Dual-multiplex amplification system and kit for degrading 25 gene loci miniSTR (short tandem repeat) of sample

Abstract

The invention relates to the field of biological detection, in particular to a mini STR (short tandem repeat) double-multiplex amplification system and kit for degrading 25 gene loci of a sample. The invention provides a kit. The kit comprises 25 gene loci; the 25 gene loci comprise 23 autosomal STR gene loci, one sex gene locus and one Yindel gene locus. According to the kit provided by the invention, the primers are divided into a group A and a group B, and all gene loci are miniS TR gene loci on the basis of using current mainstream instruments and equipment. The two tubes of primers use the same experiment condition, and amplification and electrophoresis can be carried out at the same time. Compared with the existing miniSTR kit, the kit disclosed by the invention can be independently amplified and does not need to be combined with other autosomal STR kits for use, and the typing of 25 gene loci can be obtained through one-time detection. The effective detection rate of degraded samples is greatly improved, and technical support is provided for detection of difficult cases.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and particularly to a 25-locus miniSTR dual multiplex amplification system and kit for degrading samples. Background Art

[0002] Short tandem repeat (STR) sequences have become an important tool for forensic DNA typing. By using polymerase chain reaction (PCR) to perform multiplex amplification of STR loci, genotyping results can be obtained from a small amount of forensic samples. However, in actual forensic cases, the DNA in forensic samples or specimens often degrades. For example, when DNA is exposed to the external environment or in a high-temperature and humid space for a period of time, it will degrade due to bacteria, biochemical or oxidation processes. In addition, environmental pollutants may also be mixed with the on-site specimens. In such specimens, the signal loss of larger fragment STR products is usually observed, and this signal loss may be caused by the presence of specific PCR inhibitors in the specimens or the fragmentation of the DNA template into small fragments.

[0003] The presence of PCR inhibitors or DNA degradation usually results in allele loss or the loss of loci at some loci. Generally, genetic analyzers in current forensic laboratories can recognize 6 fluorescent dyes, among which 5 are used for locus arrangement and 1 is for the molecular weight internal standard. If the number of loci in the multiplex PCR reaction is increased, only the size of the amplicons can be increased among the 5 dyes. However, as the amplicons become larger, the problem of locus loss will further expand. Currently, multiplex STR detection kits for forensic DNA analysis on the market can produce amplicons with sizes ranging from 70 bp to 650 bp. When detecting degraded DNA samples, not all genotypes can often be detected. Moreover, since large fragment primers will compete with small fragment primers, the amplification efficiency of small fragment primers will also decrease, and only partial genotypes of small fragment STR loci can be detected. During actual testing, DNA testers sometimes try to increase the number of PCR cycles. However, the amplification of trace amounts of DNA is extremely vulnerable to random effects, which may lead to locus loss, allele loss, uneven peak heights / peak areas of heterozygotes, inconsistent stutter peak values, and an increased risk of laboratory contamination.

[0004] When the specimens are severely degraded and STR analysis cannot be normally performed, by designing primers near the STR repeat sequences to minimize the size of the PCR products as much as possible, an attempt is made to obtain information from the degraded DNA specimens. Binding the primers to the vicinity of the STR repeat sequences to improve the detection results and shorten the PCR products, this technique is called "miniSTR". Applied Biosystem launched MiniFiler TM PCR amplification kit, which is the first commercial kit for miniSTR, and can simultaneously amplify and detect 8 STR loci and the sex locus. Compared with Identifiler TM kit, the amplicons of the MiniFiler TM PCR amplification kit can be reduced by up to 201 bp. The sensitivity, anti-inhibition ability and the ability to detect degraded samples of the Mini Filer TM PCR amplification kit are all superior to those of Identifiler TM kit.

[0005] For the kits in the prior art, due to the influence of the capillary electrophoresis fluorescence channels, the number of loci of the miniSTR kit is relatively limited. Currently, the common commercial miniSTR kits are generally supplementary kits for the existing mainstream STR kits. For example, MiniFiler is a supplement to the Identifiler Plus kit, and FastDirect 13A is a supplementary kit for FastDirect34A. The limited number of loci restricts the wide use of the miniSTR kit. The present invention can solve this problem by increasing the number of loci on the basis of the existing mainstream six-color fluorescence multiplex amplification system. There are also some cases where the miniSTR primers are too close to the repetitive sequences. If base mutations, deletions or insertions occur in the primer binding region, it will lead to inaccurate detection of DNA typing. Summary of the Invention

[0006] In view of this, the present invention provides a 25-locus miniSTR dual multiplex amplification system and kit for degraded samples. The kit (Mini25A) provided by the present invention divides the primers into two groups, A and B. On the basis of using the existing mainstream instrument and equipment, all loci are miniSTR loci. The two tubes of primers use the same experimental conditions and can be amplified and electrophoresed simultaneously. Compared with the existing miniSTR kits, the kit of the present invention can be independently amplified without the need to be used in combination with other autosomal STR kits. By one detection, the typing of 25 loci can be obtained. The effective detection rate of degraded samples is greatly improved, providing technical support for the detection of difficult cases.

[0007] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0008] The present invention provides a kit, including: 25 loci; the 25 loci include: 23 autosomal STR loci, 1 sex locus and 1 Yindel locus.

