 and ZmMBF1c expression (Yang et al., 2022); soybean nuclear factor GmNF-YA plays an important role in soybean salt stress. GmNF-YA binds to the flowering regulatory factor GmFVE, reducing the interaction between GmFVE and GmHDA13 to weaken histone deacetylation. GmH3K9 acetylation leads to the expression of salt stress-induced genes (Lu et al., 2021); rice OsNF-YA2 ( OsHAP2E ) overexpression lines improved plant tolerance to salt and drought stress by increasing photosynthesis and tiller number (Alam et al., 2015).

[0007] Under heat stress, NF-YA2, NF-YB3, and NF-YC10 form a trimeric complex that synergizes with DREB2A in Arabidopsis protoplasts to activate the promoters of heat-stress-induced genes (Sato et al., 2014). Maize NF-YA1 enhances plant tolerance to heat by maintaining protein stability and promoting protein renaturation under high temperatures (Yang et al., 2024).

[0008] NF-YA regulates plant stress not only in response to external environmental stress but also in response to ER stress within the cell. NF-YB3 and NF-YC2 interact with bZIP28 and NF-YA4 during ER stress (Liu et al., 2010).

[0009] As the world's most important food crop, ensuring corn production is crucial for food security. In recent years, global climate change has led to frequent high temperatures, posing a threat to corn production. While some research has been conducted on heat tolerance in corn, the molecular mechanisms and genetic basis remain underdeveloped. Heat-tolerant corn germplasm resources are scarce, and key genes have been poorly mapped and cloned. Identifying heat-tolerant genes and understanding their molecular mechanisms is crucial for developing new heat-tolerant corn germplasm and breeding new varieties. Summary of the Invention

[0010] To address the above problems, the present invention provides an application of maize nuclear transcription factor NF-YA9 in improving plant stress resistance. In the early stage of the present invention, all members of the ZmNF-YA subfamily were subjected to phylogenetic tree analysis, conserved domain analysis, tissue expression pattern analysis, etc., and the expression pattern analysis of the members under simulated high temperature stress was also carried out. The results showed that in addition to the reported ZmNF-YA1 outside, ZmNF-YA9 The present invention is based on the maize NF-YA family members ZmNF-YA9 As the research object, corn zmnf-ya9 Mutant and overexpressing transgenic Arabidopsis lines were validated ZmNF-YA9 The function of regulating high temperature stress in maize was analyzed preliminarily. ZmNF-YA9 The molecular mechanism of regulating high temperature stress in corn provides genetic resources and theoretical basis for the creation of new germplasm of heat-resistant corn and the cultivation of new varieties. ZmNF-YA9 It also has the function of positively regulating salt stress and cold stress in corn.

[0011] Note: According to academic rules, genes involved in ZmNF-YA9 are in capital italics, i.e. ZmNF-YA9 , the mutants are in lowercase italics, i.e. zmnf-ya9 .

[0012] The first object of the present invention is to provide an application of maize nuclear transcription factor NF-YA9 in improving plant stress resistance, wherein the stress resistance includes high temperature stress, salt stress and cold stress. The cDNA sequence of the maize nuclear transcription factor NF-YA9 is shown in SEQ No. 1, and the amino acid sequence is shown in SEQ No. 2. The plants include maize, Arabidopsis thaliana, rice, etc.

[0013] The second object of the present invention is to provide an application method of maize nuclear transcription factor NF-YA9 to improve plant stress resistance, which is characterized in that the expression level of maize nuclear transcription factor NF-YA9 is increased by: using the cDNA in maize B73 leaf tissue as a template, ZmNF-YA9 The gene CDS sequence was amplified to obtain a PCR amplification product, which was then forward-linked to the overexpression vector pCAMBIA1300-UbiPro-Tnos (the 35S promoter was replaced with UbiPro on the commercial vector pCAMBIA1300 backbone), and then transformed into Escherichia coli competent DH5α. Finally, it was transformed into plants (such as Arabidopsis thaliana) using Agrobacterium-mediated method to improve the ZmNF-YA9 Gene expression, obtained ZmNF-YA9 Transgenic plants with enhanced gene expression. Compared to wild-type plants, overexpressing transgenic Arabidopsis lines showed enhanced resistance to oxidative stress (less wilting and significantly increased SOD and POD enzyme activities) and reduced H2O2 and O2 in Arabidopsis leaves. - Accumulation reduces the mortality of Arabidopsis leaf cells under high temperature stress. After high temperature stress, the thousand-grain weight of Arabidopsis seeds is significantly higher than that of the wild type.

