Microneedle raw material composition and microneedle and acoustic power system formed by microneedle raw material composition

Abstract

The invention discloses a microneedle raw material composition as well as a microneedle and a sonodynamic system formed by the microneedle raw material composition. The microneedle raw material composition comprises a zinc-based porphyrin metal organic framework MOF (Zn-TCPP) modified by mPEG-PEI. The sonodynamic system provided by the invention can kill redundant white fat cells. Obese mice treated with this ultrasound gene therapy show significant improvements in glucose tolerance and insulin sensitivity, successfully achieving weight loss and inhibiting weight rebound.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a microneedle raw material composition, microneedles formed thereby, and a sonodynamic system. Background Art

[0002] The increasing prevalence of obesity and its associated complications, including cardiovascular diseases, type 2 diabetes, osteoarthritis, fatty liver, and several cancers (such as breast cancer, colorectal cancer, ovarian cancer, liver cancer, and pancreatic cancer), have made obesity a global health priority and the second leading preventable cause of death worldwide. Obesity is a condition of excessive accumulation of fat in adipose tissue, which is mainly divided into white adipose tissue (WAT) and brown adipose tissue (BAT) according to its location and function; the former can effectively store lipids, while the latter generates heat by consuming lipids and glucose. Since white fat is superficial and easily accessible, inducing its browning has been proposed as a major therapeutic strategy against obesity. Brown adipocytes contain multiple mitochondria that express unique thermogenic genes, among which uncoupling protein (UCP1) plays a central role. UCP1 decouples oxidative phosphorylation from adenosine triphosphate, thereby converting energy into heat to combat obesity and related metabolic disorders. Some reports have demonstrated the positive effect of the UCP1 overexpression therapeutic strategy in combating obesity. However, gene regulation techniques that allow continuous overexpression of UCP1 still have limitations, such as immunogenicity and the impact of gene mutations.

[0003] The nuclease protein 9 associated with clustered regularly interspaced short palindromic repeats (CRISPR-Cas9) system, including CRISPR activation (CRISPRa) and CRISPR interference gene editing technologies, is a powerful tool for manipulating gene expression. It allows for the stable long-term overexpression and knockout of target genes with high efficiency and precision in gene editing, which has been widely adopted by the scientific community. Subtypes of the activation system rely on the fusion of dead Cas9 (dCas9) with transcriptional activation domains (such as VP64 and KRAB), which together regulate the expression of endogenously activated genes. This technology has been used to activate the UCP1 gene in mouse white preadipocytes. Studies have shown that compared with Cas9, the dCas9 system has a lower risk of off-target effects and a milder action. However, after the CRISPR-dCas9 technology is directly delivered into the body for disease treatment, the CRISPR system (such as plasmid DNA and ribonucleoprotein) will undergo degradation and immune clearance. In addition, common vectors such as adeno-associated virus, lentivirus, and lipid nanoparticles of non-viral vectors have limited loading capacity and systemic toxicity. There is an urgent need for a new treatment model and method for obesity. Summary of the Invention

[0004] The technical problem to be solved by the present invention is an urgent need for a new treatment model and method for obesity. Obesity is an increasing global health problem that requires effective, feasible, and innovative treatment models. Therefore, the present invention provides a microneedle raw material composition, the microneedles formed therefrom, and a sonodynamic system. This patent develops a spatiotemporally controllable microneedle platform for ultrasound-gene therapy against obesity. The metal-organic framework (MOF) photosensitizer modified with (mPEG-PEI) encapsulates the clustered regularly interspaced short palindromic repeat activation (CRISPRa) / CRISPRa uncoupling protein (UCP1) system, and it is prepared into an MN patch for intradermal delivery to adipocytes. Generally speaking, this treatment platform can achieve two major strategies of "eliminating the enemy" and "winning over the enemy": one is to kill excess white adipocytes through sonodynamic therapy, and the other is to promote the browning of white adipocytes through the controlled release of the CRISPRa-UCP1 system. Obese mice treated with this ultrasound gene therapy showed significant improvements in glucose tolerance and insulin sensitivity, successfully achieving weight loss and suppressing weight regain. This study provides a new standard treatment model for gene therapy of obesity and other metabolic diseases.

[0005] On the one hand, the present invention provides a micro-needle raw material composition, which uses mPEG-PEI modified zinc-based porphyrin metal-organic framework MOF (Zn-TCPP), and the composition is named MP.

[0006] In a preferred embodiment, in the micro-needle raw material composition, the mass ratio of mPEG to PEI is 1:(0.5 - 5), preferably 1:0.5, 1:0.8, 1:1, 1:1.5, 1:1.8, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5 or 1:5.

[0007] In a preferred embodiment, in the micro-needle raw material composition, the mass ratio of mPEG-PEI to the MOF is 1:(2 - 10), preferably 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 or 1:10.

[0008] On the other hand, the present invention also provides a preparation method of the raw material composition as described in the present invention, which includes: adding a mixed solution of mPEG and PEI to a zinc-based porphyrin metal-organic framework MOF solution to obtain the MP.

[0009] On the other hand, the present invention also provides a micro-needle, and the micro-needle carries the raw material composition as described in the present invention.

[0010] In a preferred embodiment, the micro-needle further includes 10 - 20 wt% of hyaluronic acid, such as 10 wt% of hyaluronic acid, 13 wt% of hyaluronic acid, 15 wt% of hyaluronic acid, 18 wt% of hyaluronic acid or 20 wt% of hyaluronic acid.

[0011] On the other hand, the present invention also provides a preparation method of a micro-needle, which includes the following steps:

[0012] (a) Mix the raw material composition as described in the present invention with hyaluronic acid and deposit it in a micro-needle cavity;

[0013] (b) Continuously fill the micro-needle cavity with a hyaluronic acid solution to obtain the micro-needle.

[0014] On the other hand, the present invention also provides a micro-needle patch, which includes the micro-needle and the patch as described in the present invention.

[0015] Preferably, the content of the micro-needle raw material composition in each micro-needle patch is 50 - 200 μg; preferably 50 μg, 70 μg, 80 μg, 90 μg, 100 μg, 120 μg, 150 μg, 180 μg or 200 μg.

[0016] On the other hand, the present invention also provides a sonodynamic system, which includes ultrasonic waves, a platform formed by the micro-needle raw material composition described in the present invention and / or the micro-needle patch described in the present invention, and uses the ultrasonic waves to irradiate the raw material composition and / or the micro-needle patch.

[0017] In a preferred embodiment, in the ultrasonic regulation gene editing system of the present invention, the ultrasonic waves satisfy one or more of the following conditions:

[0018] 1.0 - 3.0 MHz, such as 1.0 MHz, 1.5 MHz, 2.0 MHz, 2.50 MHz or 3.0 MHz;

[0019] 0.1 - 3.0 W / cm -2 such as 0.5 W / cm -2 、0.8 W / cm -2 、1.0 W / cm -2 、1.3 W / cm -2 、1.5 W / cm -2 、1.8 W / cm -2 、2.0 W / cm -2 、2.5 W / cm -2 or 3.0 W / cm -2 ;

[0020] and / or, 10% - 50% duty cycle, such as 10% duty cycle, 20% duty cycle, 30% duty cycle, 40% duty cycle or 50% duty cycle;

[0021] The ultrasonic radiation time is 3 - 15 min, such as 5 min.

[0022] On the other hand, the present invention also provides the application of the raw material composition described in the present invention, the raw material composition obtained by the preparation method described in the present invention, the micro-needles described in the present invention, the micro-needle patch obtained by the preparation method described in the present invention, the micro-needle patch described in the present invention or the sonodynamic system described in the present invention in the preparation of drugs for treating obesity.

[0023] In a preferred embodiment, the raw material composition, the micro-needles or the micro-needle patch have one or more of the following characteristics:

[0024] I. Promote the drug to increase the ROS level in the white adipocytes of the subject;

[0025] II. Promote the drug to increase the apoptosis of the white adipocytes of the subject;

[0026] III. Promote the drug to reduce the triglyceride storage capacity of the white adipocytes of the subject;

[0027] IV. Promote the reduction of fat in the IgWAT, PgWAT and PrWAT of the subject by the drug;

[0028] V. Promote the improvement of glucose tolerance and insulin resistance of the subject by the drug.

[0029] The microneedle patch of the present invention: is a novel transdermal drug delivery device, the surface of which is covered with tiny needles and can painlessly penetrate the skin surface to deliver drugs to subcutaneous cells.

[0030] The CRISPRa-UCP1 plasmid of the present invention is a gene activation tool based on the CRISPR / Cas9 system and is used to enhance the expression of the UCP1 (mitochondrial uncoupling protein 1 in brown adipose tissue) gene.

