Endogenous promoter of koelreuteria paniculata or koelreuteria paniculata var. variegata and application thereof in regulating plant leaf color development
By regulating GLK gene expression through the endogenous promoter of Koelreuteria paniculata or Koelreuteria variegata, the problem of leaf color variation in Koelreuteria paniculata and Koelreuteria variegata was solved, thereby improving the photosynthetic efficiency and ornamental value of the plants.
Patent Information
- Application Number
- CN202510846272.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-06-24
AI Technical Summary
Existing technologies have failed to effectively resolve leaf color variations caused by differences in chloroplast development between Koelreuteria paniculata and Koelreuteria variegata, especially the golden-yellow leaf phenotype of Koelreuteria variegata, which affects photosynthetic efficiency.
Provide endogenous promoters of Koelreuteria paniculata or Koelreuteria variegata, especially the nucleotide sequence of the GLK gene, and regulate plant leaf color development by constructing gene expression cassettes and expression vectors, including the cultivation of plant varieties with high photosynthetic efficiency or ornamental plant varieties.
By regulating the expression level of the GLK gene, chloroplast development can be improved, thereby enhancing the photosynthetic efficiency and ornamental value of plants.
Smart Images

Figure CN120350011B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to endogenous promoters of plants and their applications, particularly to endogenous promoters of Koelreuteria paniculata or Koelreuteria variegata and their application in regulating leaf color development in plants, belonging to the field of endogenous promoters of Koelreuteria paniculata or Koelreuteria variegata and their applications. Background Technology
[0002] Leaf color variation is a common phenomenon in nature. Goldenrain tree (Koelreuteria paniculata), golden locust (Sophora japonica), and golden elm (Ulmus parvifolia) are all naturally occurring yellow-leaf mutants. These similar genetic variations may reveal common molecular and physiological regulatory mechanisms, which are of significant research value. Goldenrain tree (Koelreuteria paniculata) is an important native tree species, serving multiple functions including ecological protection, urban and rural beautification, and medicinal value. The mutant goldenrain tree (Koelreuteria paniculata) is a variant of a seedling of Goldenrain tree. Its physiological characteristics are similar to those of the common Goldenrain tree, but its leaves mutate to a golden yellow, giving it better landscaping characteristics.
[0003] Golden2-like ( GLK This gene belongs to the GARP subfamily of the MYB family and is widely found in higher plants. It has attracted considerable attention from researchers in recent years, primarily functioning in regulating chloroplast development. Furthermore, this gene is involved in various biological processes, including fruit quality regulation, plant responses to biotic and abiotic stresses, plant senescence regulation, and hormone signal transduction. Related molecular mechanism studies have shown that… GLK Transcription factors play a crucial role in chloroplast metabolism and development by regulating plasmid-nucleus retrograde signaling. Functional studies in model plants, such as rice, bryophytes, and Arabidopsis thaliana, have demonstrated that… GLK All gene mutants exhibited a yellowing leaf phenotype and a significant reduction in chlorophyll synthesis precursors (Waters et al., (2009)). GLK Transcription Factors Coordinate Expression of the Photosynthetic Apparatus in Arabidopsis. The Plant Cell. 21(4): 1109-28; Rossini et al., (2001). The Maize Golden2 Gene Defines a Novel Class of Transcriptional Regulators in Plants. The Plant Cell. 13(5): 1231-44). Studies in ornamental plants further confirm this. GLK Conservation of gene function: In chrysanthemum DmGLK2 low expression and DmGLK1The silencing of chloroplasts leads to inhibited chloroplast development and a significant decrease in chlorophyll content, resulting in a yellow-green leaf phenotype (Chang Qingshan, Zhang Lixia, Chen Yu, et al. (2013). Photosynthesis and thylakoid membrane spectra of yellow-green leaf mutants of chrysanthemum. Forestry Science. 49: 72-78); in birch BpGLK1 A 40 bp deletion mutation in the gene leads to a decrease in chlorophyll content and chloroplast developmental defects, ultimately resulting in a yellow-green leaf mutant (Gang et al., (2019)). GLK1 Transcription Factor Function Reveals New Insights in Chlorophyll Biosynthesis and Chloroplast Development. Journal of Experimental Botany. 70: 3125-3138. These studies provide insights for further analysis. GLK The molecular regulatory mechanisms of genes in chloroplast development provide important clues. Summary of the Invention
[0004] One of the objectives of this invention is to provide an endogenous promoter for Koelreuteria paniculata or Koelreuteria bipinnata.