[0014] The technical effects of the present invention are:

[0015] 1. The present invention is based on the corn NF-YA family members ZmNF-YA9 As the research object, we used transgenic Arabidopsis thaliana and maize overexpression zmnf-ya9 Mutants, verified ZmNF-YA9 The function of regulating high temperature stress in maize was analyzed preliminarily. ZmNF-YA9 The molecular mechanism of regulating high temperature stress in corn provides genetic resources and theoretical basis for the creation of new heat-resistant corn germplasm and the breeding of new varieties.

[0016] 2. The present invention utilizes overexpression transgenic Arabidopsis thaliana strains and corn zmnf-ya9 Mutants, preliminary analysis ZmNF-YA9 The molecular mechanism regulating high temperature stress in maize has been experimentally demonstrated: compared with the wild type, transgenic Arabidopsis lines overexpressing α-glucan have enhanced antioxidant capacity (they have less wilting and significantly increased SOD and POD enzyme activities) and reduced H2O2 and O2 in Arabidopsis leaves. - Accumulation reduces the mortality of Arabidopsis leaf cells under high temperature stress. After high temperature stress, the 1000-grain weight of Arabidopsis seeds is significantly higher than that of wild type. zmnf-ya9 The mutant had reduced antioxidant stress levels (severe wilting and low SOD and POD enzyme activities) and increased leaf H2O2 and O2. - The above experiments have fully proved that ZmNF-YA9 It can positively regulate the plant's tolerance to high temperature stress.

[0017] 3. In addition, experiments have shown that ZmNF-YA9 It also has the function of positively regulating salt stress and cold stress in corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a phylogenetic analysis of maize NF-YA members;

[0019] Figure 2 Analysis of conserved domains of maize NF-YA members;

[0020] Figure 3 High temperature treatment of corn ZmNF-YA9 、 ZmNF-YA1 The relative expression level of

[0021] Figure 4 for ZmNF-YA9 The protein tertiary structure prediction of its homologous genes; Among them, A: ZmNF-YA9 Protein tertiary structure; B: OsNF-YA9 Protein tertiary structure; C: AtNF-YA7 Protein tertiary structure;

[0022] Figure 5 for ZmNF-YA9 Promoter analysis;

[0023] Figure 6 for ZmNF-YA9 Transcriptional activation activity analysis; BD-ZmYA9 is the pGBKT7-ZmNF-YA9 strain, and Empty BD-vector is an empty vector;

[0024] Figure 7 for ZmNF-YA9 Expression pattern analysis; where A: ZmNF-YA9 Tissue expression pattern; B: ZmNF-YA9 expression patterns in response to heat stress;

[0025] Figure 8 For identification of overexpression strains and detection of gene expression; A: ZmNF-YA9 Tissue expression pattern; B: ZmNF-YA9 expression patterns in response to heat stress;

[0026] Figure 9 for zmnf-ya9 Identification and expression analysis of mutants; A: zmnf-ya9 Mutant identification; B: ZmNF-YA9 Expression analysis;

[0027] Figure 10Phenotypic and physiological index determination of overexpressed Arabidopsis before and after high temperature treatment; A: Phenotypic of overexpressed Arabidopsis before and after high temperature treatment; B: SOD activity; C: POD activity;

[0028] Figure 11 Analysis of hydrogen peroxide (H2O2) content in leaves of overexpressing Arabidopsis before and after high temperature treatment; A: DAB staining of leaves of overexpressing Arabidopsis before and after high temperature treatment; B: Determination of hydrogen peroxide (H2O2) content in leaves of overexpressing Arabidopsis before and after high temperature treatment;

[0029] Figure 12 To overexpress oxygen anions (O2. - ) content analysis; A: NBT staining of overexpressed Arabidopsis leaves before and after high temperature treatment; B: Oxygen anions (O2. - ) content determination;

[0030] Figure 13 Trypan blue was used to stain Arabidopsis leaves before and after high temperature treatment, and the degree of leaf staining was observed to determine the degree of leaf cell damage;

[0031] Figure 14 The results of overexpression of Arabidopsis thaliana thousand-grain weight before and after high temperature treatment;

[0032] Figure 15 The phenotypic and physiological indexes of mutant maize before and after high temperature treatment are measured; A: phenotype of mutant maize before and after high temperature treatment; B: SOD activity; C: POD activity;

[0033] Figure 16 Analysis of hydrogen peroxide (H2O2) content in mutant corn leaves before and after high temperature treatment; A: DAB staining of mutant corn leaves before and after high temperature treatment; B: Hydrogen peroxide (H2O2) content in mutant corn leaves before and after high temperature treatment;