[0031] The MOF (Zn-TCPP) of the present invention: is a metal-organic framework material formed by the coordination of zinc ions and TCPP (tetracarboxyphenyl porphyrin), and has a high surface area and high biocompatibility.

[0032] The obesity of the present invention refers to a chronic metabolic disease in which excessive fat accumulation or abnormal distribution in the body leads to weight gain.

[0033] The present invention constructs an intelligent spatiotemporally controllable microneedle (MN) patch, which realizes ultrasound-gene therapy for obesity by upregulating browning genes and simultaneously killing excess white adipocytes. As Figure 1As shown, by using zinc meso-tetrakis(4-carboxyphenyl)porphyrin (Zn-TCPP) MOF (metal-organic framework material) modified with mPEG (methoxypolyethylene glycol) or mPEG-PEI (methoxypolyethylene glycol-polyethylenimine) as a carrier, loading with the CRISPRa-UCP1 plasmid (hereinafter also referred to as aUCP1) that upregulates UCP1, and then encapsulating it in a hyaluronic acid (HA) MN patch, a US-regulated weight loss platform (hereinafter also referred to as MN-MP / aUCP1, where "MP" refers to mPEG-PEI-modified MOF (Zn-TCPP)) was successfully prepared. This platform uses the transdermal property of the MN patch to deliver the ultrasound-gene regulation system (hereinafter also referred to as MP / aUCP1) to the subcutaneous fat layer and penetrate into adipocytes. Zn-TCPP modified with mPEG-PEI (600Da) exhibits high molecular mass and high cationic charge density, enabling effective gene aggregation and endosomal escape. In addition, US irradiation can promote intracellular plasmid transfection and gene overexpression. Generally speaking, under the spatiotemporal regulation of US, on the one hand, it activates the MOF to efficiently produce reactive oxygen species (ROS) to kill excessive white adipocytes, and on the other hand, it promotes the activation of UCP1 through the CRISPRa-UCP1 system, thus "turning" white adipocytes and promoting their browning. This method significantly promoted weight loss in mice (18.3% ± 1.7%), improved insulin resistance, and inhibited weight rebound in the long term. In addition, the genome editing treatment caused by US significantly increased the level of oxidative stress in adipose tissue (e.g., 8-hydroxy-2deoxyguanosine (8-OHdG)), and upregulated the expression of browning-related genes (e.g., UCP1).

[0034] On the basis of conforming to the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0035] The reagents and raw materials used in the present invention are all commercially available.

[0036] The positive and progressive effects of the present invention are as follows:

[0037] This patent developed a spatiotemporally controllable microneedle platform for ultrasound-gene therapy against obesity. The (mPEG-PEI)-modified metal-organic framework (MOF) photosensitizer encapsulated the regularly spaced clustered regularly interspaced short palindromic repeats activation (CRISPRa) / CRISPRa uncoupling protein 1 (UCP1) system, which was fabricated into MN patches and delivered intradermally to adipocytes. Overall, this therapeutic platform can achieve two strategies: "eliminating the enemy" and "turning the enemy into an ally". One is to kill excess white adipocytes through sonodynamic therapy, and the other is to promote the browning of white adipocytes through the controllable release of the CRISPRa-UCP1 system. Obese mice treated with this ultrasound-gene therapy showed significant improvements in glucose tolerance and insulin sensitivity, successfully achieving weight loss and suppressing weight regain. This study provides a new standard treatment modality for gene therapy of obesity and other metabolic diseases. Brief Description of the Drawings

[0038] Figure 1 For the preparation process of MN-MP / aUCP1 and its application in the weight loss treatment of a spatiotemporally controllable ultrasound-gene therapy platform. a) Schematic diagram of the synthesis process of the MN-MP / aUCP1 patch. b) Insertion of the MN-MP / aUCP1 patch into the white adipose tissue in the inguinal region of obese mice. c) Controllable release of MP / aUCP1 from the MN patch under US irradiation. d) "Eliminating the enemy" and "turning the enemy into an ally": apoptosis and browning of white adipocytes. MN: microneedle; US: ultrasound.

[0039] Figure 2Characterization and ROS generation ability of the MP / aUCP1 nanosystem. a) Transmission Electron Microscope (TEM) images and corresponding elemental maps of Zn-TCPP nanosheets (scale bar: 100 nm). b) X-ray photoelectron spectroscopy (XPS) measurement scans of TCPP and Zn-TCPP. c) Ultraviolet-visible (UV-vis) absorption spectra of TCPP and Zn-TCPP nanosheets. d) Fourier transform infrared spectroscopy (FT-IR) of TCPP and Zn-TCPP. e) Schematic diagram of the PX330 vector inserted with sgRNA and sequencing results of the sgRNA targeting UCP1 in the CRISPRa-UCP1 plasmid (aUCP1). f) Protein expression of UCP1 in mature adipocytes after co-incubation with or without aUCP1. g) Agarose gel electrophoresis of MP / aUCP1 at different mass ratios (aUCP1∶MP = 4∶1, 2∶1, 1∶1, 1∶0, 1∶2, 1∶3, or 1∶4). H) ζ-potentials of MOF (Zn-TCPP), MP, aUCP1, and MP / aUCP1, data are shown as mean ± standard deviation (SD) (n = 3). I) X-ray diffraction (XRD) patterns of Zn-TCPP and MP / aUCP1 nanosheets. j, k) Ultraviolet-visible (UV-vis) absorption spectra of DPBF (2,6-di(tert-butyl)phenol) added with MP / aUCP1 (50 μg mL -1 )(j) or H2O(k) under US irradiation. l) Electron spin resonance (ESR) measurements of US only, MP / aUCP1, and MP / aUCP1 + US.

[0040] Figure 3 Showing the sonodynamic properties of MP / aUCP1 nanosheets. a, b) Flow cytometry (FCM) analysis of the reactive oxygen species (ROS) level (a) in mature 3T3-L1 adipocytes and the corresponding fluorescence intensity (b) after various treatments, data are shown as mean ± SD (n = 3). For the gating strategy, see Figure 9 b of. c) Confocal laser scanning microscopy (CLSM) observation of 2,7-dichlorofluorescein diacetate (DCFH-DA)-stained mature adipocytes after different treatments (scale bar: 10 μm). d) Viability of mature adipocytes after co-culture with MP / aUCP1 nanosheets at different concentrations (0, 2.5, 5, 10, 25, or 50 μg mL -1 ) for 24 h, data are presented as mean ± SD (n = 5). e) With MP / aUCP1 (50 μg mL -1 ) plus various sound intensities (0, 0.25, 0.5, 0.75, 1, and 1.5 W cm -2) Viability of mature adipocytes treated with US radiation, data are presented as mean ± SD (n = 5). f) Flow cytometry apoptosis analysis of mature adipocytes in different groups. For the gating strategy, see f of Figure 9 g) Concentration of cellular triglyceride (TG) after different treatments, data are presented as mean ± SD (n = 3). I: Control; II: US irradiation; III: aUCP1; IV: MP / aUCP1; V: MP + US; VI: MP / aUCP1 + US. Significance was calculated by Student’s t-test. *P < 0.05, ***P < 0.001, ****P < 0.0001.

[0041] Figure 4 Preparation and characterization of MN-MP / aUCP1. a) Schematic illustration of the fabrication of microneedle (MN) patches. b, c) Representative digital photographs of MN patches (b) and MN patches loaded with MP / aUCP1 (c) (scale bar: 200 nm). d) Scanning electron microscope (SEM) image of the MN-MP / aUCP1 patch (scale bar: 200 μm). e) Schematic illustration of the mechanical strength of MN patches with different HA concentrations and the corresponding testing device. f) Hematoxylin and eosin (H&E) staining of mouse skin showing the penetration of MNs (scale bar: 100 μm). g) Upper panel: Images of the tips of MNs pressed into the skin at different time points; almost all MNs were dissolved within 15 minutes (scale bar: 200 μm); Lower panel: Recovery of the skin after MN treatment (scale bar: 5 mm). h) Fluorescence images of MN patches containing MP nanosheets loaded with aUCP1-ICG (Indocyanine Green, an indocyanine compound) and Cy3 (Cyanine 3, a cyanine fluorescent dye) (scale bar: 200 μm). I) In vivo fluorescence images of aUCP1 (aUCP1-ICG) and MP / aUCP1 (aUCP1-ICG loaded with MP) delivery by subcutaneous injection (InJ) or MN patches inserted into the inguinal region. j) Quantification of fluorescence intensity during 3-day treatment, data are presented as mean ± SD (n = 3). k, l) Fluorescent biodistribution (k) and corresponding quantitative analysis of fluorescence intensity (l) of major organs in mice 24 hours after subcutaneous injection or MN patch delivery of aUCP1 and MP / aUCP1, data are presented as mean ± SD (n = 3). Statistical significance was calculated by Student’s t-test. *P < 0.05, **P < 0.01, ****P < 0.0001.