[0005] A second objective of this invention is to provide a gene expression cassette containing the endogenous promoter of the aforementioned Koelreuteria paniculata or Koelreuteria bipinnata.
[0006] A third objective of this invention is to provide an expression vector or host cell containing the aforementioned gene expression cassette.
[0007] The fourth objective of this invention is to apply the endogenous promoters and driver genes of the aforementioned Koelreuteria paniculata or Koelreuteria variegata to the expression vectors or host cells containing the driver genes, thereby regulating the development of plant leaf color, including the cultivation of plant varieties with high photosynthetic efficiency or ornamental plant varieties.
[0008] To achieve the above objectives, the main technical solutions adopted by the present invention include:
[0009] One aspect of this invention is that it provides an endogenous promoter for Koelreuteria paniculata or Koelreuteria bipinnata.
[0010] In a preferred embodiment of the present invention, the nucleotide sequence of the endogenous promoter is selected from the nucleotide sequences shown in (a) or (b): (a) the nucleotide sequence shown in SEQ ID No. 1; (b) the nucleotide sequence shown in SEQ ID No. 2.
[0011] Another aspect of the present invention is to provide a gene expression cassette, which is composed of a promoter, a target gene, and a terminator operably linked together; wherein the promoter is an endogenous promoter of Koelreuteria paniculata or Koelreuteria bipinnata.
[0012] In a preferred embodiment of the present invention, the target gene is a reporter gene or a gene related to plant leaf color development; more preferably, the gene related to plant leaf color development is... GLK Gene; a particularly preferred embodiment of the present invention, wherein GLK The gene is that of Koelreuteria paniculata or Koelreuteria variegata. GLK Genes; wherein, the goldenrain tree or the variegated goldenrain tree... GLK The nucleotide sequence of the gene's CDS is shown in SEQ ID No. 4.
[0013] Another aspect of the present invention is to provide an expression vector or host cell containing an endogenous promoter of the said Koelreuteria paniculata or Koelreuteria bipinnata.
[0014] Another aspect of the present invention is to apply the endogenous promoter of the aforementioned Koelreuteria paniculata or Koelreuteria variegata, the gene expression cassette, the expression vector containing the aforementioned gene expression cassette, or the host cell to regulate the development of plant leaf color, including the cultivation of plant varieties with high photosynthetic efficiency or ornamental plant varieties.
[0015] For reference, the present invention provides a method for cultivating plant varieties with high photosynthetic efficiency, comprising: mixing a promoter with the nucleotide sequence shown in SEQ ID No. 2 with... GLK Gene manipulation is used to obtain a recombinant plant expression vector, which is then overexpressed in plants to screen for plant varieties with high photosynthetic efficiency.
[0016] For reference, the present invention provides a method for cultivating ornamental varieties of *Koelreuteria paniculata* or *Koelreuteria variegata*, comprising: reducing or inhibiting the driving activity of the promoter with the nucleotide sequence shown in SEQ ID No. 1 or the promoter with the nucleotide sequence shown in SEQ ID No. 2 in *Koelreuteria paniculata* or *Koelreuteria variegata*, thereby reducing the driving activity of the promoter with the nucleotide sequence shown in SEQ ID No. 2 in *Koelreuteria paniculata* or *Koelreuteria variegata*. GLK Gene expression levels are reduced.