[0034] Figure 17 is the oxygen anion (O2. - ) content analysis; A: NBT staining of mutant corn leaves before and after high temperature treatment; B: oxygen anions (O2. - )content;

[0035] Figure 18 To use trypan blue to stain the mutant and wild-type maize leaves before and after high temperature treatment, and to observe the degree of leaf staining to analyze the degree of cell damage in the mutant maize;

[0036] Figure 19Relative expression levels of maize NF-YA members under salt stress treatment; the blue column represents the untreated control;

[0037] Figure 20 Relative expression levels of maize NF-YA members under cold stress treatment; the blue column represents the untreated control;

[0038] Figure 21 After cold stress treatment zmnf-ya9 Phenotypic comparison of mutant corn and W22 wild type, where the one on the left side of the flower pot is zmnf-ya9 mutants, and the W22 wild-type control on the right. DETAILED DESCRIPTION

[0039] Example 1: NF-YA family analysis

[0040] 1. Phylogenetic analysis of the NF-YA family genes

[0041] The amino acid sequences of 16 YA members of maize, 10 YA members of rice, and 10 YA members of Arabidopsis were subjected to phylogenetic analysis. The phylogenetic tree results showed that all 26 YA members of maize, rice, and Arabidopsis can be divided into three classes in phylogeny. Class I contains the most maize NF-YA members, and only ZmNF-YA11 and ZmNF-YA16 Classified as Class Ⅲ ( Figure 1 ).

[0042] 2. Analysis of conserved domains of maize NF-YA gene family members

[0043] The conserved domains of 16 NF-YA members of maize were analyzed using online websites MEME and NCBI. The results showed that except ZmNF-YA16 In addition, all maize NF-YA members have a conserved CBFB_NF-YA domain, among which maize NF-YA1 / 7 / 11 / 12 / 13 and NF-YA14 also have a CBF domain ( Figure 2 ).

[0044] 3. Expression analysis of maize NF-YA family members under high temperature stress

[0045] Fluorescence quantitative PCR was used to determine the expression level changes of maize NF-YA members under high temperature stress (40℃). Figure 3 As shown in Figure 2, with the extension of high temperature treatment time, ZmNF-YA9 The expression level of ZmNF-YA9 The expression of was significantly induced by high temperature, and it was speculated that it was involved in the positive response regulation of maize to high temperature stress. ZmNF-YA9 For the research object (from Figure 3 It can be seen that: ZmNF-YA9 The high temperature process continued to increase from 2h to 12h), and further analyzed its molecular mechanism of response to high temperature stress.

[0046] Example 2: Gene ZmNF-YA9 analyze

[0047] 1. ZmNF-YA9 Protein tertiary structure analysis

[0048] We used the online website SWISS-MODEL to analyze ZmNF-YA9 and its homologous genes in rice OsNF-YA9 , homologous genes in Arabidopsis AtNF-YA7 The tertiary structure of the protein shows two α-helical structures of NF-YA protein ( Figure 4 ), the tertiary structures of NF-YA member proteins in three different species are highly similar, further demonstrating the evolutionary conservation of NF-YA genes among different species.

[0049] 2. ZmNF-YA9 Promoter analysis

[0050] For further research ZmNF-YA9 The functions and regulation modes of ZmNF- YA9 The promoter sequence of the gene was analyzed. The results showed that in addition to the transcription-essential element (TATA-box) and a large number of light-responsive elements (G-box), the promoter sequence of this gene also has ABA-responsive element (ABRE), methyl jasmonate-responsive element (CGTCA-motif), auxin-responsive element (TGACG-motif) and gibberellin-responsive element (GARE-motif) and other plant hormone-related regulatory elements; hypoxia-specific inducible element (GC-motif) and antioxidant response element (ARE); drought-induced response element (MYB binding site involved in drought-inducibility, MBS) and other cis-acting elements ( Figure 5 ). The promoter region of a gene can not only regulate gene transcription, but also regulate gene expression under specific circumstances. ZmNF-YA9 Participates in the process of plant hormone regulation and response to adverse stress.