[0042] Figure 5Anti-obesity treatment efficacy using MN-MP / aUCP1 under US irradiation. a) Schematic diagram of different treatments for mice. b, c) Changes in body weight (b) and high-fat diet (HFD) intake (c) of mice under different treatment conditions. Data are represented as mean ± SD (n = 5). d) Representative photos of mice on the 21st day after various treatments. e) Representative photos of adipose tissues from different parts extracted from the mice in d). f) Weights of the adipose tissues in e). Data are represented as mean ± SD (n = 5). g) Representative hematoxylin-eosin (H&E) images of adipose tissues from different parts (scale bar: 50 μm). h) Corresponding morphometric analysis of adipocyte size. i) Observation of liver sections isolated from mice after 21 days of different treatments by H&E and Oil Red O staining (scale bar: 50 μm). IgWAT: inguinal white adipose tissue; PgWAT: perigonadal white adipose tissue; PrWAT: perirenal white adipose tissue. Statistical significance was calculated by Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0043] Figure 6 Improvement and long-term effects of obesity-related metabolic dysfunction in mice after treatment with MN-MP / aUCP1 + US. a - c) Serum glucose (a) and insulin (b) levels in mice on the 21st day after various treatments, and insulin resistance index (IRI) calculated from the above serum glucose and insulin levels (c); data are represented as mean ± SD (n = 5). d - f) Levels of triglyceride (TG) (d), free fatty acid (FFA) (e), and cholesterol (CHO) (f); data are represented as mean ± SD (n = 5). g) Sirius red staining of white adipose tissue (IgWAT) in different groups of mice after 21 days of treatment (scale bar: 100 μm). h) Masson staining and Sirius red staining of the livers of different groups of mice after 21 days of treatment (scale bar: 500 μm). i) Daily diet intake of mice with different treatments during the 15-day body weight recovery monitoring period. j, k) Body weight changes (j) and corresponding percentage of body weight changes (k) during the body weight recovery monitoring period. Data are represented as mean ± SD (n = 3). I: control; II: MN + US; III: MN-aUCP1; IV: MN-MP / aUCP1; V: MN-MP + US; VI: MN-MP / aUCP1 + US. Statistical significance was calculated by Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0044] Figure 7Changes in the molecular levels of IgWAT after MN-MP / aUCP1+US treatment. a) Representative terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) images showing apoptosis (red) in inguinal white adipose tissue (IgWAT), perigonadal WAT (PgWAT), and perirenal WAT (PrWAT) (scale bar: 50 μm). b) Representative fluorescence images of reactive oxygen species (ROS) levels in IgWAT (scale bar: 50 μm). c-e) Oxidative stress levels in IgWAT of different treatment groups, including MDA (c), 4-HNE (d), and 8-OHdG (e), data are expressed as mean ± SD (n = 5). f) Representative immunofluorescence images of UCP1 labeling in IgWAT sections (scale bar: 50 μm). g) mRNA expression levels of UCP1 in IgWAT of mice in different groups, data are expressed as mean ± SD (n = 3). h) Western blot analysis of UCP1, PGC1-β, and PPARγ in IgWAT. I, j) mRNA expression levels of PGC1-β (I) and PPARγ (j), data are expressed as mean ± SD (n = 3). k) Determination of TG content in IgWAT, data are expressed as mean ± SD (n = 3). l) First-generation sequencing results of UCP1 in IgWAT of mice. I: Control; II: MN+US; III: MN-aUCP1; IV: MN-MP / aUCP1; V: MN-MP+US; VI: MN-MP / aUCP1+US. Statistical significance was calculated by Student’s t-test. **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0045] Figure 8 : a) Bright-field image of MOF (Zn-TCPP) nanosheets (scale bar: 200 nm). b) TEM image of MP / aUCP1 nanosheets and corresponding elemental maps (scale bar: 100 nm). c) Particle size distributions of Zn-TCPP, MP, and MP / aUCP1 (n = 3).

[0046] Figure 9 : a) UV-visible (UV-vis) relative absorbance of DPBF with the addition of MP / aUCP1 (50 μg mL -1 ) or H2O under US irradiation. b) Flow cytometry gating strategy for analyzing ROS levels. c) Quantification of reactive oxygen species (ROS) levels in mature 3T3-L1 adipocytes by confocal laser scanning microscopy (CLSM). Data are presented as mean ± standard deviation (n = 3). d) 3T3-L1 preadipocytes with different concentrations (0, 2.5, 5, 10, 25, and 50 μg mL -1) Viability after co - culturing with MP / aUCP1 nanosheets for 24 h. Data are presented as mean ± standard deviation (n = 5). e) Viability of 3T3 - L1 pre - adipocytes treated with MP / aUCP1 (50 μg mL -1 ) plus US irradiation at different sound intensities (0, 0.25, 0.5, 0.75, 1, and 1.5 W cm -2 ). Data are presented as mean ± standard deviation (n = 5). f) Gating strategy for apoptosis analysis using flow cytometry. g) Fluorescence microscopy images of 3T3 - L1 pre - adipocytes stained with calcein AM and PI after different treatments (scale bar: 50 μm). Significance was calculated by Student’s t - test. n.s.: not significant, ****P < 0.0001.

[0047] Figure 10 : a) Cellular uptake was observed using confocal laser scanning microscopy (CLSM) (left) and corresponding quantitative analysis (right) after incubation of different treatment groups with mature adipocytes for 4 h (scale bar: 20 μm). b) CLSM images (left) and corresponding fluorescence intensities (right) of MP / aUCP1 co - incubated with mature adipocytes for 4 h with or without US irradiation, for evaluating lysosome / endosome escape ability (scale bar: 20 μm).

[0048] Figure 11 : Transfection ability of 3T3 - L1 pre - adipocytes (a) and mature adipocytes (b) after different treatments was evaluated by flow cytometry. Data are presented as mean ± standard deviation (n = 3). Significance was calculated by Student’s t - test. **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0049] Figure 12 : a, b) Transfection efficiency of 3T3 - L1 pre - adipocytes was evaluated by fluorescence microscopy (a) and corresponding quantitative analysis (b). c, d) Transfection efficiency of mature adipocytes was evaluated by fluorescence microscopy (c) and corresponding quantitative analysis (d) (scale bar: 50 μm). Data are presented as mean ± standard deviation (n = 3). Significance was calculated by Student’s t - test. **P < 0.01, ***P < 0.001.

[0050] Figure 13: a) Scanning electron microscopy (SEM) image of hyaluronic acid (HA) microneedle (MN) patch (scale bar: 200 μm). b) Hematoxylin and eosin (H&E) staining of mouse skin 24 hours after administration of PBS (left) and MN patch (right) (scale bar: 500 μm). c) Mechanical strength of MN patches with different MP / aUCP1 contents. d) Representative photographs of subcutaneous implantation of MN patch in the inguinal region of mice for 1 min (left) and 15 min (right). e) Transfection ability of mature adipocytes after different treatments evaluated by flow cytometry. f) Skin photographs 24 hours after different treatments. g-i) Fluorescent biodistribution (g) and corresponding quantitative analysis of fluorescent intensity of major organs of mice on the 2nd (h) and 3rd (i) days after different treatments. Data are presented as mean ± standard deviation (n = 3). Statistical significance was calculated by Student’s t-test. n.s.: not significant, *P < 0.05, **P < 0.01, ***P < 0.001.

[0051] Figure 14 : a) Percentage change in body weight of mice under different treatment conditions during 21-day treatment. Data are presented as mean ± standard deviation (n = 5). b) Representative photographs of isolated livers of mice on the 21st day after various treatments. c) Changes in blood glucose concentration during oral glucose tolerance test after 8-hour fasting in mice of different groups. Data are presented as mean ± standard deviation (n = 3). Statistical significance was calculated by Student’s t-test. *P < 0.05, ***P < 0.001, ****P < 0.0001.

[0052] Figure 15 : Representative hematoxylin and eosin (H&E) staining histological images of major organs such as heart, spleen, lung, and kidney of mice in different groups 21 days after treatment (scale bar: 200 μm).