[0009] In some embodiments of the present invention, in the above-mentioned kit, the autosomal STR loci include: D18S51, CSF1PO, D3S1358, D16S539, D7S820, TPOX, D13S317, D5S818, D8S1179, FGA, TH01, vWA, D21S11, D22S1045, D1S1656, Penta D, D6S1043, Penta E, D2S441, D2S1338, D10S1248, D19S433, and D12S391.

[0010] In some embodiments of the present invention, in the above-mentioned kit, the sex locus includes: AMEL.

[0011] In some embodiments of the present invention, in the above-mentioned kit, the Yindel locus includes: rs199815934.

[0012] In some embodiments of the present invention, in the above-mentioned kit, the locus carries a fluorescence detection label; the fluorescence detection label includes: FAM, HEX, LTAM, LROX, LPUR, and NH650A.

[0013] In some embodiments of the present invention, the above-mentioned kit includes: a primer set for amplifying the 25 loci; the primer set includes: Group A and Group B; Group A includes: Groups 1 to 5; Group B includes: Groups 6 to 10;

[0014] Group 1 includes: a primer set for amplifying AMEL, a primer set for amplifying D18S51, and a primer set for amplifying CSF1PO;

[0015] Group 2 includes: a primer set for amplifying D3S1358, a primer set for amplifying D16S539, and a primer set for amplifying D7S820;

[0016] Group 3 includes: a primer set for amplifying TPOX, a primer set for amplifying D13S317, and a primer set for amplifying D5S818;

[0017] Group 4 includes: a primer set for amplifying D8S1179 and a primer set for amplifying FGA;

[0018] Group 5 includes: a primer set for amplifying TH01, a primer set for amplifying vWA, and a primer set for amplifying D21S11;

[0019] Group 6 includes: a primer set for amplifying D22S1045, a primer set for amplifying D1S1656, and a primer set for amplifying D21S11;

[0020] The group 7 includes: a primer set for amplifying PentaD and a primer set for amplifying D6S1043;

[0021] The group 8 includes: a primer set for amplifying AMEL, a primer set for amplifying rs199815934, and a primer set for amplifying Penta E;

[0022] The group 9 includes: a primer set for amplifying D2S441, a primer set for amplifying D2S1338, and a primer set for amplifying CSF1PO;

[0023] The group 10 includes: a primer set for amplifying D10S1248, a primer set for amplifying D19S433, and a primer set for amplifying D12S391;

[0024] The group 1 and the group 6 carry FAM; the group 2 and the group 7 carry HEX; the group 3 and the group 8 carry LTAM; the group 4 and the group 9 carry LROX; the group 5 and the group 10 carry LPUR.

[0025] In some embodiments of the present invention, in the above kit, the primer set for amplifying AMEL has:

[0026] (1) Nucleic acids having the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 4;

[0027] (2) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (1);

[0028] (3) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (1) or (2);

[0029] (4) Nucleic acids that are partially complementary or completely complementary to any one of (1), (2) or (3); and / or

[0030] The primer set for amplifying D18S51 has:

[0031] (5) Nucleic acids having the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6;

[0032] (6) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (5);

[0033] (7) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (5) or (6);

[0034] (8) Nucleic acids that are partially complementary or completely complementary to any one of (5), (6) or (7); and / or

[0035] The primer set for amplifying CSF1PO has:

[0036] (9) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:7 to SEQ ID NO:10;

[0037] (10) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (9);

[0038] (11) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (9) or (10);

[0039] (12) Nucleic acids that are partially complementary or completely complementary to any one of (9), (10) or (11); and / or

[0040] The primer set for amplifying D3S1358 has:

[0041] (13) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:11 and SEQ ID NO:12;

[0042] (14) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (13);

[0043] (15) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (13) or (14);

[0044] (16) Nucleic acids that are partially complementary or completely complementary to any one of (13), (14) or (15); and / or

[0045] The primer set for amplifying D16S539 has:

[0046] (17) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:13 and SEQ ID NO:14;

[0047] (18) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (17);

[0048] (19) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (17) or (18);

[0049] (20) Nucleic acids that are partially complementary or completely complementary to any one of (17), (18) or (19); and / or

[0050] The primer set for amplifying D7S820 has:

[0051] (21) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:15 and SEQ ID NO:16;

[0052] (22) A nucleic acid with one or more nucleotides substituted, deleted or added in the fragment described in (21);

[0053] (23) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (21) or (22);

[0054] (24) A nucleic acid partially or completely complementary to any one of (21), (22) or (23); and / or

[0055] The primer set for amplifying TPOX has:

[0056] (25) A nucleic acid with the nucleotide sequences shown in SEQ ID NO:17 and SEQ ID NO:18;

[0057] (26) A nucleic acid with one or more nucleotides substituted, deleted or added in the fragment described in (25);

[0058] (27) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (25) or (26);

[0059] (28) A nucleic acid partially or completely complementary to any one of (25), (26) or (27); and / or

[0060] The primer set for amplifying D13S317 has:

[0061] (29) A nucleic acid with the nucleotide sequences shown in SEQ ID NO:19 and SEQ ID NO:20;

[0062] (30) A nucleic acid with one or more nucleotides substituted, deleted or added in the fragment described in (29);

[0063] (31) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (29) or (30);

[0064] (32) A nucleic acid partially or completely complementary to any one of (29), (30) or (31); and / or

[0065] The primer set for amplifying D5S818 has:

[0066] (33) A nucleic acid with the nucleotide sequences shown in SEQ ID NO:21 and SEQ ID NO:22;