[0051] 3. ZmNF-YA9 Transcriptional activation activity analysis

[0052] To verify ZmNF-YA9 Whether a transcription factor has transcriptional activity ZmNF-YA9 The CDS region sequence was cloned into the vector pGBKT7 and transformed into the yeast Y2HGold strain. Figure 6 As shown, the pGBKT7-ZmNF-YA9 strain and the empty vector both grew normally on the SD-Trp-deficient plate, while on the SD-Trp-x-α-gal plate, the yeast transformed with the empty vector (at different dilution concentrations) grew slowly and could not turn blue. Only the pGBKT7-ZmNF-YA9 yeast (at different dilution concentrations) could grow normally and turn the substrate blue, which indicates that ZmNF-YA9 Has transcriptional activation activity.

[0053] 4. ZmNF-YA9 Expression pattern analysis

[0054] Using qRT-PCR method ZmNF-YA9 The expression patterns in different tissues of maize were identified, and the results showed that: ZmNF-YA9 There were significant differences in expression levels in seven tissues. The highest expression level was in the immature embryo 15 days after pollination, slightly higher in the endosperm 15 days after pollination than in the root, and almost no expression in the stem, leaf, tassel, and 5-day-old kernel ( Figure 7 A in the figure). Under normal conditions ZmNF-YA9 It is hardly expressed in leaves, but when subjected to high temperature stress, ZmNF-YA9 The expression level in leaves at the seedling stage gradually increased, indicating that ZmNF-YA9 The expression of Figure 7 B in ).

[0055] Example 3: Overexpression strains, zmnf-ya9 Identification of mutants and expression analysis

[0056] 1. Identification of overexpression strains and detection of gene expression

[0057] Search the Maize GDB (https: / / www.maizegdb.org) database to obtain corn ZmNF-YA9 The CDS sequence of the Zm00001d041491 gene was amplified using high-fidelity DNA polymerase using cDNA from maize B73 leaf tissue as a template.

[0058] The specific primers are as follows:

[0059] Primer1: ttctgcagcccgggggatccATGACCTCTGTTGTTCAGAG (SEQ No. 4);

[0060] Primer2: catgagctcggtacccggTCATTCACGACTAGGCGCC (SEQ No. 5).

[0061] The amplification reaction system is as follows:

[0062] Table 1 PCR amplification system

[0063]

[0064] The PCR reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 65°C for 30 s, and extension at 68°C for 1 min (amplification efficiency was 2 kb / min), for a total of 35 cycles.

[0065] The PCR product was subjected to agarose gel electrophoresis, and the target band was recovered by cutting the gel. Note: We extracted mRNA from the primary roots, leaves at the 3-leaf stage, and grains 12 days after pollination of the B73 corn inbred line, respectively. After reverse transcription, cDNA was used for gene amplification. After sequencing, it was found that it was inconsistent with the reference sequence in the https: / / www.maizegdb.org database. After analysis, it was found that the variable splicing site of the transcript in the database was incorrect, and our amplification result had a clear variable splicing site recognition sequence TCGA, so our amplification result was a functionally correct version. Corn ZmNF-YA9 The cDNA sequence is shown in SEQ No. 1, the amino acid sequence is shown in SEQ No. 2, and the genomic DNA sequence is shown in SEQ No. 3.

[0066] The overexpression vector pCAMBIA1300-UbiPro-Tnos (made by replacing the 35S promoter with UbiPro on the commercial vector pCAMBIA1300 backbone) was digested with BamHI and SacI, and the vector fragment was recovered. The recovered fragment was ligated to the digested vector using homologous recombination. The homologous recombination ligation system is as follows:

[0067] Table 2 Homologous recombination ligation system

[0068]

[0069] Gently pipette to mix, centrifuge briefly, and place in a PCR instrument at 50°C for 15 min. After the reaction is completed, immediately place on ice.

[0070] The reaction system was added to 100 μL of freshly melted Escherichia coli DH5α, which was placed on ice for 30 min, then heat-shocked in a 42°C water bath for 45 s. After being placed on ice for 2 min, 700 μL of LB liquid medium without antibiotics was added and the culture was revived in a shaker at 37°C for 1 h. After recovery, the culture was centrifuged at 5000 rpm for 3 min, 700 μL of supernatant was discarded, and the remaining 100 μL of bacterial liquid was resuspended and evenly spread on an LB plate containing kanamycin resistance (50 ng / L) and incubated inverted at 37°C overnight. When the colonies grew to an appropriate size, single colonies were picked for PCR identification. The overexpressing transgenic lines were identified using a combination of primers at the 3' end of the Ubi promoter and the 5' end of the gene (F: CTTTTTGTTCGCTTGGTTGTGATGA; R: CAAAGGTAAGCCAGCCGGAT; the above primer sequences are SEQ No. 11 and SEQ No. 12, respectively). The total reaction volume was 10 μL: 5 μL of 2× Taq Master Mix, 0.2 μL of each primer, 1 μL of bacterial solution, and 3.6 μL of ddH2O.