[0053] Figure 16 : Routine blood analysis of mice on the 21st day after different treatments. The range within the dotted line represents the normal norm. Data are presented as mean ± standard deviation (n = 5). RBC: red blood cell; WBC: white blood cell count; Lymph: lymphocyte; Gran: granulocyte; Mon%: monocyte percentage; Lymph%: lymphocyte percentage; Gran%: granulocyte percentage; MCH: mean corpuscular hemoglobin; MCV: mean corpuscular volume; PLT: platelet count.

[0054] Figure 17: Serum biochemistry of mice on the 21st day after different treatments (a-h). Serum ALT (a), AST (b), and TP (c) reflect liver function. Serum CK (d), CK-MB (e), and LDH (f) reflect cardiac function. Serum urea (g) and creatinine (h) reflect renal function. Data are expressed as mean ± standard deviation (n = 5). Statistical significance was calculated by Student’s t-test. n.s.: not significant, *P < 0.05, **P < 0.01.

[0055] Figure 18 : Analysis of interleukin-6 (IL-6), IL-1β, and tumor necrosis factor α (TNF-α) levels in mouse serum (a-c) and IgWAT (d-f). Data are expressed as mean ± standard deviation (n = 5). g) Photos of mice treated with various conditions during 15-day body weight recovery monitoring. Statistical significance was calculated by Student’s t-test. n.s.: not significant, ****P < 0.0001.

[0056] Figure 19 : a) Quantitative analysis of terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) images in inguinal white adipose tissue (IgWAT), PgWAT (perigonadal white adipose tissue); PrWAT (perirenal white adipose tissue). Data are expressed as mean ± standard deviation (n = 3). b) Quantitative analysis of ROS levels within IgWAT. c) Quantitative analysis of UCP1 levels within IgWAT. Data are expressed as mean ± standard deviation (n = 3). d) Western blot analysis of PPARα in IgWAT. e) Free fatty acid (FFA) levels in mouse IgWAT on the 21st day after different treatments. Data are expressed as mean ± standard deviation (n = 3). f) Principal component analysis (PCA) plot of RNA-seq data from IgWAT isolated from untreated and MN-MP / aUCP1+US-treated mice (n = 5). Statistical significance was calculated by Student’s t-test. n.s.: not significant, **P < 0.01, ***P < 0.001, ****P < 0.0001. Detailed implementation mode

[0057] The present invention will be further illustrated by way of examples below, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product instructions.

[0058] Overview of materials and methods

[0059] 1. Materials

[0060] Unless otherwise specified, all chemicals in this patent are from Sigma-Aldrich. Meso-tetrakis(4-carboxyphenyl)porphine (TCPP, 97%) was purchased from Tokyo Chemical Industry Co., Ltd. Ethanol was purchased from Merck. Pyrazine (99%) was purchased from Aladdin. The SDS-PAGE Gel Rapid Preparation Kit was purchased from Beyotime Co., Ltd. Hyaluronic acid (10 kDa) was purchased from Meilun Biotechnology Co., Ltd. Dulbecco's Modified Eagle Medium (DMEM), calf serum, and fetal bovine serum (FBS) were purchased from Biological Industries. Blood glucose, free fatty acid (FFA), and insulin assay kits were purchased from Nanjing Jiancheng. Mouse IL-6, IL-1β, and TNF-α ELISA kits were purchased from eBioscience (Shanghai, China). Various other assay kits used in this patent were purchased from Beyotime. The anti-UCP1 antibody was from CST, and the anti-PGC1β antibody, anti-PPARα antibody, and anti-PPARγ antibody were from Abcam.

[0061] 2. Characterization

[0062] The morphologies of MOF (Zn-TCPP) and MP / aUCP1 nanosheets were obtained by TEM (FEI Tecnai G2 F20, acceleration voltage = 200 kV). The corresponding elemental mappings were observed by JEM-2100F. XPS was performed by X-ray photoelectron spectrometer (Thermoescalab 250XI). The UV-visible absorption spectra were examined by UV-visible near-infrared spectrophotometer (PE Lambda 950). The infrared spectra were studied by Shimadzu IR Prestige-21 infrared spectrometer. The size and ζ potential were detected by Malvern ZetaParticle Sizer Nano Series (Nano ZS90). The XRD patterns were tested by bruker D8 X-ray diffractometer. Confocal images were captured by CLSM (Carl Zeiss, LSM 900). 1 O2 detection was determined by electron spin resonance (ESR) spectrometer (200A300-10 / 12). The morphology of the MN patch was observed by scanning electron microscope (ZEISS GeminiSEM 300). Fluorescent sections were observed by Nikon biological microscope (CI-L).

[0063] 3. Synthesis of MOF (Zn-TCPP) Nanopatch

[0064] PVP (105 mg), Zn(NO3)2·6H2O (22.5 mg, 0.075 mmol), and pyrazine (4 mg, 0.05 mmol) were dissolved in an 85 mL capped brown flask containing a mixture of 60 mL DMF and ethanol (V∶V = 3∶1). Then, TCPP (20 mg, 0.025 mmol) dissolved in a mixture of 25 mL DMF and ethanol (volume ratio = 3∶1) was added dropwise under stirring. Next, the prepared solution was sonicated for 20 minutes. The flask was placed in a water bath with magnetic stirring and reacted at 80 °C for 16 hours. After washing twice with ethanol and centrifuging at 8000 r.p.m for 8 minutes, MOF (Zn-TCPP) nanosheets were obtained. Subsequently, the collected Zn-TCPP nanosheets were dispersed in 50 mL of ethanol.

[0065] 4. Construction of the CRISPRa-UCP1 system

[0066] The UCP1 gene sequence is available at https: / / www.ncbi.nlm.nih.gov / , and its Gene ID is 7350. The target of the UCP1 gene sequence: AGGGCTTTGGGAGTGACGCG (SEQ ID NO:1) was designed using an online tool (http: / / chopchop.cbu.uib.no / . ). The sgRNA and CRISPR-dCas9 system were obtained from Integrated DNA Technologies.

[0067] 5. Western blot analysis of mature adipocytes

[0068] After 3T3-L1 preadipocytes (white adipocytes) differentiated into mature adipocytes, the CRISPRa-UCP1 plasmid was mixed with Lipofectamine 2000 and treated on mature adipocytes for 3 days. The total protein concentration was evaluated using a BCA protein assay kit. Equal amounts of protein (25 μg) were separated on a 12% sodium dodecyl sulfate polyacrylamide gel. The protein was transferred to a PVDF membrane and incubated with a blocking buffer at room temperature for 1 hour. The membrane was incubated overnight with a 1000-fold diluted anti-UCP1 antibody (CST, Catalog No.72298), and then immersed in the conjugated secondary antibody at room temperature for 1 hour. Finally, after three washes, the protein expression level was measured by a chemiluminescent imaging system (GE healthcare, USA).

[0069] 6. Synthesis of P / aUCP1, MP, and MP / aUCP1 nanosheets

[0070] A mixture of mPEG and PEI (w∶w = 1∶2) and aUCP1 were mixed at a mass ratio of 1∶1.25 and stirred overnight to prepare P / aUCP1. 40 mg of Zn-TCPP was dispersed in 5 mL of PBS, 10 mg of the mixture of mPEG and PEI (w∶w = 1∶2) was added thereto, and the mixture was stirred overnight in the dark at room temperature. Then mPEG-PEI modified Zn-TCPP was obtained. MP / aUCP1 nanosheets were obtained by mixing MP and aUCP1 at a mass ratio of 4:1 for 2 h.

[0071] 7. Agarose gel electrophoresis analysis

[0072] CRISPRa-UCP1 plasmids with different mass ratios were incubated with MP overnight. Then the mixture was centrifuged at 8000 r.p.m. for 8 minutes, and the supernatant was collected. Subsequently, 5 μL of the supernatant with different mass ratios was mixed with 1 μL of 6×DNA loading buffer to prepare various loading solutions. Then these loading solutions were added to the sample wells in a 0.5% agarose gel, and electrophoresis was carried out at 80 V for 40 minutes. Gel imaging was performed using a gel recording system (ChampChemi 910Plus).

[0073] 8. In vitro sonodynamic performance evaluation

[0074] Under US irradiation, 1,3-diphenylisobenzofuran (DPBF) was used as 1 an indicator of O2 to evaluate the ability of MP / aUCP1 to generate 1 O2 in vitro. To test this, a DMSO solution containing DPBF (5 μL, 10 mM) was mixed with a 50 μg·mL -1 solution of MP / aUCP1. The UV-vis absorption spectrum of DPBF was measured to evaluate the generation of -2 O2 after irradiation with US (1.0 MHz, 1.5 W·cm 1 for different durations (0 min, 1 min, 2 min, 3 min and 4 min). In addition, 2,2,6,6-tetramethylpiperidine (TEMP) was used as a scavenger, and 1 O2 was detected by an ESR spectrometer in different treatment groups, including H2O + TEMP + US (1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min), TEMP + MP / aUCP1 (50 μg·mL -1 ), and MP / aUCP1 (50 μg·mL -1 ) + TEMP + US (1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min).

