Specific primer for identifying vibrio parahaemolyticus KUT2 type strain and fluorescent PCR (polymerase chain reaction) detection method

Abstract

The invention relates to the technical field of molecular diagnosis, and discloses a specific primer for identifying a vibrio parahaemolyticus KUT2 type strain and a fluorescent PCR (Polymerase Chain Reaction) detection method. The invention provides a primer KUT2-F / R and a TaqMan probe for identifying a vibrio parahaemolyticus KUT2 type strain, and establishes a fluorescent PCR (Polymerase Chain Reaction) method (TaqMan probe method). According to the method, the KUT type of the main vibrio parahaemolyticus epidemic in diarrhea patients in China can be quickly identified, a serotyping system of the vibrio parahaemolyticus is expanded, and a more accurate tool is provided for epidemiological investigation and traceability. Compared with the prior art, the kit has the advantages that the due level of a fluorescent PCR technology is achieved in the aspects of amplification efficiency, sensitivity and specificity, so that efficient and specific detection on the KUT strain is realized, whether the strain is the mainly popular KUT type in China or not can be judged within one hour, and the actual use detection requirement is fully met.

Description

Technical Field

[0001] The present invention relates to the field of molecular diagnostic techniques, and more particularly, to specific primers for identifying Vibrio parahaemolyticus serotype KUT2 strains and a fluorescence PCR detection method. Background Art

[0002] Vibrio parahaemolyticus ( Vibrio parahaemolyticus ) is a Gram-negative halophilic bacterium widely present in marine and estuarine environments and is one of the important foodborne pathogenic bacteria, mainly causing gastroenteritis in humans. Serotyping, as an important typing method, is of great significance in the epidemiological investigation of Vibrio parahaemolyticus. By identifying the O antigen (lipopolysaccharide) and K antigen (capsular polysaccharide) of the strains, different serotypes can be distinguished, thereby tracing the source and transmission route of the disease and identifying high-risk strains. To date, 13 O antigens and 71 K antigens have been identified. Certain serotypes, such as O3:K6 and its variants, have caused large-scale outbreaks worldwide.

[0003] K typing is an important part of the serotyping of Vibrio parahaemolyticus. However, some strains cannot be typed for K due to the lack of specific K antigens or the absence of K antigen expression, and are called K-type untypable (KUT) strains. There are significant differences in the prevalence of KUT strains in different regions. In the Black Sea region of Turkey, O4:KUT, O2:KUT, and O3:KUT have all been found, and there is trh - a dominant clone of positive strains. In Bangladesh, O1:KUT and O3:KUT are one of the dominant serotypes. In India, among the strains isolated from oysters, OUT:KUT and O1:KUT are common serotypes. In Thailand, studies on clinical samples and oyster isolates found that O3:K6 is the most common serotype, followed by OUT:KUT and O4:K9. From 2018 to 2022, in a certain northern region of China, the detection rate of Vibrio parahaemolyticus in diarrhea cases was 6.83%, and the O4:KUT serotype accounted for 10.34%. In the southeast coastal region of China, the prevalence of O4:KUT even exceeded that of O3:K6 in some years. These findings emphasize the importance of continuous monitoring of KUT strains in order to timely understand their epidemic trends and potential risks.

[0004] The pathogenicity of Vibrio parahaemolyticus is mainly related to the toxins it produces, such as thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH). Studies have shown that some KUT strains carry the coding genes of TDH and TRH, increasing their pathogenicity. Therefore, KUT strains still have important significance in clinical infections and epidemiological investigations.

[0005] Strains identified as KUT by serum agglutination are currently mainly differentiated and their phylogenetic relationships analyzed by molecular typing methods such as pulsed-field gel electrophoresis (PFGE) and multilocus variable number tandem repeat analysis (MLVA). Whole-genome sequences and multilocus sequence typing (MLST) data are also often used to construct phylogenetic trees to reveal the evolutionary status of KUT strains in the entire Vibrio parahaemolyticus population and analyze their phylogenetic relationships with other strains. During the monitoring of diarrhea pathogens, we found a group of KUT strains from diarrhea samples. Through whole-genome sequence analysis and construction of a maximum likelihood tree based on single nucleotide polymorphisms (sNPs) in non-repetitive and non-recombinant regions of the whole genome, it was found that these strains formed several independent branches with relatively large genetic distances. The two main branches were named KUT1 and KUT2. KUT1 strains are distributed in provinces such as Guangdong, Zhejiang, Shanghai, Jiangsu, Shandong, Beijing, and Liaoning, and KUT2 strains are distributed in provinces such as Guangdong, Zhejiang, Shanghai, Shandong, Beijing, and Liaoning. However, due to the lack of effective K antiserum, rapid identification of KUT strains remains difficult, and the development of efficient molecular identification techniques is particularly crucial. Summary of the Invention

[0006] The object of the present invention is to provide specific primers and a fluorescence PCR detection method for identifying Vibrio parahaemolyticus KUT2 strains.