[0071] The PCR reaction procedure was as follows: initial denaturation at 94°C for 1 min; denaturation at 98°C for 10 s, annealing at 65°C for 15 s, and extension at 68°C for 1 min (amplification efficiency of 2 kb / min), for 35 cycles; and a complete extension at 68°C for 5 min. After verification by agarose gel analysis, four positive colonies were selected for bacterial preservation and plasmid digestion. Once the fragments were confirmed to be correct, they were sent for sequencing.

[0072] The plasmid was extracted using a plasmid extraction kit from Guangzhou Meiji Biotechnology Co., Ltd. The target fragment was digested with SacⅠ and BamH Ⅰ at both ends of the target fragment for identification. The enzyme digestion system is as follows:

[0073] Table 3 Restriction enzyme digestion system

[0074]

[0075] Mix by pipetting, centrifuge briefly, and incubate at 37°C for 1 h.

[0076] The constructed plasmid was transformed into Agrobacterium competent cells: plasmid DNA was added to the melted Agrobacterium competent cells, which were placed in ice for 5 min, then frozen in liquid nitrogen for 5 min, placed in a 28°C water bath for 5 min, and then placed in an ice bath for 5 min; then 700 μL of YEP liquid medium without antibiotics was added, and the culture was shaken at 180 rpm at 28°C for 2-3 h; the culture was centrifuged at 5000 rpm for 3 min, and the remaining 100 μL of bacterial liquid was evenly spread on YEP solid medium containing kanamycin (50 ng / L) and rifampicin (50 ng / L), and cultured in an inverted manner at 28°C for 2-3 days.

[0077] Transform Arabidopsis thaliana using the floral dip method (Clough et al., 1998):

[0078] (1) Select wild-type Arabidopsis thaliana in full bloom with many branches, cut off the formed siliques, and water appropriately;

[0079] (2) Grow the Agrobacterium containing the recombinant vector to an OD of 600 = 0.8-1.0, centrifuge at 6000 rpm for 6 min to collect the cells, add the same volume of resuspension as the culture medium, and add 15 μL of surfactant Silwet-77 per 40 mL of resuspension;

[0080] (3) Immerse the inflorescence of Arabidopsis thaliana completely in the infection solution for 10 min. During this period, use a 1 mL pipette to absorb the bacterial solution and gently blow on the flower buds. After the bacterial solution on the surface of the plant is air-dried, use bamboo sticks to fix the stem to ensure upright growth; culture in the dark for 48 h, and then culture under normal light.

[0081] Five overexpression transgenic lines were obtained by PCR identification ( Figure 8 (A) RNA was extracted from the five overexpression lines and reverse transcribed to obtain cDNA, and real-time fluorescence quantitative qPCR was used to detect ZmNF-YA9 The expression levels in 5 strains were detected. ZmNF-YA9 The relative expression levels of the genes in strain OE1 were increased to varying degrees compared with the non-transgenic control. ZmNF-YA9 The relative expression level of α-glucose in α-glucose-containing glutathione increased by 8-fold and that in α-glucose-containing glutathione increased by 6-fold ( Figure 8 (B) OE1 and OE5, which had the highest expression levels of the target gene, were selected for subsequent phenotypic identification.

[0082] 2. zmnf-ya9 Identification of mutants and expression analysis

[0083] The maize materials used in this study were B73 inbred line and W22 inbred line seeds, which were stored in our laboratory. zmnf-ya9The mutant (Mutator) was purchased from ChinaMu Project (http: / / china.jass.ac.cn), Jiangsu Academy of Agricultural Sciences Maize Genetic Resources Center. The Mu insertion site is ZmNF-YA9 The sixth exon region of the gene is to ensure that the mutant phenotype is caused by ZmNF-YA9 We purchased two mutant events caused by a single gene mutation. PCR was performed on these two mutant lines. Two specific primers, F+R, were designed within 500 bp upstream and downstream of the Mu insertion site. Finally, homozygous identification was performed using the MuTIR-specific primer Mu67. Homozygous mutation identification should show no bands with the two specific primers F+R, but a band of approximately 500 bp with F+Mu67.