[0075] 9. Cell and mouse culture

[0076] 3T3-L1 embryonic fibroblasts (preadipocytes) were purchased from the American Type Culture Collection (ATCC) and cultured at 37°C in DMEM medium containing 10% calf serum and 5% CO2. This cell line was identified quarterly to ensure no mycoplasma contamination. For the differentiation of 3T3-L1 preadipocytes, when the cell confluence reached 100%, the prepared MDI induction medium (90% DMEM, 10% FBS, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, and 10 μg·mL -1 insulin) was added and cultured for 2 days, and then switched to DMEM containing 10% FBS and 1 μM dexamethasone for 2 days. Subsequently, the medium was changed to DMEM medium containing 10% FBS and continued to be cultured, with the liquid changed every 2 days until 3T3-L1 preadipocytes were induced into mature adipocytes on the 8-10th day. All mouse experiments in this study were conducted in accordance with the policies of the National Ministry of Health and approved by the Experimental Animal Center of the Tenth People's Hospital of Shanghai. Male C57BL / 6J mice at 6-8 weeks of age were purchased from Lingchang Biotechnology Co., Ltd. The mice were fed a high-fat diet (HFD) (Wuxi Fanbo Biotechnology Co., Ltd., FB-D12492, 60% fat) for about 8 weeks, and their body weight increased from ≈18 g to ≈35 g.

[0077] 10. Sonodynamic properties and anti-obesity performance at the cellular level

[0078] To verify the sonodynamic properties at the cellular level, 3T3-L1 preadipocytes were induced to differentiate into mature adipocytes according to the previous method. The mature adipocytes were divided into six groups: control, US (1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min), aUCP1 (according to the manufacturer's instructions, 10 μg·mL -1 mixed with Lipofectamine 2000), MP / aUCP1 (50 μg·mL -1 ), MP+US (MP, 40 μg·mL -1 ; US, 1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min), and MP / aUCP1+US (MP / aUCP1, 50 μg mL -1 ; US, 1.0 MHz, 1.5 W cm -2, 50% duty cycle, 5 min). After 12 h, DCFH-DA probe and FCM analysis were used to measure ROS levels. In addition, after loading the DCFH-DA probe, CLSM was used to observe the generation of ROS. Image J software was used to quantify the ROS-positive area. The content of cell markers was quantified by a colorimetric analysis kit. On the other hand, the cell viability of 3T3-L1 preadipocytes and mature adipocytes was determined by a standard CCK-8 assay, and apoptosis was identified by flow cytometry after annexin V-FITC / propidium iodide staining.

[0079] 11. Analysis of cell uptake and lysosomal escape

[0080] P / aUCP1-FITC, aUCP1-FITC, and MP / aUCP1-FITC were generated by FITC modification of P / aUCP1, aUCP1 (mixed with Lipofectamine 2000), and MP / aUCP1, respectively. The induced differentiated mature adipocytes were divided into four groups: P / aUCP1-FITC (18 μg mL -1 ), aUCP1-FITC (10 μg mL -1 ), MP / aUCP1-FITC (50 μg mL -1 ), and MP / aUCP1-FITC + US (MP / aUCP1, 50 μg mL -1 ; US: 1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min). After 4 h, the cell nuclei were stained with DAPI, and the uptake of the materials was observed using a confocal laser microscope. To analyze lysosomal escape, after treating the cells for 4 h, the lysosomes / endosomes and cell nuclei were stained with a lysosomal red fluorescent probe and DAPI. Subsequently, the cells were washed three times with PBS, fixed with 4% paraformaldehyde, and observed under CLSM.

[0081] 12. Evaluation of gene transfection ability

[0082] P / aUCP1@EGFP, aUCP1@EGFP (mixed with Lipofectamine 2000), and MP / aUCP1@EGFP each containing an equal amount of pEGFP were co-incubated with 3T3-L1 preadipocytes and mature adipocytes, respectively. The cells were cultured for 6 h, then fresh DMEM medium was added, and co-cultured for another day. Subsequently, FCM and fluorescence microscopy were used to evaluate the transfection efficiency of the harvested cells.

[0083] 13. Preparation of microneedle patches

[0084] MN patches were fabricated using polydimethylsiloxane (PDMS) molds, with each needle cavity having a square base of 300 μm × 300 μm and tapering to a height of 800 μm. The MNs were arranged in a 12×12 array with a center-to-center spacing of 600 μm. To prepare the MN patches, 15 wt% HA was dissolved in PBS to prepare the HA solution. 100 μL of the HA solution was separately mixed with MP (80 μg), aUCP1 (20 μg mixed with Lipofectamine 2000), and MP / aUCP1 (100 μg), deposited in the needle cavities, and dried under vacuum for 20 minutes. Then, the needle chambers were filled with 100 μL of the HA solution, and the micro-molds were left standing at 25 °C overnight to form the MN patches. The morphology of the empty and drug-loaded MNs was observed using a scanning electron microscope. HA MN patches with 10%, 15%, or 20% by weight were prepared, and the mechanical strength of the MNs was measured using a tensile testing machine (WDW-10). The obtained nanosheets were as Figure 1 shown.

[0085] 14. Characterization of MN-MP / aUCP1 patches

[0086] MN patches containing different amounts of MP / aUCP1 were prepared and subjected to mechanical strength testing. To evaluate the transfection efficiency of the drug-loaded MN patches after US irradiation, different MNs were incubated with mature adipose tissue for 6 hours, followed by replacement with fresh DMEM medium and further culture for one day. Subsequently, flow cytometry (FCM) was used to evaluate the transfection efficiency of the collected cells. aUCP1-ICG and MP / Cy3 were used to prepare MN patches for fluorescence imaging. The aUCP1 solution was mixed with ICG and stirred at room temperature in the dark for 24 hours. After dialysis, aUCP1 labeled with ICG was obtained. MP and Cy3 were stirred in the dark for 24 hours and then centrifuged to obtain MP / Cy3. Fluorescence images of MN sections were taken by confocal laser scanning microscopy (CLSM). In vivo imaging of obese mice and fluorescence imaging of ex vivo organs and tissues were performed using an in vivo imaging system (IVIS) spectral imaging system (VISQUE Invivo Smart-LF).

[0087] 15. In vivo treatment of obesity with MN-MP / aUCP1 patches

[0088] Diet-induced obese mice were randomly divided into 6 groups, including a control group, an MN+US group, an MN-aUCP1 group, an MN-MP / aUCP1 group, an MN-MP+US group, and an MN-MP / aUCP1+US group. The abdominal hair of the mice was shaved and the mice were anesthetized. Different drug-loaded MN patches were inserted into the subcutaneous fat layer in the right inguinal region. After 15 minutes, a 1 cm 2 ultrasound probe was used at 1.0 MHz and 1.5 W cm -2The abdomen of the mice with the MN patch inserted was irradiated for 5 minutes at 50% duty cycle. Each mouse received 7 courses of treatment, once every 3 days. During the treatment period, the food intake and body weight of the mice were monitored every 3 days. At the end of the 21-day treatment, blood samples were collected from mice fasted for 12 hours by retro-orbital puncture, and serum was separated by centrifugation. Serum glucose and insulin levels were measured by detection kits, serum glucose (mmol L -1 )× serum insulin (mIU L -1 ) / 22.5 to calculate IRI. Subsequently, the mice were subjected to an oral glucose tolerance test. The mice were given glucose (2 g kg -1 ). Glucose concentration in tail vein blood was measured by glucose meter (Yuwell) at 0, 0.5 and 2 hours. Then, mice were sacrificed, blood samples were obtained for serum biochemical analysis, and major organs (heart, liver, spleen, lung and kidney) were collected for H&E staining. Liver sections were stained with Oil Red O to characterize the degree of lipid droplet infiltration.