[0067] (34) A nucleic acid with one or more nucleotides substituted, deleted or added in the fragment described in (33);

[0068] (35) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (33) or (34);

[0069] (36) A nucleic acid that is partially or fully complementary to any one of (33), (34), or (35); and / or

[0070] The primer set for amplifying D8S1179 has:

[0071] (37) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:23 and SEQ ID NO:24;

[0072] (38) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (37);

[0073] (39) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (37) or (38);

[0074] (40) A nucleic acid that is partially or fully complementary to any one of (37), (38), or (39); and / or

[0075] The primer set for amplifying FGA has:

[0076] (41) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:25 and SEQ ID NO:26;

[0077] (42) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (41);

[0078] (43) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (41) or (42);

[0079] (44) A nucleic acid that is partially or fully complementary to any one of (41), (42), or (43); and / or

[0080] The primer set for amplifying TH01 has:

[0081] (45) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:27 and SEQ ID NO:28;

[0082] (46) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (45);

[0083] (47) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (45) or (46);

[0084] (48) A nucleic acid that is partially or fully complementary to any one of (45), (46), or (47); and / or

[0085] The primer set for amplifying vWA has:

[0086] (49) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:29 and SEQ ID NO:30;

[0087] (50) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (49);

[0088] (51) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (49) or (50);

[0089] (52) A nucleic acid that is partially or fully complementary to any one of (49), (50), or (51); and / or

[0090] The primer set for amplifying D21S11 has:

[0091] (53) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:31 to SEQ ID NO:34;

[0092] (54) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (53);

[0093] (55) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (53) or (54);

[0094] (56) A nucleic acid that is partially or fully complementary to any one of (53), (54), or (55); and / or

[0095] The primer set for amplifying D22S1045 has:

[0096] (57) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:35 and SEQ ID NO:36;

[0097] (58) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (57);

[0098] (59) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (57) or (58);

[0099] (60) A nucleic acid that is partially or fully complementary to any one of (57), (58), or (59); and / or

[0100] The primer set for amplifying D1S1656 has:

[0101] (61) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:37 and SEQ ID NO:38;

[0102] (62) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (61);

[0103] (63) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (61) or (62);

[0104] (64) Nucleic acids that are partially or fully complementary to any one of (61), (62) or (63); and / or

[0105] The primer set for amplifying PentaD has:

[0106] (65) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:39 and SEQ ID NO:40;

[0107] (66) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (65);

[0108] (67) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (65) or (66);

[0109] (68) Nucleic acids that are partially or fully complementary to any one of (65), (66) or (67); and / or

[0110] The primer set for amplifying D6S1043 has:

[0111] (69) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:41 and SEQ ID NO:42;

[0112] (70) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (69);

[0113] (71) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (69) or (70);

[0114] (72) Nucleic acids that are partially or fully complementary to any one of (69), (70) or (71); and / or

[0115] The primer set for amplifying PentaE has:

[0116] (73) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:43 and SEQ ID NO:44;

[0117] (74) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (73);

[0118] (75) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (73) or (74);

[0119] (76) A nucleic acid that is partially or completely complementary to any one of (73), (74) or (75); and / or

[0120] The primer set for amplifying D2S441 has:

[0121] (77) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:45 and SEQ ID NO:46;

[0122] (78) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (77);

[0123] (79) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (77) or (78);

[0124] (80) A nucleic acid that is partially or completely complementary to any one of (77), (78) or (79); and / or

[0125] The primer set for amplifying D2S1338 has:

[0126] (81) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:47 and SEQ ID NO:48;

[0127] (82) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (81);

[0128] (83) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (81) or (82);

[0129] (84) A nucleic acid that is partially or completely complementary to any one of (81), (82) or (73); and / or

[0130] The primer set for amplifying D10S1248 has:

[0131] (85) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:49 and SEQ ID NO:50;

[0132] (86) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (85);

[0133] (87) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (85) or (86);

[0134] (88) A nucleic acid that is partially or fully complementary to any one of (85), (86), or (87); and / or

[0135] The primer set for amplifying D19S433 has:

[0136] (89) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:51 and SEQ ID NO:52;

[0137] (90) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (89);

[0138] (91) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (89) or (90);

[0139] (92) A nucleic acid that is partially or fully complementary to any one of (89), (90), or (91); and / or

[0140] The primer set for amplifying D12S391 has:

[0141] (93) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:53 and SEQ ID NO:54;

[0142] (94) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (93);

[0143] (95) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (93) or (94);

[0144] (96) A nucleic acid that is partially or fully complementary to any one of (93), (94), or (95); and / or

[0145] The primer set for amplifying rs199815934 has:

[0146] (97) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:55 and SEQ ID NO:56;

[0147] (98) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (97);

[0148] (99) A nucleotide sequence having at least 70% identity to the nucleotide sequence shown in (97) or (98);

[0149] (100) A nucleic acid that is partially or completely complementary to any one of (97), (98), or (99).

[0150] In some embodiments of the present invention, the above-mentioned kit further includes: an internal standard, a buffer, and an allele typing standard.

[0151] In some embodiments of the present invention, the internal standard in the above-mentioned kit includes: NS320; the internal standard carries NH650A; the molecular weight of the internal standard is: 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 314, 320.

[0152] In some embodiments of the present invention, for the above-mentioned kit, the buffer includes: PCR reaction premix (5×): deionized water, Tris-HCl, KCl, NH4Cl, MgCl2, dNTPs, Glycerol, BSA, Taq DNA Polymerase; Low TE (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0).