[0007] To achieve the object of the present invention, in the first aspect, the present invention provides a specific primer for identifying Vibrio parahaemolyticus KUT2 strains, including: primer KUT2-F and KUT2-R for identifying Vibrio parahaemolyticus KUT2 strains; The primer sequences are as follows (5'-3'): KUT2-F: GGTTGTGTTACTGATGACCTTAA; KUT2-R: GGCTTAGATAAATTACTGACTCTATAATTG.

[0008] In the second aspect, the present invention provides a probe used in combination with the primer, wherein the probe used in combination with primer KUT2-F and KUT2-R is KUT1-P; The probe sequence is as follows (5'-3'): F-TCTACAATTCCTCCTGCCAACTTCATC-Q; Wherein, F is a fluorescent group and Q is a quenching group; Preferably, F is HEX and Q is BHQ1.

[0009] In the third aspect, the present invention provides a detection reagent or kit containing the primer and / or the probe.

[0010] Fourthly, the present invention provides a fluorescence PCR detection method (including for non-diagnostic purposes) for Vibrio parahaemolyticus KUT2 type strains, and uses the primers and probes, or a detection reagent or kit containing the primers and probes to perform fluorescence PCR detection on a sample to be tested.

[0011] Preferably, the PCR reaction system is: 2×PCR Premix 10 µL, primer mixture 0.4 µL, probe 0.4 µL, pure water 7.2 µL, DNA template 2 µL.

[0012] In the primer mixture, the concentrations of primers KUT2-F and KUT2-R are both 10 mM; The concentration of the probe is 10 mM.

[0013] The PCR reaction conditions are: 90-95°C for 30-120 s; 90-95°C for 5-30 s, 56-60°C for 10-60 s, 20-40 cycles; fluorescence signals are collected at the end of each cycle.

[0014] Preferably, the PCR reaction conditions are: 95°C for 1 min; 95°C for 10 s, 60°C for 30 s, 40 cycles; fluorescence signals are collected at 60°C.

[0015] Furthermore, based on the amplification results for determination, if Cq ≤ 35, it is determined as positive, that is, the sample to be tested contains Vibrio parahaemolyticus KUT2 type strains; if Cq > 35, it is determined as negative, that is, the sample to be tested does not contain Vibrio parahaemolyticus KUT2 type strains.

[0016] By virtue of the above technical solutions, the present invention has at least the following advantages and beneficial effects: The present invention can quickly identify the main KUT types of Vibrio parahaemolyticus prevalent in diarrheal patients in China, expand the serotyping system of Vibrio parahaemolyticus, and provide a more accurate tool for epidemiological investigation and traceability. The technology adopted by the present invention has reached the level that the fluorescence PCR technology should have in terms of amplification efficiency, sensitivity and specificity, and can fully meet the actual use detection requirements.

[0017] The present invention focuses on the KUT types with important public health significance, and provides technical support for diarrheal disease surveillance and traceability. The KUT2 type strains used to establish this method are all isolated from diarrheal patients in China and are widely distributed in China. The present invention is applied to diarrheal pathogen detection and traceability investigation, and can provide a key basis for early diagnosis, early warning and outbreak response, which helps to control the spread range of the corresponding infection and ensure the health and safety of the public.

[0018] The present invention uses the fluorescence PCR method (TaqMan probe method) to achieve efficient and specific detection of KUT2-type strains, and can determine whether the strain is the main prevalent KUT type in China within 1 hour. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the amplification curve and standard curve of the serial dilution of the genomic nucleic acid of the KUT1-type positive reference strain ICDC-VP1716 in the preferred embodiment of the present invention. Among them, the slope: -3.3876, amplification efficiency E = 10 -1 / slope -1: 97.33%.

[0020] Figure 2 It is the amplification curve and standard curve of the serial dilution of the genomic nucleic acid of the KUT2-type positive reference strain ICDC-VP1272 in the preferred embodiment of the present invention. Among them, the slope: -3.3028, amplification efficiency E = 10 -1 / slope -1: 100.80%. DETAILED DESCRIPTION OF THE INVENTION

[0021] Currently, through molecular typing and constructing phylogenetic trees, the genetic relationship of KUT strains can be identified and analyzed to a certain extent, and then higher-resolution detection can be achieved. However, these methods are usually more cumbersome and require high professional skills and experimental conditions.