[0089] Meanwhile, inguinal, perigonadal, and perirenal adipose tissues were isolated from each mouse, fixed, wrapped in paraffin, and cut into sections. The size of adipose tissues was observed by H&E staining. The stained sections were photographed by microscope. Apoptotic cells in adipose tissues of different parts were detected by TUNEL kit. IgWAT was immunofluorescently stained with anti-UCP1 antibody (1:100 dilution). Malondialdehyde content was determined by colorimetry. ROS, 4-HNE, and 8-OHdG levels were determined by corresponding ELISA kits. Quantitative analysis of fluorescent images was performed using image J software. Total RNA was extracted from IgWAT using TRIzol reagent (Invitrogen), and cDNA was synthesized using a reverse transcription system (Thermo Fisher). The relative gene expression of UCP1, PGC1-β, and PPARγ was evaluated by 7500 real-time PCR system (ABI Step oneplus, Applied Biosystems). In addition, UCP1, PGC1-β, PPARγ and PPARα levels were assessed based on Western blotting using anti-UCP1 antibody (CST, catalog number 72298), anti-PGC1-β antibody (Abcam, catalog number ab176328), anti-PPARγ antibody (Abcam, catalog number ab178860) and anti-PPARα antibody (Abcam, catalog number ab314112) (1:1000 dilution). TAG content was determined using a colorimetric assay kit. First-generation sequencing was performed using a 3730xl sequencer (Applied Biosystems), and sequencing results were interpreted using sequencing analysis 5.2.0 software.

[0090] 16. Monitoring the weight recovery after MN-MP / aUCP1 + US treatment

[0091] After 21 days of treatment with MN-MP / aUCP1 + US, the weight recovery of mice on HFD and within 15 days was monitored. The food intake of mice was recorded daily, and the body weight was measured on the 24th, 30th, and 36th days during this period.

[0092] 17. RNA sequencing

[0093] After 7 courses of treatment with MN-MP / aUCP1 + US, IgWAT was isolated from mice, and IgWAT from obese mice was used as a control. RNA of IgWAT was extracted using a universal RNA extraction kit (Magen Biotech Co., Ltd.). RNA sequencing was performed using the RNA Nano 6000 assay kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies).

[0094] Statistical analysis

[0095] All data are shown as mean ± SD. Statistical differences were calculated using unpaired Student's t-test by GraphPad Prism software (version 9.0.0) and represented as n.s., not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0096] Example 1: Preparation and characterization of MP / aUCP1 nanosheets

[0097] The morphology and size of MOF (Zn-TCPP) were observed using transmission electron microscopy (TEM), which was a layered structure with an average diameter of about 250 nm ( Figure 2 a of Figure 8 a). The TEM elemental mapping showed that zinc (Zn), carbon (C), nitrogen (N), and oxygen (O) elements were evenly distributed throughout the structure of the metal-organic framework (Zn-TCPP) structure ( Figure 2 a). To further verify the elemental composition and valence state of Zn-TCPP nanosheets, X-ray photoelectron spectroscopy (XPS) was performed. It was found that the main composition of the elements was consistent with the results observed in the drawing images ( Figure 2 b). In addition, Zn 2p showed two different peaks, confirming the existence of Zn valence states in Zn-TCPP nanosheets. The optical properties of Zn-TCPP nanosheets were examined using ultraviolet-visible (UV-vis) spectroscopy ( Figure 2c). Free TCPP shows the characteristic peak of the porphyrin ring at 425 nm, while the characteristic peak of the Zn-TCPP nanosheet shows a slight red shift (435 nm). The TCPP molecule in the free form shows in the range of 510 - 650 nm, while the Zn-TCPP nanosheet shows two Q bands at 558 nm and 595 nm respectively, indicating that the porphyrin ring is successfully metallized by Zn 2+ ions. The binding mode of the porphyrin with Zn atoms was further investigated by Fourier transform infrared spectroscopy (FT-IR) ( Figure 2 d). In the TCPP spectrum, the absence of the C=O stretching vibration peak at ≈1700 cm -1 means that the carboxyl group of the porphyrin has changed. In addition, in the spectrum of Zn-TCPP, two new peaks appear at ≈1600 and 1400 cm -1 , indicating that the carboxyl group in the TCPP ligand forms a Zn-O bond with the metal. In addition, the in-plane vibration of N-H disappears at 982 cm -1 and a new peak appears at 995 cm -1 , indicating that Zn-TCPP belongs to metal porphyrin.

[0098] By cloning the sgRNA targeting UCP1 and the vector stably expressing the encoded dCas9, the CRISPRa-UCP1 plasmid was constructed to edit the uncoupling protein gene. The fusion protein contains the viral protein 16 transcriptional activator (VP64), the NF-κB transactivation subunit p65, and the Epstein-Barr virus R transactivator (Rta) (the above three constitute VP64-p65-Rta) ( Figure 2 e). The results showed that the UCP1 expression in mature adipocytes transduced with CRISPRa-UCP1 was increased compared with the control group ( Figure 2 f). The binding affinity between mPEG-PEI modified MOF (MP) and aUCP1 was investigated by agarose gel electrophoresis assay ( Figure 2 g). As the amount of aUCP1 increased, the MP capacity became insufficient. To improve the transfection efficiency and protect the plasmid from nuclease degradation, MP was effectively bound to aUCP1 at a mass ratio of 4:1. TEM analysis showed an increase in the C, N, and O elements in MP / aUCP1, indicating the successful modification of mPEG-PEI. And the presence of phosphorus (P) element further confirmed the successful loading of aUCP1 in MP ( Figure 2 a and Figure 8 b). In addition, after mPEG-PEI modification, the electric potential changed from negative to positive ( Figure 2 h). Subsequently, aUCP1 was loaded using MP by electrostatic adsorption, and the final average electric potential of MP / aUCP1 was measured to be 3.39 mV ( Figure 2h). Dynamic light scattering (DLS) measurements showed that the loading of aUCP1 increased the average size of MPs from 257.1 nm to 288 nm ( Figure 8 c). As shown by X-ray diffraction (XRD), although mPEG-PEI and aUCP1 were loaded, the MP / aUCP1 nanosheets still maintained good crystallinity, indicating that the crystal structure was not significantly affected ( Figure 2 i). The above results indicated the successful co-loading of mPEG-PEI and aUCP1.

[0099] Example 2: Sonodynamic properties and in vitro anti-obesity performance of the MP / aUCP1 system

[0100] To further investigate the sonodynamic properties of the MP / aUCP1 nanosystem, ultraviolet-visible spectroscopy and electron spin resonance (ESR) spectroscopy were used to detect the production of ROS. As the ultrasonic stimulation time continued, the production of 1 O2 detected using DPBF as a probe increased significantly ( Figure 2 j and Figure 9 a), confirming that the nanosystem had the desired properties. However, there was no significant increase in 1 O2 in pure H2O after ultrasonic irradiation ( Figure 2 k and Figure 9 a). In addition, 2,2,6,6-tetramethylpiperidine (TEMP) was used to capture 1 O2. Compared with the US and MP / aUCP1 groups, the characteristic signal (1:1:1) of 1 O2 was identified in the MP / aUCP1 + US group ( Figure 2 l). Flow cytometry (FCM) analysis and confocal laser scanning microscopy (CLSM) were used to test the ability of the nanosystem to produce ROS in mature 3T3-L1 cells. As shown in Figure 3 a, b and Figure 9 b, the average levels of ROS in mature adipocytes in the MP + US group and the MP / aUCP1 + US group were 50.8% and 50.4% respectively, which were significantly higher than those in the control group. Similarly, the results obtained using the 2,7-dichlorofluorescein diacetate (DCFH-DA) probe from CLSM were consistent with the results from FCM analysis, confirming that MP / aUCP1 was able to produce significant intracellular ROS under US stimulation, which confirmed the efficient sonodynamic effect against obesity (Sonodynamic Therapy) ( Figure 3 c and Figure 9 c).

[0101] Then the anti-obesity effect was evaluated in vitro. As shown in Figure 9 d and Figure 3As shown in d, the results indicate that MP / aUCP1 has high biosafety, and even at relatively high concentrations, its cytotoxicity to 3T3-L1 preadipocytes and mature adipocytes is negligible. After incubation with MP / aUCP1, both 3T3-L1 preadipocytes and mature adipocytes showed sonication intensity-dependent therapeutic effects when exposed to US radiation ( Figure 9 in e and Figure 3 e). To further verify the therapeutic potential of the nanosystem, flow cytometry (FCM) was used to detect the viability of mature adipocytes after different treatments. Compared with other treatments, the MP / aUCP1 + US group showed a significantly higher apoptosis rate (43.5%) ( Figure 9 in f and Figure 3 f). Correspondingly, a killing effect was also observed in 3T3-L1 preadipocytes ( Figure 9 g). Meanwhile, the study evaluated the therapeutic effects of each treatment on triglyceride (TG) storage in adipocytes. The results showed that the intracellular TG in mature adipocytes co-incubated with MP / aUCP1 decreased significantly after US irradiation, indicating that MP / aUCP1 effectively inhibited lipid storage ( Figure 3 g).