[0153] The present invention also provides the application of the above-mentioned kit in any of the following;

[0154] (I) Individual identification; and / or

[0155] (II) Paternity testing; and / or

[0156] (III) Detecting degraded forensic samples.

[0157] In some embodiments of the present invention, in the above-mentioned application, the reaction conditions for the detection include: initial denaturation at 95°C / 1 min; thermal cycling (95°C / 10 s, 58°C / 1 min) × 27 - 29 cycles; final extension at 60°C / 5 min; incubation at 4°C / Hold.

[0158] The beneficial effects of the present invention include:

[0159] (1) The kit (Mini25A) provided by the present invention divides the primers into two groups, A and B. Based on the use of current mainstream instrument equipment, all loci are miniSTR loci. The two tubes of primers use the same experimental conditions and can be amplified and electrophoresed simultaneously. Compared with existing miniSTR kits, the kit of the present invention can be independently amplified without the need to be used in combination with other autosomal STR kits. By one detection, the typing of 25 loci can be obtained. This greatly improves the effective detection rate of degraded samples and provides technical support for the detection of difficult cases.

[0160] (2) Before designing the primers, the company's "SNP Search and Marking Software for Human DNA Sequences" (abbreviation: SNPMarker; software copyright registration number: 2023SR0126058) is used to identify SNVs within 500 bp upstream and downstream of 25 loci. It is stipulated that there should be no SNV with a frequency greater than 0.1% within 5 bp at the 3' end during the primer design process. Such a design can effectively reduce the risk of allele dropout and genotyping errors, and avoid possible mutations, insertions, and deletions in the primer region. BRIEF DESCRIPTION OF THE DRAWINGS

[0161] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0162] Figure 1 Shows the locus position distribution map of the double multiplex amplification system; where: on the left is primer set A; on the right is primer set B;

[0163] Figure 2 Shows the amplification result of the D2S441 primer pair;

[0164] Figure 3 Shows the first amplification map of primer set B;

[0165] Figure 4 Shows the amplification results of primer sets B-1(a), B-2(b), and B-3(c);

[0166] Figure 5 Shows the amplification map of the modified primer set B;

[0167] Figure 6 Shows the different primer genotyping maps of sample 1; where: above shows: primer 1; below shows: primer 2;

[0168] Figure 7 Shows the different primer genotyping maps of sample 2; where: above shows: primer 1; below shows: primer 2;

[0169] Figure 8 Shows the different primer genotyping maps of sample 3; where: above shows: primer 1; below shows: primer 2;

[0170] Figure 9Show the detection spectra of the primer set A of the Mini25A kit and the primer set B of the Mini25A kit for the 9948 standard DNA; among them: the loci in A are in sequence: AMEL, D18S51, CSF1PO; the loci in B are in sequence: D3S1358, D16S539, D7S820; the loci in C are in sequence: TPOX, D13S317, D5S818; the loci in D are in sequence: D8S1179, FGA; the loci in E are in sequence: TH01, vWA, D21S11; the loci in F are in sequence: D22S1045, D1S1656, D21S11; the loci in G are in sequence: Penta D, D16S1043; the loci in H are in sequence: AMEL, Yindel, Penta E; the loci in I are in sequence: D2S411, D2S1338, CSF1PO; the loci in J are in sequence: D10S1248, D19S433, D12S391;

[0171] Figure 10 Show the sensitivity test results of the Mini25A kit; among them: on the left shows: primer set A, the total number of alleles is 24; on the right shows: primer set B, the total number of alleles is 24;

[0172] Figure 11 Show the anti-inhibition test results of the Mini25A kit;

[0173] Figure 12 Show VeriFiler TM Plus PCR amplification kit amplification detection spectra of actual degraded samples;

[0174] Figure 13 Show the detection spectra of actual degraded samples amplified by the miniSTR double multiplex amplification system; among them: shown below: primer set A; shown above: primer set B. Detailed implementation manners

[0175] The present invention discloses a 25-locus miniSTR double multiplex amplification system and kit for degraded samples.

[0176] It should be understood that the expression "one or more of..." individually includes each of the objects recited after the expression and various different combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0177] The terms "comprising", "having" or "including", including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unrecited elements or steps, unless specifically stated otherwise or understood from the context otherwise.

[0178] It should be understood that as long as the present invention is still operable, the order of steps or the order of performing certain actions is not important. In addition, two or more steps or actions can be carried out simultaneously.

[0179] The use of any and all examples or exemplary language herein, such as "for example" or "including", is merely intended to better illustrate the present invention and does not limit the scope of the present invention unless a claim is made. No language in this specification should be construed as indicating that any unclaimed element is essential for the practice of the present invention.

[0180] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant values in the specific embodiments have been presented as precisely as possible herein. However, any numerical value inherently and inevitably contains standard deviations caused by individual test methods. Therefore, unless otherwise clearly stated, it should be understood that all ranges, quantities, numerical values and percentages used in this disclosure are modified by "about". Herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific numerical value or range.

[0181] The kit involved in the present invention adopts six-color fluorescence labeling technology and can simultaneously amplify and detect 25 miniSTR loci of human (hereinafter referred to as Mini25A kit). The fragment amplification range of all loci is 62-274bp, including: 23 autosomal STR loci, the sex locus AMEL (Amelogenin) and a Yindel (rs199815934). It is divided into two groups, A and B, with 14 loci in each group. AMEL, D21S11 and CSF1PO are duplicate loci, which are used to verify whether they are the same sample.