[0017] This invention, after discovering the color differences in the leaves of *Koelreuteria paniculata* and *Koelreuteria variegata* and their highly stable phenotypic characteristics, further analyzed the chloroplast structures of both species and measured their photosynthetic characteristics. It was found that the net photosynthetic rate of *Koelreuteria variegata* was significantly lower than that of *Koelreuteria paniculata*, suggesting that this difference is due to the lower leaf color. GLK Gene promoter mutations led to a significant downregulation of gene expression, affecting chloroplast development and resulting in the mutant's golden-yellow leaf phenotype. Based on this, specific primers were designed using existing full-length transcriptome data of *Koelreuteria paniculata* to obtain... GLK The nucleotide sequence of the gene, and its effects GLK Analysis of gene tissue characteristics and temporal developmental expression patterns revealed that in July and September, the leaves of the goldenrain tree... GLK The expression level of the gene was significantly higher than that of *Koelreuteria paniculata*; by using FPNI-PCR technology, the expression levels were obtained separately. GLK Analysis of the gene's two types of promoters, type A and type B, revealed that type A promoters are present in both *Koelreuteria paniculata* and *Koelreuteria bipinnata*, while type B promoters are unique to *Koelreuteria paniculata*. GUS activity assays showed that type B promoters exhibited higher driving activity than type A promoters; therefore, in *Koelreuteria paniculata*... GLK The gene expression level was significantly higher than that of Koelreuteria paniculata. The endogenous promoter of Koelreuteria paniculata or Koelreuteria paniculata provided by this invention can be used to regulate the leaf color development of plants, and has application prospects in the cultivation of plant varieties with high photosynthetic efficiency or ornamental plant varieties. Attached Figure Description
[0018] Figure 1 Phenotypic images of leaves of *Koelreuteria paniculata* and *Koelreuteria bipinnata*; among them, Figure 1 -a is a phenotypic diagram of the leaves of the goldenrain tree; Figure 1 -b is a leaf phenotype diagram of Koelreuteria paniculata.
[0019] Figure 2 The images show the ultrastructure of chloroplasts in the leaves of *Koelreuteria paniculata* and *Koelreuteria bipinnata*; among them, Figure 2 -a represents the complete cellular structure of a Koelreuteria paniculata leaf; Figure 2 -b represents the complete chloroplast structure of a Koelreuteria paniculata leaf; Figure 2 -c represents the chloroplast lamellar structure of the leaves of the Koelreuteria paniculata; Figure 2 -d represents the complete cellular structure of a Koelreuteria paniculata leaf; Figure 2 -e represents the complete chloroplast structure of the leaves of the Koelreuteria paniculata; Figure 2 -f represents the chloroplast grana lamellar structure of the leaves of *Koelreuteria paniculata*; in the figure, CH represents chloroplast, CW represents cell wall, V represents vacuoles, P represents plastoglobulin, T represents thylakoid granules, and SG represents starch granules.
[0020] Figure 3 Line graphs showing the photosynthetic characteristics of *Koelreuteria paniculata* and *Koelreuteria variegata*; among them, Figure 3 -a represents the diurnal variation of net photosynthetic rate of Koelreuteria paniculata and Koelreuteria bipinnata in July; Figure 3 -b represents the diurnal variation of net photosynthetic rate of Koelreuteria paniculata and Koelreuteria bipinnata in August; Figure 3 -c represents the daily variation of net photosynthetic rate of Koelreuteria paniculata and Koelreuteria bipinnata in September; Figure 3 -d represents the diurnal variation of stomatal conductance in Koelreuteria paniculata and Koelreuteria bicolor in July; Figure 3 -e represents the diurnal variation of stomatal conductance in Koelreuteria paniculata and Koelreuteria bicolor in August; Figure 3 -f represents the diurnal variation of stomatal conductance in September for Koelreuteria paniculata and Koelreuteria bicolor.