[0102] Example 3: The MP / aUCP1 system has efficient lysosomal escape and gene editing capabilities in vitro. The cellular uptake ability of FITC-labeled MP / aUCP1 was investigated using confocal laser scanning microscopy (CLSM). The P / aUCP1 group (synthesized by aUCP1 encapsulated with mPEG-PEI) and the aUCP1 group (using commercially available Lipofectamine 2000 as a co-transfection reagent) were used as control groups. The results showed that mature adipocytes effectively internalized MP / aUCP1, and US enhanced the cellular accumulation of MP / aUCP1 ( Figure 10 a). Effective escape from lysosomes after endocytosis is crucial for gene editing. As Figure 10 shown in b, after incubation for 4 hours, the MP / aUCP1 nanosheets successfully avoided lysosomes, mainly due to the "proton sponge" effect induced by PEI in MP / aUCP1. Importantly, this endosomal escape effect was more obvious under US irradiation, confirming that US enhanced the genome editing potential of the MP / aUCP1 nanosystem.

[0103] Next, the transfection efficiency of MP / aUCP1 in cells was investigated after US irradiation. A plasmid encoding enhanced green fluorescent protein (pEGFP) was selected as the reporter gene, which has a similar size to the CRISPRa-UCP1 plasmid. FCM analysis showed that MP / aUCP1 transfected more than 50% of 3T3-L1 preadipocytes and mature adipocytes, and the transfection efficiency was about 3 times higher than that of P / aUCP1, comparable to Lipofectamine 2000 (aUCP1 group @ EGFP)( Figure 11 ). In addition, after US irradiation, the cell transfection rate exceeded 60%( Figure 11 ). Similarly, fluorescence microscopy confirmed consistent results( Figure 12 ). These results indicate that the MP / aUCP1 system significantly increases US-mediated plasmid transfection.

[0104] Example 4: Preparation and Characterization of MN-MP / aUCP1 Microneedle Patches

[0105] The MN patches were fabricated using the micro-molding method, in which a 15% w / v HA solution was mixed with the MP / aUCP1 solution and placed in a polydimethylsiloxane (PDMS) mold. Then the mold was subjected to vacuum treatment, after which the 15% w / v HA solution was placed into the micro-mold, dried at room temperature, and demolded( Figure 4 a). As shown in Figure 4 b and Figure 13 a, the MN patches had a size of 1 cm × 1 cm and an array of 12 mn × 12 mn. Each needle was molded into a pyramid shape with a base diameter of 300 μm and a height of 800 μm. The color of the MNs loaded with MP / aUCP1 was darker, while scanning electron microscope (SEM) images showed that loading the drug did not affect the successful synthesis of the MNs( Figure 4 c, d). The mechanical strength of the patches made from 10 wt%, 15 wt%, and 20 wt% HA solutions was determined using a tensile testing machine( Figure 4 e). The smooth continuous force-displacement curve indicated that no microneedles broke during compression. In addition, compared with the patches of 10 wt% HA, the 15 wt% MN patches showed excellent mechanical properties, which provided sufficient hardness to penetrate the skin, and the 10 wt% HA patches had a significantly higher minimum average force (0.058 N) required for skin penetration( Figure 4 e). Hematoxylin and eosin (H&E) staining clearly depicted the MNs penetrating through the epidermis into the dermis( Figure 4 f). The patch was applied to the skin of the inguinal region of obese mice, and after 15 minutes, the MNs were completely dissolved in the skin, and there was no obvious skin irritation or damage at the administration site( Figure 4 g). Compared with the skin tissue without patch treatment, no obvious inflammatory response was found in the area pressed by the patch.Figure 13 of b).

[0106] MN patches with different amounts of MP / aUCP1 were fabricated and tested. Increasing the MP / aUCP1 content from 50 μg to 200 μg led to a change in the hardness of the MNs ( Figure 13 of c). Interestingly, the MN patch with 100 μg MP / aUCP1 exhibited similar mechanical strength to the patch with 50 μg MP / aUCP1 and was able to smoothly penetrate the skin ( Figure 13 of c and Figure 13 of d). Therefore, the MN patch loaded with 100 μg MP / aUCP1 was selected for further study. FCM analysis showed that when using HA MN patches for drug delivery, the cell transfection rate increased slightly ( Figure 13 of e). Figure 4 h of shows the fluorescence images of representative MN patches containing MP / Cy3 and aUCP1-ICG, where the loaded MP nanosheets and CRISPRa system were evenly distributed inside the MNs. In addition, compared with the control group and the skin injected with MP / aUCP1, no obvious redness was observed in the MN-MP / aUCP1 treatment group after 1 day ( Figure 13 of f). The biodistribution and the ability to target WAT of the drug-loaded patches were monitored using an in vivo imaging system (IVIS) spectral imaging system. Apparently, in vivo fluorescence imaging confirmed that aUCP1 was preserved for one day without MN encapsulation, while the MP-encapsulated aUCP1 injection (InJ) was continuously visible subcutaneously in obese mice until the next day ( Figure 4 of i). Compared with the mice treated with MN-aUCP1, the mice treated with MN-MP / aUCP1 still had a relatively high fluorescence signal on the third day ( Figure 4 of i, j). Analysis of the ex vivo organ distribution within 3 days after treatment showed that relatively less fluorescence signal was retained in organs such as the liver, lung, and kidney in all groups. In contrast, the mice treated with MN administration showed higher signal intensity within the inguinal WAT (IgWAT) ( Figure 4 of k, l and Figure 13 of g-i). Taken together, these findings indicate that MN patches improve the long-term retention of MP / aUCP1 in tissues.

[0107] Example 5: In vivo weight loss treatment effect of MN-MP / aUCP1 patches

[0108] This example evaluated the potential of the drug-loaded patches to treat obesity in mice. To mimic obesity, male C57BL / 6J mice (6 - 8 weeks old, approximately 18 g) were fed a high-fat diet (HFD) for about 8 weeks until they reached a body weight of approximately 35 g ( Figure 5a). Considering the abundant WAT in the inguinal region of mice and its superficial location, MN patches were implanted into the IgWAT of mice for anti-obesity treatment. Mice were randomly assigned to six groups, and each group was treated as follows: I) control, II) MN+US, III) MN-aUCP1, IV) MN-MP / aUCP1, V) MN-MP+US, and VI) MN-MP / aUCP1+US. Anti-obesity treatment was divided into 7 courses. MN patches were used every 3 days, and then the inguinal region of mice was irradiated 15 minutes after MN patch injection ( Figure 5 a). During the 21-day weight loss treatment, food intake and body weight were monitored every three days. Although the high-fat diet intake of mice in each group was similar, the body weights of mice in the control group and the group treated only with US increased by 8.2±2.2% (from 34.6±1.0 to 37.4±0.8 g) and 8.3±1.6% (from 34.4±0.8 to 37.3±0.9 g), respectively. In contrast, the MN-MP / aUCP1+US group and the MN-MP+US group lost 18.3%±1.7% and 13.4%±3.2% of their body weight, respectively. Treatment with MN-MP / aUCP1 without US irradiation resulted in a 6.9%±2.1% reduction in mouse body weight, which was similar to that in the MN-aUCP1 group (a 8.3%±2.3% reduction in body weight)( Figure 5 b, c, and Figure 14 a). In addition, photos of mice taken at the end of the treatment demonstrated that mice in the MN-MP+US and MN-MP / aUCP1+US groups showed a reduction in body fat and a leaner body shape( Figure 5 d). Subsequently, the mice were sacrificed, and the IgWAT, PgWAT, and PrWAT were dissected to compare their sizes and masses. Compared with other groups, the subcutaneous and visceral WAT in the MN-MP / aUCP1+US group had smaller volumes and lower masses( Figure 5 e, f).