[0182] The Mini25A kit can be independently amplified and does not need to be used in combination with other autosomal STR kits to obtain the required locus typing. Primer set A includes all 13 CODIS loci and can be used alone for a tentative test.

[0183] The primer set A dyes and loci are as follows: blue - FAM: AMEL, D18S51, CSF1PO; green - HEX: D3S1358, D16S539, D7S820; yellow - LTAM: TPOX, D13S317, D5S818; red - LROX: D8S1179, FGA; purple - LPUR: TH01, vWA, D21S11.

[0184] The primer set B dyes and loci are as follows: blue - FAM: D22S1045, D1S1656, D21S11; green - HEX: PentaD, D6S1043; yellow - LTAM: AMEL, Yindel, Penta E; red - LROX: D2S441, D2S1338, CSF1PO; purple - LPUR: D10S1248, D19S433, D12S391.

[0185] When detecting, the molecular weight internal standard NS320 is used, with an orange color, labeled by NH650A, and it contains a total of 15 fragments with molecular weight sizes of 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 314, 320 respectively.

[0186] The primer sequences involved in the present invention are shown in Table 1:

[0187] Table 1 Primer sequence table of Mini25A kit

[0188]

[0189]

[0190]

[0191] The alleles in the allelic typing standards of each locus and the typing of the positive control (male 9948 standard DNA) are shown in Table 2:

[0192] Table 2 Locus information table of Mini25A kit

[0193]

[0194]

[0195] The Mini25A amplification reagent includes:

[0196] 1) PCR Reaction Premix (5×): Deionized water, 20 mM Tris-HCl, 50 mM KCl, 30 mM NH4Cl, 2.5 mM MgCl2, 0.3 mM dNTPs, 3.2% Glycerol, 0.1 mg / ml BSA, 67 units / ml Taq DNA Polymerase.

[0197] 2) Low TE (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0).

[0198] 3) Primer Set Mixing Solution (10×).

[0199] The PCR amplification reaction conditions of the Mini25A kit are shown in Table 3:

[0200] Table 3 PCR Amplification Program of Mini25A Kit

[0201] Initial Denaturation Thermal Cycling Final Extension Incubation 95°C / 1 min (95°C / 10 s, 58°C / 1 min) × 27 - 29 cycles 60°C / 5 min 4°C / Hold

[0202] In Examples 1 to 6 of the present invention, the raw materials and reagents used can be purchased from the market.

[0203] The present invention will be further described below in conjunction with examples:

[0204] Example 1 Cross-Reaction and Solution of Mini25A Primers

[0205] MiniSTR generally requires its amplicons to be as small as possible. In this way, the region where primers can be designed is greatly restricted, which easily leads to some cross non-specific reactions between different primers. To solve these non-specificities, it poses a great challenge to primer design. In this example, experiments were designed to find cross-reacting primers and optimize them to eliminate non-specificity.

[0206] Primer D2S441-F: TAAATTGGAGCTAAGTGGCTG and D2S441-R: GAACTGTGGCTCATCTATGAAA were designed for the first time and made into a primer pair of 10 μM. The 9948 standard DNA was amplified using this primer pair, and the results are shown in Figure 2 . As can be seen from the figure, this primer pair can be amplified normally.

[0207] The first primer set B was prepared using this D2S441 primer pair. After making a multiplex amplification system, a non-specific peak appeared at allele 14 of D2S441 ( Figure 3 circled).

[0208] Three sets of primers were prepared: B-1, lacking the fluorescent primer for D2S441; B-2, lacking the fluorescent primer for D2S1338; B-3, lacking the fluorescent primer for CSF1PO. The three sets of primers were used to amplify the 9948 standard DNA. Figure 4 As can be seen, there are no non-specific peaks in primer set B-1, while non-specific peaks are present in both primer sets B-2 and B-3. Therefore, the fluorescent primer causing the non-specific peak is the fluorescent primer for D2S441, i.e., D2S441-F.

[0209] The primers for D2S441 were modified: B-D2S441-F: CTGTGGCTCATCTATGAAAACT; B-D2S441-R: AGCTAAGTGGCTGTGGTGTTATG. After modification, primer set B was prepared and used to amplify the 9948 standard DNA. From Figure 5 it can be seen that there are no non-specific peaks.

[0210] Example 2 Influence of SNV-containing primers on the detection map of the D8S1179 locus

[0211] Due to the limitation of the fragment size of miniSTR, the primer design needs to be close to the repeat sequence, and the position of primer design is also restricted. If there are gene mutations in the primer binding region, it will also affect the detection results of STR.