[0084] The primer sequences used are as follows (according to the sequence in Table 4, the primer sequences are shown in SEQ No. 6-10):

[0085] Table 4 Primer sequences for identification of homozygous mutants in maize

[0086]

[0087] DNA was extracted from corn kernels of two mutant lines using the alkaline boiling method for PCR identification. No 800 bp band was found in the amplification results of the specific primers MuF+MuR, while a 500 bp target band was found in the amplification results of MuF+Mu67, indicating that the mutants were homozygous ( Figure 9 The relative expression of ZmNF-YA9 was determined for the homozygous mutant and its wild type. ZmNF-YA9 There is almost no expression in homozygous mutants ( Figure 9 B in ).

[0088] Allelic test was performed on the hybridization of two homozygous mutant lines, and it was found that the phenotype of the hybrid F1 did not change, indicating that the phenotype of the mutant was caused by ZmNF-YA9 Caused by a single gene mutation.

[0089] Example 4: Analysis of heat resistance of overexpression strains

[0090] Arabidopsis pot culture: Mix nutrient soil and vermiculite in a mass ratio of 3:1, add appropriate amount of water and stir until the soil is moist, sterilize with high pressure steam, cool to room temperature, and then divide into 5 cm × 5 cm black square pots. Select Arabidopsis plants with uniform growth and transplant them into an artificial climate chamber for cultivation at 28°C daytime, 24°C nighttime, and a light intensity of 120 μmol·m - 2 ·s -1 .

[0091] Arabidopsis thaliana high temperature treatment: Wild-type Arabidopsis thaliana and two overexpression lines OE1 and OE5 were cultured under normal growth conditions until the flowering stage, and then transferred to a light incubator (35°C, 300 μmol·m -2 ·s -1 ) and were subjected to heat stress until the wild type showed obvious wilting phenotype.

[0092] 1. Under high temperature stress ZmNF-YA9 Overexpression of

[0093] Phenotypic changes were observed after high temperature treatment. The results showed that before high temperature treatment, the wild type and the two overexpression lines grew in the same direction. After high temperature treatment, the leaves of the wild type and the two overexpression lines showed varying degrees of yellowing and wilting, but the wild type showed a more severe degree of wilting ( Figure 10 A in ).

[0094] After the stress treatment, the leaves were taken for superoxide dismutase (SOD) and peroxidase (POD) activity determination. After high temperature treatment, the SOD and POD enzyme activities in the wild type and the two overexpression lines increased significantly. After treatment, the SOD and POD enzyme activities in the two overexpression lines were significantly higher than those in the wild type ( Figure 10 B and C), indicating overexpression ZmNF-YA9 Enhanced the plant's tolerance to oxidative stress under high temperature stress.

[0095] 2. Under high temperature stress ZmNF-YA9 Overexpression of α-H2O2 reduced H2O2 accumulation in Arabidopsis leaves

[0096] like Figure 11 As shown in Figure A, before high temperature treatment, the DAB staining levels of the leaves of the wild type and the two overexpression lines were basically the same, but after high temperature treatment, the staining level of the wild type leaves was significantly darker than that of the two overexpression lines, indicating that more H2O2 accumulated in the leaves of the wild type Arabidopsis. Further determination of the H2O2 content in the leaves revealed that the H2O2 content in the leaves of the wild type Arabidopsis increased significantly after high temperature treatment ( Figure 11 B), indicating overexpression in Arabidopsis ZmNF-YA9 It can reduce the accumulation of H2O2 in leaves under high temperature stress, reduce cell damage, and enhance the plant's resistance to high temperature.

[0097] 3. Under high temperature stress ZmNF-YA9 Overexpression of α-glucanin reduced O2 in Arabidopsis leaves. - accumulation

[0098] The leaves were dyed with NBT, and the results were as follows: Figure 12As shown in Figure A, before high temperature treatment, the staining levels of the leaves of the wild type and the two overexpressing plants were basically the same. However, after high temperature treatment, the staining level of the leaves of the wild type became significantly darker, indicating that more O2 accumulated in its leaf cells. - , the cells were more seriously damaged, and the O2. - It was found that the leaves of wild-type Arabidopsis accumulated the most O2 after high temperature treatment. - ( Figure 12 B), indicating overexpression in Arabidopsis ZmNF-YA9 It can reduce O2 under high temperature stress. - Accumulation in the leaves enhances the plant's resistance to high temperatures.

[0099] 4. Overexpression ZmNF-YA9 Reducing the mortality of Arabidopsis leaf cells under high temperature stress

[0100] Trypan blue was used to stain Arabidopsis leaves before and after high temperature treatment, and the degree of staining was observed to determine the degree of damage to the leaf cells. Figure 13 As shown in Figure 2, the staining degree of wild-type Arabidopsis leaves is significantly darker than that of the two overexpression lines, indicating that wild-type Arabidopsis leaves are more severely damaged after high temperature treatment and more cells die in the leaves. ZmNF-YA9 It improves the ability of Arabidopsis to resist high temperatures and reduces its leaf damage and cell death under high temperatures.