[0021] Figure 4 for GLKGene expression pattern analysis diagram; among which, Figure 4 -a is GLK Bar chart showing gene expression patterns in different tissues; Figure 4 -b is GLK Gene expression time sequence bar chart; ** indicates P≤0.01.
[0022] Figure 5 The image shows a comparison of the promoter sequences of *Koelreuteria paniculata* and *Koelreuteria variegata*. L1-L14 represent the sequencing results of 14 single clones from the *Koelreuteria paniculata* promoter, and J1-J10 represent the sequencing results of 10 single clones from the *Koelreuteria variegata* promoter.
[0023] Figure 6 Variograms of promoters for Koelreuteria paniculata and Koelreuteria bicolor.
[0024] Figure 7 Histochemical staining images of GUS driven by different promoter subtypes.
[0025] Figure 8 A graph showing the detection of GUS enzyme activity driven by different promoter subtypes. Detailed Implementation
[0026] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.
[0027] Test materials
[0028] The goldenrain trees and goldenrain trees were naturally grown in the goldenrain tree nursery in Xiangyuan County, Shanxi Province. Flower buds and seeds of three goldenrain trees with similar growth were selected as research materials. Leaf tissues were taken from the same parts of the goldenrain trees and goldenrain trees on May 19, 2018, July 19, 2018, and September 19, 2018. Stem segments and root tissues of the goldenrain tree tissue culture seedlings were taken in Room 209 of the tissue culture room of the research building of Beijing Forestry University. All samples were flash-frozen in liquid nitrogen and stored at -80℃ for later use.
[0029] Experimental Example 1: Screening, Cloning, and Differential Analysis of Promoters Associated with the Color of Koelreuteria paniculata Leaves
[0030] 1. Color comparison of leaves of Koelreuteria paniculata and Koelreuteria bipinnata
[0031] The materials used in this study were obtained from a nursery in Xiangyuan County, Shanxi Province, and had been grown under natural conditions for more than 5 years. Observations were conducted over several consecutive years, and the results are as follows: Figure 1 As shown, the goldenrain tree has green leaves. Figure 1-a), its mutant (Koelreuteria paniculata) has golden-yellow leaves and its phenotypic characteristics are very stable ( Figure 1 -b).
[0032] 2. Chloroplast Structure Analysis
[0033] Mature leaves (the third pair of leaves at the top of the plant) of *Koelreuteria paniculata* and *Koelreuteria bipinnata* were collected for transmission electron microscopy analysis. Leaf samples were collected at 8:00 AM. During sample processing, the main veins were avoided, and fresh tissue was cut into 1-2 mm pieces. 2 Thin slices were prepared and transferred to 2.5% glutaraldehyde for vacuum embedding. The 2.5% glutaraldehyde was pre-fixed at 4°C for 24 h, followed by fixation with 1% OsO4 for 2 h. After dehydration, embedding, and embedding, the embedded samples were sectioned using an EM UC6 microtome (Leica Microsystems GmbH, Wetzlar, Germany) and observed using a JEOL 1200 transmission electron microscope (JEOL Ltd., Tokyo, Japan).
[0034] The ultrastructure of chloroplasts in the leaves of Koelreuteria paniculata and Koelreuteria bipinnata are as follows: Figure 2 As shown, the chloroplasts of normal Koelreuteria paniculata green leaf mesophyll cells contain starch granules and a small amount of plastoglobulin, and have a distinct thylakoid membrane and matrix lamellae structure. Figure 2 -a, Figure 2 -b, Figure 2 -c). Compared to the goldenrain tree, ultrastructural analysis of the chloroplasts in the leaves of the goldenrain tree (Koelreuteria paniculata) shows ruptured thylakoid membranes and unclear or missing stroma lamellae. Figure 2 -f). Furthermore, the chloroplasts in the leaves of *Koelreuteria paniculata* are filled with a large amount of plastoglobulin and a small amount of starch granules ( Figure 2 -d, Figure 2 -e).