[0109] H&E staining of the isolated fat further showed that the MN-MP / aUCP1+US treatment regimen not only significantly reduced the adipocytes in IgWAT but also in PgWAT and PrWAT, indicating that this treatment is not limited to subcutaneous inguinal fat but causes systemic fat reduction( Figure 5 g, h). In addition, compared with the control group and the MN+US group, H&E staining showed a significant reduction in the fat content of the livers of mice using the ultrasound-gene therapy strategy( Figure 5 i), accompanied by a significant reduction in the size of the liver( Figure 14 b). Corresponding Oil Red O staining demonstrated the ability of the CRISPRa-UCP1 system to effectively reduce fatty liver complications. The addition of US radiation further enhanced the anti-obesity treatment effect( Figure 5i) of

[0110] In addition, the combination of MN-MP / aUCP1 and US was found to significantly improve obesity-related metabolic dysfunction in mice. Compared with the control group, mice treated with MN-MP / aUCP1+US had lower circulating glucose and insulin levels, resulting in significantly improved insulin resistance and glucose tolerance ( Figure 6 a-c of Figure 14 c). After treatment with MN-MP / aUCP1+US, plasma chemical analysis consistently showed a downward trend in TG and cholesterol levels, as well as an increase in free fatty acids (FFA) generated by lipolysis ( Figure 6 d-f). These findings indicate that this treatment strategy has the ability to comprehensively improve obesity symptoms.

[0111] In addition, the inventors evaluated the biosafety of this ultrasound-gene therapy strategy. The inventors' anti-obesity treatment regimen did not show any damage to the major organs ( Figure 15 ). The blood routine, cardiac function, and serum biochemical results of the mice also demonstrated that the treatment had no potential toxic side effects ( Figure 16 , Figure 17 ). The control group (control group and MN+US) showed an increased circulating amount of ALT and AST. In contrast, the levels of these enzymes in the other groups remained within the normal range, which may be attributed to the fatty liver symptoms in the control group. Sonodynamic oxidative damage may trigger a strong inflammatory response, further exacerbating liver and adipose tissue fibrosis caused by obesity. To evaluate the degree of damage, the inventors further measured the levels of serum and adipose inflammatory cytokines and evaluated the degree of fibrosis in the liver and adipose tissue. Fortunately, enzyme-linked immunosorbent assay (ELISA) tests of mouse serum and IgWAT showed that MN-M / aUCP1+US treatment did not stimulate the production of inflammatory cytokines such as IL-1β, IL-6, and TNF-α ( Figure 18 a-f). In addition, US irradiation did not result in a significant increase in the degree of fibrosis in the liver and adipose tissue ( Figure 6 g, h). Therefore, these data indicate that the ultrasound-gene therapy strategy of the present invention has high biosafety.

[0112] Example 6: Monitoring of weight recovery after MN-MP / aUCP1+US treatment

[0113] Weight maintenance after weight loss is a major challenge in the treatment of obesity. To verify the persistence and effectiveness of the US-regulated CRISPRa-UCP1 system for anti-obesity treatment, after seven courses of treatment, the high-fat intake and weight recovery of the mice were continuously monitored ( Figure 5a). During the 15-day monitoring period, mice in all groups consumed almost equal amounts of food. However, at the end of the observation period, compared with all other groups, mice in the MN-MP / aUCP1+US group showed the lowest weight gain ( Figure 6 i-k of Figure 18 g). In summary, the ultrasound-gene therapy strategy effectively reduced the body weight of obese mice and significantly inhibited weight rebound.

[0114] Example 7: Changes in molecular levels of IgWAT after MN-MP / aUCP1+US treatment

[0115] To better evaluate the efficacy of MN-MP / aUCP1-mediated ultrasound-gene therapy, the inventors studied the role of the US-regulated genome editing system at the molecular level in obese mice. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) showed that compared with MN-MP+US, apoptotic cells in IgWAT, PgWAT, and PrWAT of mice treated with MN-MP / aUCP1+US increased significantly, with the most significant effect in IgWAT ( Figure 7 a of Figure 19 a). This indicates that apoptosis of adipocytes is largely due to oxidative stress induced by the sonodynamic reaction, which leads to the accumulation of ROS in the cytoplasm and organelles, damaging lipids, proteins, and DNA, and ultimately resulting in cell death. To prove this, the inventors detected the levels of fatty reactive oxygen species, lipid peroxidation products (malondialdehyde (MDA), 4-hydroxynonenal (4-HNE)), and DNA oxidation products (8-hydroxy-2'-deoxyguanosine (8-OHdG)). As expected, the ROS levels increased significantly in both the MN-MP+US group and the MN-MP / aUCP1+US group ( Figure 7 b of Figure 19 b). The levels of major oxidation products also increased, as shown in Figure 7 c-e, indicating oxidative stress in these two groups after US stimulation.

[0116] Immunofluorescence was used to confirm the overexpression of UCP1 in mouse adipose tissue after treatment with the CRISPRa system. In contrast to the control group, the expression of UCP1 increased in mouse IgWAT in the MN-aUCP1, MN-MP / aUCP1, and MN-MP / aUCP1+US groups ( Figure 7 f of Figure 19 c), which was also confirmed by equivalent detection at the mRNA and protein levels ( Figure 7g, h). Meanwhile, the results of qPCR and western blot analysis showed that the expression level of PGC1-β in IgWAT of the MN-MP / aUCP1+US group was significantly increased, and the expression level of PPARγ was decreased ( Figure 7 h-j). PGC1-β is considered a key regulator of mitochondrial metabolism, while PPARγ, as an index of adipogenesis, promotes adipogenesis and lipid synthesis. In addition, in the MN-MP / aUCP1+US group, IgWAT of PPARα, which is mainly found in brown / beige adipocytes, was also upregulated ( Figure 19 d). These findings indicate that MN-MP / aUCP1+US treatment not only induced the transformation of white adipocytes into brown-like adipocytes, but also counteracted obesity by inhibiting adipogenesis and enhancing metabolism. Consistent with expectations, ultrasound-gene therapy significantly reduced the fat TG content and increased the FFA level ( Figure 7 k and Figure 19 e). The results of Sanger sequencing showed that the ultrasound-gene editing system only led to the stable overexpression of the target gene, without gene insertion, deletion or mutation ( Figure 7 l). In summary, all the above results indicate that white adipocytes underwent apoptosis and were effectively transformed into brown-like adipocytes.

Claims

1. A microneedle raw material composition, characterized in that, It includes using mPEG-PEI to modify zinc-based porphyrin metal-organic framework MOF (Zn-TCPP), and this composition is named MP.

2. The raw material composition according to claim 1, wherein The mass ratio of mPEG to PEI is 1∶(0.5 - 5), preferably 1:2; and / or, the mass ratio of mPEG-PEI to the MOF is 1∶(2 - 10), preferably 1:

4.

3. The preparation method of the raw material composition according to claim 1 or 2, comprising: Adding the mixed solution of mPEG and PEI to the zinc-based porphyrin metal-organic framework MOF solution to obtain the MP.

4. A microneedle, characterized in that, The microneedles carry the raw material composition as described in claim 1 or 2; preferably, the microneedles also include 10 - 20 wt% of hyaluronic acid, such as 15 wt% of hyaluronic acid.

5. A method for preparing microneedles, comprising the following steps: (a) Mix the raw material composition as described in claim 1 or 2 with hyaluronic acid and deposit it in the microneedle cavity; (b) Continuously fill the microneedle cavity with hyaluronic acid solution to obtain the microneedles.

6. A microneedle patch, which comprises the microneedles and the patch as described in claim 4; preferably, the content of the microneedle raw material composition in each microneedle patch is 50 - 200 μg, preferably 80 μg.

7. An ultrasound dynamic system, which includes ultrasound, a platform formed by the raw material composition as described in claim 1 or 2 and / or the microneedle patch as described in claim 6, and uses the ultrasound to irradiate the raw material composition and / or the microneedle patch.

8. The sono-dynamic system according to claim 7, wherein, The ultrasound satisfies one or more of the following conditions: 1.0 - 3.0 MHz; 0.1 - 3.0 W / cm -2 For example, 1.5 W / cm -2 ; and / or, 10% - 50% duty cycle, such as 50% duty cycle; The ultrasound irradiation time is 3 - 15 min, such as 5 min.

9. The application of the raw material composition as described in claim 1 or 2, the microneedle raw material composition obtained by the preparation method as described in claim 3, the microneedles as described in claim 4, the microneedle patch obtained by the preparation method as described in claim 5, the microneedle patch as described in claim 6, or the ultrasound dynamic system as described in claim 7 or 8 in the preparation of drugs for treating obesity.

10. The application according to claim 9, characterized in that, The microneedle raw material composition, the microneedles or the microneedle patch have one or more of the following characteristics: I. Promote the drug to increase the ROS level in the white adipocytes of the subject; II. Promote the drug to increase the apoptosis of the white adipocytes of the subject; III. Promote the drug to reduce the triglyceride storage capacity of the white adipocytes of the subject; IV. Promote the drug to reduce the fat in the IgWAT, PgWAT and PrWAT of the subject; V. Promote the drug to improve the glucose tolerance and insulin resistance of the subject.

Images