[0101] 5. Overexpression ZmNF-YA9 The 1000-grain weight of Arabidopsis thaliana strains after high temperature stress was significantly higher than that of wild type

[0102] To explore ZmNF-YA9 The effects of high temperature treatment on plant yield were investigated by measuring the 1000-grain weight of overexpressed and wild-type Arabidopsis before and after high temperature treatment. The results showed that under normal growth conditions, there was no significant difference in the 1000-grain weight between the wild-type and the two overexpression lines; however, after high temperature treatment, the 1000-grain weight of the wild-type Arabidopsis decreased significantly, and the 1000-grain weight of the two overexpression lines also decreased but was significantly higher than that of the wild-type Arabidopsis ( Figure 14 ).

[0103] Example 5: zmnf-ya9 Analysis of heat tolerance of mutants

[0104] right zmnf-ya9 Homozygous mutant maize and its wild type W22 maize were cultured under normal conditions until they had three leaves and one heart, then transferred to a light incubator and subjected to 40°C stress treatment. When the mutant plants showed severe wilting phenotype, samples were collected and various indicators were measured.

[0105] 1. zmnf-ya9 Mutants are more sensitive to high temperature stress

[0106] right zmnf-ya9 Homozygous mutant maize and its wild type W22 maize seedlings were subjected to 40 ℃ stress treatment to observe their phenotypic changes before and after high temperature treatment and to measure the activity levels of superoxide dismutase (SOD) and peroxidase (POD). zmnf-ya9 There was no significant phenotype difference between the mutant corn and the wild type. After 12 h of high temperature treatment, the leaves of both mutant and wild type plants turned yellow and lost their green color. The leaves of the mutant plants wilted, and the edges of the leaves turned yellow and dried up. After 24 h of treatment, the leaves of the mutant plants showed obvious wilting and drying up. Figure 15 A in the figure indicates that the mutant corn seedlings are more sensitive to high temperatures and have a weaker ability to resist high temperatures than the wild type. At the same time, the activities of superoxide dismutase (SOD) and peroxidase (POD) in the leaves of mutant corn and wild type corn before and after high temperature treatment were measured. The results showed that the activities of SOD and POD in the leaves of mutant corn seedlings after high temperature treatment were significantly lower than those of wild type ( Figure 15 B and C in Figure 3), which shows that compared with wild-type corn, mutant corn has lower ability to resist high temperature stress. ZmNF-YA9 Complete loss of function increased the sensitivity of maize seedlings to high temperature and reduced the tolerance of plants to high temperature stress, further demonstrating that ZmNF-YA9 It can positively regulate the plant's tolerance to high temperature stress.

[0107] 2. High temperature increases zmnf-ya9 H2O2 accumulation in mutant leaves

[0108] like Figure 16 As shown, there was no difference in the color depth of the mutant and wild-type corn leaves before high temperature treatment, but after treatment, the mutant corn leaves were significantly darker ( Figure 16 A in the figure), further determination of the H2O2 content in its leaves revealed that the H2O2 content in the mutant corn leaves increased significantly after high temperature treatment, and more H2O2 accumulated in the mutant corn leaves compared with the wild type ( Figure 16 B in the figure) indicates that high temperature causes greater damage to the mutant corn leaves.

[0109] 3. High temperature stress zmnf-ya9 O2 in mutant leaves .- Increased accumulation

[0110] The results of NBT staining analysis were as follows: Figure 17 As shown in A, there was no significant difference in the NBT staining depth between the mutant and wild-type corn leaves before high temperature treatment, but the staining degree of the mutant corn leaves was significantly darker after high temperature treatment. .-The content of O2 in wild-type and mutant corn leaves was found. .- The contents of O2 in the mutant corn leaves increased significantly. .- content( Figure 17 B in the figure) indicates that high temperature causes greater damage to the mutant corn leaves.

[0111] 4. High temperature increases zmnf-ya9 Cell death in mutant leaves

[0112] Trypan blue was used to stain the mutant and wild-type corn leaves before and after high temperature treatment. Figure 18 As shown in the figure, under normal growth conditions, there is no obvious difference in the coloration of trypan blue between the mutant and wild-type corn leaves. However, after high temperature treatment, the mutant corn leaves showed obvious blue coloration, which was darker than the wild-type, further explaining that ZmNF- YA9 Loss of gene function increases cell death in maize under high temperature.