[0035] This experiment also measured the photosynthetic characteristics of five-year-old Koelreuteria paniculata and Koelreuteria variegata in July, August, and September. The results are as follows: Figure 3 As shown. Six time periods were selected within a day. The data showed that the net photosynthetic rates of *Koelreuteria paniculata* and *Koelreuteria variegata* basically conformed to the changing trend of plant net photosynthetic rates, but the net photosynthetic rate of *Koelreuteria variegata* was significantly lower than that of *Koelreuteria paniculata*. Figure 3 -a、 Figure 3 -b、 Figure 3 -c). The stomatal conductance of both *Koelreuteria paniculata* and *Koelreuteria variegata* also conformed to the diurnal variation trend of plant stomatal conductance. There was no significant difference in stomatal conductance between *Koelreuteria paniculata* and *Koelreuteria variegata* in July and August, but in September, the stomatal conductance of *Koelreuteria variegata* was significantly higher than that of *Koelreuteria paniculata*. Figure 3 -d、 Figure 3 -e、 Figure 3 -f).
[0036] Based on the above experimental results, it is speculated that due to the goldenleaf jasmine... GLK Mutations in the gene promoter led to a significant downregulation of gene expression, which in turn affected chloroplast development and resulted in the mutant's golden leaf phenotype.
[0037] 3 GLK Gene cloning
[0038] By analyzing the transcriptome data of *Koelreuteria paniculata*, cloning-specific primers were designed using the Primer3Plus online website (Table 1). PCR amplification was performed using *Koelreuteria paniculata* and *Koelreuteria bipinnata* DNA and cDNA as templates to obtain target fragments of different lengths. The target bands were purified by gel extraction according to the instructions of a DNA gel extraction kit (Biomega, China). The ligation was performed overnight at 4°C with the pGEM-T vector. The ligation product was transformed into *E. coli* DH5α competent cells, plated, and incubated upside down on a shaker at 37°C. After 14-16 h of plate culture, single colonies were picked for PCR verification. Positive single colonies were added to LB broth and incubated at 37°C on a shaker. The cultured bacterial solutions were then sequenced.
[0039] Table 1. List of primers used in gene cloning
[0040]
[0041] The nucleotide sequence obtained after PCR verification and sequencing is a nucleotide sequence containing a 5′UTR (underlined portion), introns, exons, and a 3′UTR, as shown in SEQ ID No. 5: TTCATATCCGAGAGATCTCAACACAA TTTGTGGTTGAGATCCAATTTCCCCATACTCCTCCTCCACTTAAATTTACAAACAAACAAAACCAACAGCAAACCC ATTAACATCGATTCTCTCCTCTTTTCATCTCCGTTTAATATCGCCGGAAAAACAAAGAAGTTACAAAAGAAAAACC CACTTCTGCTAGCTCTTCAAATCATACTTAGCCAGTTTTTTCATGCAAAAACTTTTGTCACGTAATTGCACCGTAT AGTATATCCCCATAGTGGGTGTATCTATATATAGTGCACTTTCAACTGTTCGAGAATTCAAGTTTTTTTGGTTTTCT CAGCTTTGATTTGTTGAATTA
[0042] Based on the nucleotide sequence shown in SEQ ID No. 5, the following was obtained: GLK The nucleotide sequence of the full-length genome of the gene is shown in SEQ ID No. 3. GLK The nucleotide sequence of the gene's CDS is shown in SEQ ID No. 4.