[0022] Compared with fluorescence PCR, the sensitivity of ordinary PCR is lower, and its amplification products need to be detected by electrophoresis. This process is cumbersome and easily leads to pollution of the detection environment by the amplification products.

[0023] Fluorescence PCR is one of the most commonly used nucleic acid detection methods at present, with many advantages: high sensitivity, capable of detecting extremely low concentrations of nucleic acid; good specificity, accurately identifying target sequences; simple operation, saving time in detection; closed system reducing product diffusion and reducing the risk of pollution; intuitive results, presented as curves or numerical values, facilitating rapid interpretation. These characteristics make it widely used in many fields. The present invention uses the fluorescence PCR method for the detection of the main KUT-type specific genes of Vibrio parahaemolyticus, and can quickly identify related KUT strains.

[0024] The present invention adopts the following technical solutions: The present invention provides a fluorescence PCR method for the detection of Vibrio parahaemolyticus KUT type. Through whole-genome sequence analysis, we found that the KUT-type Vibrio parahaemolyticus prevalent in diarrhea patients in multiple provinces in China is mainly KUT1 and KUT2 types. By deeply analyzing the sequence of the K antigen gene cluster of the strains, specific genes that are conserved in KUT-type strains and have significant differences from other K-type strains are screened out. wzy(The target sequence for detecting KUT1 type strains is located at positions 16451 - 17770 bp of the sequence of NCBI accession number MT898055.1 ( Vibrio parahaemolyticus strain VP410 capsule biosythesis gene cluster,completesequence); the target sequence for detecting KUT2 type strains is located at positions 14957 - 16459 bp of the sequence of NCBI accession number MT898406.1 ( Vibrio parahaemolyticus strain VP412 capsule biosythesis genecluster, completesequence)). Based on this, primers (KUT1 - F / R, KUT2 - F / R) and probes (KUT1 - P, KUT2 - P) that can identify KUT type were designed, so as to achieve efficient and specific detection of KUT1 and KUT2 type strains by fluorescence PCR method.

[0025] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0026] Example 1 Development of specific primers for identifying Vibrio parahaemolyticus KUT1 and KUT2 type strains (1) Primer and probe design We designed 4 groups of primer - probes (Table 1 and Table 2) according to the wzy gene sequences of KUT1 and KUT2 type strains. Among them, the first and second groups of probes were labeled with Minor Groove Binder (MGB) at the 3' end, and the third and fourth groups of probes were labeled with quenching group BHQ1 at the 3' end. Using the serial dilution of the nucleic acid of the positive strain as the template, the amplification effects of the 4 groups of primer - probes were preliminarily verified. The results showed that for the two groups containing MGB - labeled probes, their amplification efficiencies were both in the range of 75% - 90%, and even when the annealing temperature was reduced to 56°C, the amplification efficiency could not reach more than 90%; for the two groups containing BHQ1 - labeled probes, the amplification efficiencies were both 90% - 110%, but there were differences in the fluorescence signal intensities at the plateau stage. According to the criteria of high fluorescence signal intensity, a typical "S" - shaped amplification curve, and an amplification efficiency in the range of 90% - 110%, finally, the third group of KUT1 (Table 3) and the fourth group of KUT2 (Table 4) primer pairs and probes were selected for strain detection.

[0027] Table 1 The sequences of 4 groups of primer - probes for KUT1 are as follows:

[0028] Table 2 The sequences of 4 primer-probe sets of KUT2 are as follows:

[0029] Table 3 The primer pairs and probes of KUT1 screened out

[0030] The length of the amplification product of KUT1-F / R is 102 bp.

[0031] Table 4 The primer pairs and probes of KUT2 screened out

[0032] The length of the amplification product of KUT2-F / R is 134 bp.

[0033] (2) Reaction system (Table 5) Table 5 Reaction system

[0034] (3) Amplification conditions 95°C for 1 min; 95°C for 10 s, 60°C for 30 s, cycle 40 times, and detect fluorescence at the annealing stage (60°C).

[0035] (4) Result interpretation When Cq ≤ 35, the test result is determined to be positive.

[0036] Example 2 Investigation of amplification efficiency Extract genomic nucleic acids from fresh cultures of the positive reference strains ICDC-VP1716 (KUT1 type, NPRC(S)01.0025, National Pathogen Microbial Resource Bank) and ICDC-VP1272 (KUT2 type, NPRC(S) 01.0019, National Pathogen Microbial Resource Bank) on ordinary nutrient agar, and perform 10-fold serial dilutions with deionized water. Take 10 -3 dilutions for digital PCR analysis, set 3 replicate wells for each reaction, and calculate the copy number concentration of the target gene fragment by taking the average value of the results of 3 wells. The results show that in the 10 -3 dilution, the concentration of the target gene fragment of ICDC-VP1272 is 7.71×10 4 copies / µL, and the concentration of the target gene fragment of ICDC-VP1716 is 2.35×10 4 copies / µL.