[0113] Example 6: Gene ZmNF-YA9 Analysis of salt stress performance

[0114] Plant material: B73 inbred line seeds.

[0115] The seeds were surface sterilized by soaking in 75% ethanol for 2 minutes and then washed with distilled water. Germination was carried out at 28°C. After germination, the corn was transplanted into vermiculite pots and grown in an artificial climate chamber (day / night, 28°C / 24°C, light intensity 120 μmol·m -2 ·s -1 ) When the leaves grew to the 3-leaf stage, they were irrigated with 150 mM NaCl solution. After 7 days of treatment, RNA was extracted from the leaves and reverse transcribed into cDNA. Real-time fluorescence quantitative qPCR was used to detect the relative expression levels of maize NF-YA9 members after salt stress treatment.

[0116] The results are as follows Figure 19 As shown in the figure, compared with the untreated control, the expression level of YA9 was significantly upregulated after salt stress treatment, and the upregulation amplitude was higher than that of other YA members.

[0117] Example 7: Gene ZmNF-YA9 Analysis of cold stress performance

[0118] Plant materials: Zea mays W22 wild type and zmnf-ya9 mutant.

[0119] The seeds were surface sterilized by soaking in 75% ethanol for 2 minutes and then washed with distilled water. Germination was carried out at 28°C. After germination, the corn was transplanted into vermiculite pots and grown in an artificial climate chamber (day / night, 28°C / 24°C, light intensity 120 μmol·m -2·s -1 When the leaves reached the three-leaf stage, they were transferred to a light incubator at 10°C. After one week, they were returned to 25°C for three days and photographed. RNA was then extracted from the leaves and reverse-transcribed into cDNA. Real-time quantitative PCR was used to detect the relative expression levels of maize NF-YA9 members after cold stress.

[0120] The results are as follows Figure 20 As shown in Figure 3, the expression level of YA9 was significantly upregulated after cold stress treatment compared with the untreated control, and the upregulation amplitude was higher than that of other YA members. Figure 21 It can be seen that after cold stress treatment, Figure 21 Left side of the flowerpot zmnf-ya9 The mutant grew slowly and gradually wilted, further proving that ZmNF-YA9 It can positively regulate the plant's tolerance to cold stress.

Claims

1. Use of maize nuclear transcription factor NF-YA9 in improving plant stress resistance, wherein the stress resistance is high temperature stress and the plant is Arabidopsis thaliana; the cDNA sequence of the maize nuclear transcription factor NF-YA9 is shown in SEQ No. 1, and the amino acid sequence is shown in SEQ No.

2.

2. A method for using corn nuclear transcription factor NF-YA9 to improve plant stress resistance, characterized in that: The expression level of maize nuclear transcription factor NF-YA9 is increased, the stress resistance is high temperature stress, and the plant is Arabidopsis thaliana; the cDNA sequence of the maize nuclear transcription factor NF-YA9 is shown in SEQ No. 1, and the amino acid sequence is shown in SEQ No.

2.

3. The method for using the maize nuclear transcription factor NF-YA9 to improve plant stress resistance according to claim 2, characterized in that: Using the cDNA from maize B73 leaf tissue as a template, ZmNF-YA9 The gene CDS sequence was amplified to obtain a PCR amplification product, which was then forward-linked to the overexpression vector pCAMBIA1300-UbiPro-Tnos and then transformed into Escherichia coli competent DH5α. Finally, it was transformed into Arabidopsis thaliana using Agrobacterium-mediated method to improve the ZmNF-YA9 Gene expression, obtained ZmNF-YA9 Transgenic plants with enhanced gene expression.

4. The method for using the maize nuclear transcription factor NF-YA9 to improve plant stress resistance according to claim 3, characterized in that: ZmNF-YA9 Transgenic Arabidopsis with enhanced gene expression enhanced the antioxidant stress level of Arabidopsis and reduced H2O2 and O2 in Arabidopsis leaves. - The accumulation of β-actin can reduce the mortality of Arabidopsis leaf cells under high temperature stress, and the thousand-grain weight of Arabidopsis seeds is increased after high temperature stress.

5. The method for using the maize nuclear transcription factor NF-YA9 to improve plant stress resistance according to claim 4, characterized in that: The method enhances the antioxidant stress level of Arabidopsis thaliana, which is manifested in: reduced leaf wilting degree and increased SOD enzyme and POD enzyme activities.

Images