[0043] 4 GLK Gene expression pattern analysis
[0044] RNA was extracted from five tissues of *Koelreuteria paniculata*: roots, stems, leaves, flower buds, and seeds, using a polysaccharide-polyphenol RNA extraction kit (omega). Leaf tissues from the same locations of *Koelreuteria paniculata* and *Koelreuteria variegata* collected on May 19th, July 19th, and September 19th were used as materials for RNA extraction and stored at -80℃ for later use. The RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA) and stored at -20℃ for later use. Quantitative PCR was performed using the TaKaRa 2×SYBR Green qPCR Mix Kit (10 µL) on a 7500 Real-Time PCR system (Applied Biosystems). The quantitative PCR reaction system is shown in Table 2, and the nucleotide sequences of the primers used are shown in Table 3. Each sample was processed in triplicate, and each triplicate was further processed in triplicate, according to Formula 2. -ΔΔCt (Livak KJ and Schmittgen TD., (2001). Analysis ofRelative Gene Expression Data UsingReal-Time Quantitative PCR and the 2 -ΔΔ Ct Methods. 25(4): 402-408) GLK Quantitative calculation of gene expression in different tissues and at different times.
[0045] The reaction procedure for quantitative fluorescence reaction was as follows: 95℃, 30 s; 95℃, 5 s, 56℃, 34 s, 95℃, 15 s, 40 cycles; 60℃, 1 min; 95℃, 30 s.
[0046] Table 2. Fluorescence quantitative reaction system
[0047]
[0048] Table 3 Primers used in quantitative fluorescence reaction
[0049]
[0050] The test results are as follows Figure 4 As shown, the expression level of the GLK gene in leaves and stems of Koelreuteria paniculata is higher than that in flower buds and seeds. Figure 4 -a), and the leaves of the goldenrain tree in July and September. GLK The expression level of the gene was significantly higher than that of Koelreuteria paniculata. Figure 4 -b).
[0051] 5 GLK Gene promoter sequence cloning
[0052] DNA was extracted from leaf tissues of *Koelreuteria paniculata* and *Koelreuteria variegata* using a polysaccharide-polyphenol DNA extraction kit (Tiangen), and stored at -20°C for later use. FPNI-PCR technology (Wang et al., a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning. BMC Biotechnology. 11:109-121) was used to analyze the DNA from *Koelreuteria paniculata* and *Koelreuteria variegata* materials. GLK The gene promoter was cloned. The PCR reaction system is shown in Table 4, the primers used are shown in Table 5, and the PCR reaction conditions are shown in Table 6. After the reaction, electrophoresis was performed on an agarose gel, and the target band was purified (Novizumab). The cloning vector (Novizumab) was ligated, and E. coli DH5α (Qingke) was transformed. The cells were incubated upside down on a shaker at 37°C for 12-16 h. Single colonies were sent to the company for sequencing.
[0053] Table 4 PCR reaction system
[0054]
[0055] Table 5 Primers used in the PCR reaction
[0056]
[0057] Table 6 PCR Reaction Conditions
[0058]
[0059] Using FPNI-PCR technology, two types of promoters, type A and type B, containing the 5′UTR of the gene were obtained. Sequence alignment revealed that the nucleotide sequence of the 5′UTR in the type A and type B promoters obtained by FPNI-PCR was consistent with... GLK The nucleotide sequence identity of the 5′UTR in the gene is 100%, thus proving that the cloned A and B type promoters are... GLK Gene promoters. The nucleotide sequence of type A promoter with a 5′UTR (underlined portion) is shown in SEQ ID No. 6, and the nucleotide sequence of type B promoter with a 5′UTR (underlined portion) is shown in SEQ ID No. 7.