[0212] Two sets of primers for the locus D8S1179 were designed for comparative testing. The unlabeled primer sequences of the two sets of primers are the same, and the fluorescently labeled primer sequences are different. The fluorescently labeled primer sequences are: Primer 1, TTCATGTGTACATTCGTATCTATCTG; Primer 2, TATTTCATGTGTACATTCGTATCTATCT. As shown in the NCBI database, there is a SNV named rs13265375 at the 124894872 base of chromosome 8 (GRCh38.p14), which is the last base at the 3' end of Primer 1. Its frequencies in different populations are shown in Table 4 below:

[0213] Table 4 Frequencies of rs13265375 in different populations

[0214] Population Sample Size RefAllele AltAllele Total 24854 G＝0.53179 A＝0.46821 European 18266 G＝0.52590 A＝0.47410 African 3520 G＝0.5790 A＝0.4210 African Others 118 G＝0.568 A＝0.432 African American 3402 G＝0.5794 A＝0.4206 Asian 158 G＝0.500 A＝0.500 East Asian 132 G＝0.485 A＝0.515 Other Asian 26 G＝0.58 A＝0.42 Latin American 1 168 G＝0.601 A＝0.399 Latin American 2 700 G＝0.587 A＝0.413 South Asian 116 G＝0.517 A＝0.483 Other 1926 G＝0.4787 A＝0.5213

[0215] Two sets of primers were tested using actual samples with known genotypes, and the test results are as follows:

[0216] Primer 1: The D8S1179 genotype of Sample 1 was 12,14, but only 12 was detected. There was a small unlabeled peak at 14, and the peak height ratio to the peak of genotype 12 was 0.0738. The D8S1179 genotype of Sample 2 was 13,15, and only allele 13 was detected while allele 15 was lost. The D8S1179 genotype of Sample 3 was 10,12, but neither genotype was detected.

[0217] Primer 2: The test results of the 3 samples were all consistent with the known genotypes.

[0218] The amplification profiles of Primer 1 and Primer 2 are as Figures 6 - 8 shown.

[0219] Example 3 Amplification Test of Mini25A Kit with 9948

[0220] Use 9948 standard DNA to perform the amplification test of Mini25A. The specific implementation method is as follows:

[0221] Use 0.1 ng / μL of 9948 standard DNA (Suzhou Xinhai Biotechnology) as the DNA template for amplification. The amplification system is 10 μL, including: 1 μL of primer set A / B mixed solution, 2 μL of PCR reaction premix, 2 μL of Low TE, and 5 μL of 0.1 ng / μL 9948 standard DNA (i.e., the template amount is 500 pg).

[0222] Use a 9700 type PCR amplifier (Applied Biosystems, USA) for amplification. The amplification conditions are: Stage 1: 95°C for 1 min, 1 cycle; Stage 2: 95°C for 10 s, 58°C for 1 min, 27 cycles; Stage 3: final extension, 60°C for 5 min, 1 cycle; terminate the reaction and store at 4°C.

[0223] After amplification, use a 3500xL genetic analyzer (Applied Biosystems, USA) for capillary electrophoresis and detection, and use GeneMapper ID-X software for data analysis. The detection results are shown in Figure 9 .

[0224] As can be seen from the figure, all miniSTR loci can normally amplify 9948 standard DNA.

[0225] Example 4 Sensitivity Test of Mini25A Kit

[0226] Verify the sensitivity, i.e., the detection limit, of this kit by testing 9948 standard DNA at different concentrations. The specific implementation method is as follows:

[0227] Using 9948 standard DNA at 0.1 ng / μL as the original template, dilute it with Low TE solution to prepare 9948 standard DNA at different concentrations, and test the sensitivity of this kit.

[0228] The amplification system is the same as in Example 3. Among them, the templates are 9948 standard DNA at 6 different concentrations, namely: 100 pg / μL, 50 pg / μL, 25 pg / μL, 12.5 pg / μL, 10 pg / μL, 6.25 pg / μL. After adding 5 μL, the amount of DNA in the system is: 500 pg, 250 pg, 125 pg, 62.5 pg, 50 pg, 31.25 pg. The amplification conditions are: the first stage: 95°C for 1 min, 1 cycle; the second stage: 95°C for 10 s, 58°C for 1 min, 29 cycles; the third stage: final extension, 60°C for 5 min, 1 cycle; terminate the reaction and store at 4°C. The instruments used for PCR amplification and electrophoresis detection are the same as in Example 3.

[0229] Use GeneMapper ID-X software for data analysis, and the sorted results are as Figure 11 shown. It can be seen from the figure that when the amount of DNA is 50 pg, all alleles can be detected, and the peak height increases with the increase of the amount of DNA. It is proved that the sensitivity of the Mini25A kit can reach 50 pg.

[0230] Example 5 Anti-inhibition test of Mini25A kit

[0231] Test 9948 standard DNA mixed with inhibitors at different concentrations, and test the anti-inhibition ability of the Mini25A kit to different inhibitors through the site detection rate of 9948 standard DNA. The specific implementation method is as follows:

[0232] Prepare 9948 standard DNA containing inhibitors, where the concentration of 9948 standard DNA is 50 pg / μL, and the inhibitors are: 500 mM heme; 1000 mM heme; 200 ng / μL humic acid; 300 ng / μL humic acid; 10 mM indigo; 20 mM indigo; 200 ng / μL collagen; 400 ng / μL collagen; 2 mM CaCl2; 3 mM CaCl2.

[0233] The amplification system is the same as in Example 3. After adding 5 μL of template, the amount of DNA in each system is 250 pg, and the final concentrations of the inhibitors are 250 mM heme; 500 mM heme; 100 ng / μL humic acid; 150 ng / μL humic acid; 5 mM indigo; 10 mM indigo; 100 ng / μL collagen; 200 ng / μL collagen; 1 mM CaCl2; 1.5 mM CaCl2. The amplification conditions are the same as in Example 4.

[0234] Using GeneMapper ID-X software for data analysis, the sorted results are as Figure 11 shown. It can be seen from the figure that when the final concentrations are 500 mM heme, 150 ng / μL humic acid, 10 mM indigo, 200 ng / μL collagen, and 1.5 mM CaCl2, all alleles of the Mini25A kit can be detected.

[0235] Example 6 Comparison of the Mini25A Kit and the VeriFiler TM Plus PCR Amplification Kit for Amplifying Actual Degraded Samples

[0236] Using actual degraded samples, test the detection ability of the Mini25A kit and the VeriFiler TM Plus PCR amplification kit for degraded samples. The specific implementation method is as follows:

[0237] Extract a tooth sample that is over 10 years old and use its extract for amplification. The Mini25A amplification system is 10 μL, including: 1 μL of primer set A / B mixed solution, 2 μL of PCR reaction premix, and 7 μL of DNA template. The amplification conditions of the Mini25A kit are the same as those in Example 4.

[0238] VeriFiler TM The amplification conditions of the Plus PCR amplification kit are as follows: Stage 1: 95°C for 1 min, 1 cycle; Stage 2: 96°C for 10 s, 62°C for 90 s, 2 cycles; Stage 3: 96°C for 10 s, 59°C for 90 s, 27 cycles; Stage 4: final extension, 60°C for 5 min, 1 cycle; terminate the reaction and store at 4°C. The instruments used for PCR amplification and electrophoresis detection are the same as those in Example 3.

[0239] The results after data analysis using GeneMapper ID-X software are as Figure 12 and Figure 13 shown. It can be seen from the figure that the VeriFiler TM Plus PCR amplification kit detected 16 loci, and the detection rate was 64%. Nine loci were not detected, namely: CSF1PO, D6S1043, D18S51, D5S818, D10S1248, D7S820, Penta E, D2S1338, and TPOX. The Mini25A kit detected all 25 loci, and the detection rate was 100%.

[0240] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Kit, characterized in that, Including: 25 loci; The 25 loci include: 23 autosomal STR loci, 1 sex locus, and 1 Y indel locus.

2. The kit according to claim 1, wherein The autosomal STR loci include: D18S51, CSF1PO, D3S1358, D16S539, D7S820, TPOX, D13S317, D5S818, D8S1179, FGA, TH01, vWA, D21S11, D22S1045, D1S1656, Penta D, D6S1043, Penta E, D2S441, D2S1338, D10S1248, D19S433, and D12S391.

3. The kit according to claim 1 or 2, characterized in that, The sex locus includes: AMEL.

4. The kit according to any one of claims 1 to 3, characterized in that The Y indel locus includes: rs199815934.

5. The kit according to any one of claims 1 to 4, characterized in that The loci carry fluorescence detection markers; The fluorescence detection markers include: FAM, HEX, LTAM, LROX, LPUR, and NH650A.

6. The kit according to claim 5, characterized in that, Including: A primer set for amplifying the 25 loci; The primer set includes: Group A and Group B; Group A includes: Groups 1 to 5; Group B includes: Groups 6 to 10; Group 1 includes: A primer set for amplifying AMEL, a primer set for amplifying D18S51, and a primer set for amplifying CSF1PO; Group 2 includes: A primer set for amplifying D3S1358, a primer set for amplifying D16S539, and a primer set for amplifying D7S820; Group 3 includes: A primer set for amplifying TPOX, a primer set for amplifying D13S317, and a primer set for amplifying D5S818; Group 4 includes: A primer set for amplifying D8S1179 and a primer set for amplifying FGA; Group 5 includes: A primer set for amplifying TH01, a primer set for amplifying vWA, and a primer set for amplifying D21S11; Group 6 includes: A primer set for amplifying D22S1045, a primer set for amplifying D1S1656, and a primer set for amplifying D21S11; Group 7 includes: A primer set for amplifying Penta D and a primer set for amplifying D6S1043; Group 8 includes: A primer set for amplifying AMEL, a primer set for amplifying rs199815934, and a primer set for amplifying Penta E; Group 9 includes: A primer set for amplifying D2S441, a primer set for amplifying D2S1338, and a primer set for amplifying CSF1PO; Group 10 includes: A primer set for amplifying D10S1248, a primer set for amplifying D19S433, and a primer set for amplifying D12S391; Group 1 and Group 6 carry FAM; Group 2 and Group 7 carry HEX; Group 3 and Group 8 carry LTAM; Group 4 and Group 9 carry LROX; Group 5 and Group 10 carry LPUR.