[0060] TTCATATCCGAGAGATCTCAACACAATTTGTGGTTGAGA TCCAATTTCCCCATACTCCTCCTCCACTTAAATTTACAAACAAACAAAACCAACAGCAAACCCATTAACATCGATT CTCTCCTCTTTTCATCTCCGTTTAATATCGCCGGAAAAACAAAGAAGTTACAAAAGAAAAACCCACTTCTGCTAGC TCTTCAAATCATACTTAGCCAGTTTTTTCATGCAAAAACTTTTGTCACGTAATTGCACCGTATAGTATATCCCCAT AGTGGGTGTATCTATATATAGTGCACTTTCAACTGTTCGAGAATTCAAGTTTTTTGGTTTTCTCAGCTTTGATTTG TTGAATTA (SEQ ID No.6)。
[0061] TTCATATCCGAGAGATCTCAACACAATTTGTGGTTGAGATCCAATTTCCCCATACTCCT CCTCCACTTAAATTTACAAACAAACAAAACCAACAGCAAACCCATTAACATCGATTCTCTCCTCTTTTCATCTCCG TTTAATATCGCCGGAAAAACAAAGAAGTTACAAAAGAAAAACCCACTTCTGCTAGCTCTTCAAATCATACTTAGCC AGTTTTTTCATGCAAAAACTTTTGTCACGTAATTGCACCGTATAGTATATCCCCATAGTGGGTGTATCTATATATA GTGCACTTTCAACTGTTCGAGAATTCAAGTTTTTTGGTTTTCTCAGCTTTGATTTGTTGAATTA (SEQ ID No. 7).
[0062] The nucleotide sequence of the type A promoter is shown in SEQ ID No. 1, and the nucleotide sequence of the type B promoter is shown in SEQ ID No. 2.
[0063] 6 GLK Gene promoter sequence differential analysis
[0064] Based on the comparison of sequencing results, it was found that... GLK Two promoter types exist: 1639 bp (SEQ ID No. 1) and 1619 bp (SEQ ID No. 2). Both types share a 20 bp indel coupled with a SNP (C / T) variant. Notably, this region exhibits heterozygosity in the wild-type *Koelreuteria paniculata*, while it shows homozygosity in the mutant *Koelreuteria variegata*. Further analysis revealed that the 1639 bp promoter is essentially the 1619 bp promoter with a 20 bp base insertion at position -1034 bp. Furthermore, when the promoter is 1639 bp, the base at position -984 bp is C, while when the promoter is 1619 bp, the base at position -984 bp is T. This stable coupling difference exists between the two types. Figure 5 ).
[0065] Experimental Example 2: Functional Identification of Promoters in Koelreuteria paniculata and Koelreuteria bipinnata
[0066] 1. Experimental Methods
[0067] The two types of promoters cloned in Experiment 1 (type A promoter and type B promoter) were used to construct "promoter-GUS-terminator" structures, with the Koelreuteria paniculata promoter being type AB and the Koelreuteria bipinnata promoter being type A. Figure 6 Genetic transformation was performed using 84K poplar. GUS chemical tissue staining and GUS enzyme activity detection were performed on leaf samples of positively transformed plants to compare and analyze the differences in promoter-driven activity of coupled variants.
[0068] 1.1 GUS Histochemical Staining Method
[0069] Cut the tender leaf tissue into 1×1 cm pieces. 2The leaflets were placed in 1.5 mL centrifuge tubes and covered completely with pre-cooled 90% acetone. The tubes were incubated at room temperature for 20-30 min. After rinsing the material thoroughly with distilled water, the material was placed in another 1.5 mL centrifuge tube and covered completely with GUS staining working solution (Bai Rui Ji). The tubes were then wrapped in aluminum foil and incubated overnight at room temperature. Elution was performed using a gradient of 25%, 50%, 70%, and 95% ethanol, gently shaking for 20 min each time, until chlorophyll was completely eluted.
[0070] 1.2 Detection of plant GUS enzyme activity
[0071] Weigh approximately 0.1 g of transgenic leaf tissue and add extraction buffer (Huayueyang) at a volume ratio of 1:5-10. Homogenize on ice and centrifuge at 15000 g, 4℃ for 10 min. Place the supernatant on ice for analysis. Preheat the spectrophotometer for at least 30 min, adjust the wavelength to 400 nm, and zero with distilled water. Add samples to the assay and control groups according to the kit instructions, mix quickly, place in a 37℃ water bath for 30 min, then immediately place in a 95℃ water bath for 5 min (tightly sealed to prevent moisture loss). Cool under running water and mix thoroughly (to maintain concentration). Centrifuge at 8000 g, 4℃ for 5 min. Mix the supernatant thoroughly, let stand at room temperature for 2 min, and measure the absorbance A at 400 nm. Calculate ΔA = Aanalyte tube - Acontrol tube. One control tube is required for each assay tube.