7. The kit according to claim 6, characterized in that, The primer set for amplifying AMEL has: (1), Nucleic acids with nucleotide sequences as shown in SEQ ID NO:1 to SEQ ID NO:4; (2) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (1); (3) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (1) or (2); (4) A nucleic acid that is partially or completely complementary to any one of (1), (2) or (3); and / or The primer set for amplifying D18S51 has: (5) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6; (6) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (5); (7) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (5) or (6); (8) A nucleic acid that is partially or completely complementary to any one of (5), (6) or (7); and / or The primer set for amplifying CSF1PO has: (9) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:7 to SEQ ID NO:10; (10) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (9); (11) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (9) or (10); (12) A nucleic acid that is partially or completely complementary to any one of (9), (10) or (11); and / or The primer set for amplifying D3S1358 has: (13) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:11 and SEQ ID NO:12; (14) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (13); (15) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (13) or (14); (16) A nucleic acid that is partially or completely complementary to any one of (13), (14) or (15); and / or The primer set for amplifying D16S539 has: (17) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:13 and SEQ ID NO:14; (18) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (17); (19) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (17) or (18); (20) A nucleic acid that is partially or completely complementary to any one of (17), (18) or (19); and / or The primer set for amplifying D7S820 has: (21) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:15 and SEQ ID NO:16; (22) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (21); (23) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (21) or (22); (24) A nucleic acid that is partially or completely complementary to any one of (21), (22) or (23); and / or The primer set for amplifying TPOX has: (25) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:17 and SEQ ID NO:18; (26) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (25); (27) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (25) or (26); (28) Nucleic acids that are partially or completely complementary to any one of (25), (26) or (27); and / or The primer set for amplifying D13S317 has: (29) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:19 and SEQ ID NO:20; (30) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (29); (31) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (29) or (30); (32) Nucleic acids that are partially or completely complementary to any one of (29), (30) or (31); and / or The primer set for amplifying D5S818 has: (33) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:21 and SEQ ID NO:22; (34) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (33); (35) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (33) or (34); (36) Nucleic acids that are partially or completely complementary to any one of (33), (34) or (35); and / or The primer set for amplifying D8S1179 has: (37) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:23 and SEQ ID NO:24; (38) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (37); (39) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (37) or (38); (40) Nucleic acids that are partially or completely complementary to any one of (37), (38) or (39); and / or The primer set for amplifying FGA has: (41) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:25 and SEQ ID NO:26; (42) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (41); (43) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (41) or (42); (44) Nucleic acids that are partially or completely complementary to any one of (41), (42) or (43); and / or The primer set for amplifying TH01 has: (45) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:27 and SEQ ID NO:28; (46) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragments described in (45); (47) Nucleotide sequences with at least 70% identity to the nucleotide sequences shown in (45) or (46); (48) A nucleic acid that is partially or completely complementary to any one of (45), (46), or (47); and / or The primer set for amplifying vWA has: (49) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:29 and SEQ ID NO:30; (50) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (49); (51) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (49) or (50); (52) A nucleic acid that is partially or completely complementary to any one of (49), (50), or (51); and / or The primer set for amplifying D21S11 has: (53) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:31 to SEQ ID NO:34; (54) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (53); (55) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (53) or (54); (56) A nucleic acid that is partially or completely complementary to any one of (53), (54), or (55); and / or The primer set for amplifying D22S1045 has: (57) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:35 and SEQ ID NO:36; (58) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (57); (59) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (57) or (58); (60) A nucleic acid that is partially or completely complementary to any one of (57), (58), or (59); and / or The primer set for amplifying D1S1656 has: (61) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:37 and SEQ ID NO:38; (62) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (61); (63) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (61) or (62); (64) A nucleic acid that is partially or completely complementary to any one of (61), (62), or (63); and / or The primer set for amplifying Penta D has: (65) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:39 and SEQ ID NO:40; (66) A nucleic acid in which one or more nucleotides are substituted, deleted, or added in the fragment described in (65); (67) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (65) or (66); (68) A nucleic acid that is partially or completely complementary to any one of (65), (66), or (67); and / or The primer set for amplifying D6S1043 has: (69) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:41 and SEQ ID NO:42; (70) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (69); (71) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (69) or (70); (72) A nucleic acid that is partially or completely complementary to any one of (69), (70) or (71); and / or The primer set for amplifying PentaE has: (73) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:43 and SEQ ID NO:44; (74) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (73); (75) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (73) or (74); (76) A nucleic acid that is partially or completely complementary to any one of (73), (74) or (75); and / or The primer set for amplifying D2S441 has: (77) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:45 and SEQ ID NO:46; (78) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (77); (79) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (77) or (78); (80) A nucleic acid that is partially or completely complementary to any one of (77), (78) or (79); and / or The primer set for amplifying D2S1338 has: (81) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:47 and SEQ ID NO:48; (82) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (81); (83) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (81) or (82); (84) A nucleic acid that is partially or completely complementary to any one of (81), (82) or (73); and / or The primer set for amplifying D10S1248 has: (85) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:49 and SEQ ID NO:50; (86) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (85); (87) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (85) or (86); (88) A nucleic acid that is partially or completely complementary to any one of (85), (86) or (87); and / or The primer set for amplifying D19S433 has: (89) A nucleic acid having the nucleotide sequences shown in SEQ ID NO:51 and SEQ ID NO:52; (90) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (89); (91) A nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (89) or (90); (92) A nucleic acid that is partially or completely complementary to any one of (89), (90) or (91); and / or The primer set for amplifying D12S391 has: (93) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:53 and SEQ ID NO:54; (94) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (93); (95) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (93) or (94); (96) Nucleic acids partially or completely complementary to any one of (93), (94) or (95); and / or The primer set for amplifying rs199815934 has: (97) Nucleic acids with nucleotide sequences as shown in SEQ ID NO:55 and SEQ ID NO:56; (98) Nucleic acids in which one or more nucleotides are substituted, deleted or added in the fragment described in (97); (99) Nucleotide sequences having at least 70% identity with the nucleotide sequences shown in (97) or (98); (100) Nucleic acids partially or completely complementary to any one of (97), (98) or (99).

8. The kit according to any one of claims 1 to 7, characterized in that It further includes: Internal standard, buffer and allele typing standard.

9. The application of the kit according to any one of claims 1 to 8 in any of the following items; (I) Individual identification; and / or (II) Paternity testing; and / or (III) Detection of degraded forensic samples.

Images