[0072] The formula for calculating GUS enzyme activity is as follows: the regression equation for determination under standard conditions is y = 0.00543x - 0.0027; where y is the concentration of the standard (nmol / mL) and x is the absorbance value.
[0073] Based on the fresh weight of the sample, GUS enzyme activity (nmol / min) / g fresh weight = [(ΔA + 0.0027) ÷ 0.00543 × V] 反总 ]÷(W×V 样 ÷V 样总 ) ÷ T = 61.39 × (ΔA + 0.0027) ÷ W; where V 反总 V is the total volume of the reaction system (mL). 样 V is the volume (mL) of sample added to the reaction system. 样总 The volume of extract added (mL) is W, the sample mass (g) is W, and the reaction time is 30 min.
[0074] 2. Experimental Results
[0075] According to the GUS chemical tissue staining results of 84K transgenic seedlings, the A and B type promoters of Koelreuteria paniculata and Koelreuteria bipinnata showed similar expression patterns to the positive control 35S promoter, and were expressed in the roots, stems, and leaves of 84K Populus tomentosa.Figure 7 Based on the detection of GUS enzyme activity in wild-type and transgenic seedlings of 84K, it was found that the GUS enzyme activity of the B-type promoter, unique to Koelreuteria paniculata, was significantly higher than that of the A-type promoter in different transgenic lines. Therefore, the driving activity of the B-type promoter is higher than that of the A-type promoter. Figure 8 Because the B-type promoter is a promoter unique to Koelreuteria paniculata, it is present in Koelreuteria paniculata. GLK The gene expression level was significantly higher than that of *Koelreuteria paniculata*; because in *Koelreuteria paniculata*... GLK Low gene expression levels lead to incomplete chloroplast development, which in turn results in the yellow leaf phenotype.
Claims
1. An endogenous promoter of Koelreuteria paniculata or Koelreuteria bicolor, characterized in that, Its nucleotide sequence is selected from the nucleotide sequence shown in (a) or (b): (a) the nucleotide sequence shown in SEQ ID No. 1; (b) the nucleotide sequence shown in SEQ ID No.
2.
2. A gene expression cassette, comprising a promoter, a target gene, and a terminator operably linked together, characterized in that, The promoter is the endogenous promoter of Koelreuteria paniculata or Koelreuteria bicolor as described in claim 1.
3. The gene expression cassette according to claim 2, characterized in that, The target gene is a reporter gene or a gene related to plant leaf color development.
4. The gene expression cassette according to claim 3, characterized in that, The gene mentioned that is related to plant leaf color development is GLK Gene.
5. The gene expression cassette according to claim 4, characterized in that, The GLK The gene is that of Koelreuteria paniculata or Koelreuteria variegata. GLK Gene.
6. The gene expression cassette according to claim 5, characterized in that, The aforementioned goldenrain tree or variegated goldenrain tree GLK The nucleotide sequence of the gene's CDS is shown in SEQ ID No.
4.
7. An expression carrier, characterized in that, The expression vector contains the endogenous promoter of Koelreuteria paniculata or Koelreuteria bicolor as described in claim 1 or the gene expression cassette as described in claim 2.
8. A recombinant host cell, characterized in that, The recombinant host cell contains the endogenous promoter of *Koelreuteria paniculata* or *Koelreuteria bipinnata* as described in claim 1, the gene expression cassette as described in claim 2, or the expression vector as described in claim 7.
Citation Information
Patent Citations
Peach chloroplast development gene PpGLK1 and application thereof
CN111944829A
CRISPR / Cas9 system for targeted knockout of GLK gene and application of CRISPR / Cas9 system
CN112941077A