[0037] With 10 -1 ~10 -6Using the diluent as a template, each dilution was repeated in 3 wells, and fluorescence PCR detection was performed separately. Taking the logarithm of the copy number of the target gene fragment in each reaction as the abscissa and the cycle threshold (Ct value) of fluorescence PCR as the ordinate, a standard curve was established, and the amplification efficiency of the detection system was calculated according to the slope of the straight line. The results showed that the amplification efficiencies of the KUT1 and KUT2 detection systems were 97.33% and 100.80% respectively, meeting the general requirements for detection. The amplification curves and standard curves of KUT1 and KUT2 are shown respectively as Figure 1 and Figure 2 shown.

[0038] Example 3 Detection Limit Investigation The genomic nucleic acid of the positive reference strain was serially diluted 2-fold with a 10 -6 diluent. Using the solutions at 6 dilution ratios from 1:1 to 1:32 as templates, fluorescence PCR detection was performed. Each dilution was repeated in 8 wells, and the lowest concentration at which all 8 detections were positive was the lowest detection limit (LOD) of this reaction. As shown in Tables 6 and 7, the LOD of this method for KUT1-type strains was 11.78 copies / reaction, and the LOD for KUT2-type strains was 9.63 copies / reaction.

[0039] Table 6 Lowest Detection Limit (LOD) for Genomic Nucleic Acid Detection of Positive Reference Strain ICDC-VP1716

[0040] Ct: Cycle threshold of fluorescence PCR reaction.

[0041] Table 7 Lowest Detection Limit (LOD) for Genomic Nucleic Acid Detection of Positive Reference Strain ICDC-VP1272

[0042] Ct: Cycle threshold of fluorescence PCR reaction.

[0043] Example 4 Specificity Investigation To verify the specificity of the method, a total of 151 strains were selected for the experiment. These strains included: 10 Vibrio parahaemolyticus strains identified as KUT1 type based on genomic sequences, 9 Vibrio parahaemolyticus strains of KUT2 type, 99 Vibrio parahaemolyticus strains of other known serotypes, and 12 other pathogenic Vibrio strains (including 6 Vibrio cholerae strains, 2 Vibrio fluvialis strains and 2 Vibrio vulnificus strains, 1 Vibrio mimicus strain and 1 Vibrio alginolyticus strain). In addition, it also included 6 Salmonella strains (2 Salmonella typhi strains, 2 Salmonella typhimurium strains and 2 Salmonella enteritidis strains), 5 diarrheagenic Escherichia coli strains (1 enterohemorrhagic Escherichia coli strain, 1 enterotoxigenic Escherichia coli strain, 1 enteroinvasive Escherichia coli strain, 1 enteroaggregative Escherichia coli strain and 1 enteropathogenic Escherichia coli strain), 2 Shigella strains, 2 Plesiomonas shigelloides strains, 2 Clostridium perfringens strains, and 1 Citrobacter freundii strain, 1 Listeria monocytogenes strain, 1 Staphylococcus aureus strain, and 1 Edwardsiella tarda strain. The results showed that only Vibrio parahaemolyticus strains identified as KUT1 type or KUT2 type based on genomic sequences were positive in the corresponding tests, and other strains were all negative. This method showed 100% specificity.

[0044] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. Specific primers for identifying Vibrio parahaemolyticus strain KUT2, characterized in that, Comprising: Primers KUT2-F and KUT2-R for identifying Vibrio parahaemolyticus serotype KUT2 strains; The primer sequences are as follows (5'-3'): KUT2-F: GGTTGTGTTACTGATGACCTTAA KUT2-R: GGCTTAGATAAATTACTGACTCTATAATTG.

2. A probe used in combination with the primer according to claim 1, characterized in that, The probe used in conjunction with the primers KUT2-F and KUT2-R is KUT2-P; The probe sequence is as follows (5'-3'): F-TCTACAATTCCTCCTGCCAACTTCATC-Q; Wherein, F is a fluorescent group and Q is a quenching group.

3. The probe according to claim 2, wherein F is HEX and Q is BHQ1.

4. A detection reagent or kit containing the primers according to claim 1 and / or the probe according to claim 2 or 3.

5. Fluorescent PCR detection method for Vibrio parahaemolyticus KUT2 strain, characterized in that, Using the primers according to claim 1 and the probe according to claim 2 or 3, or using a detection reagent or kit containing the primers and the probe to perform fluorescence PCR detection on a sample to be tested; The method is for non-disease diagnosis purposes.

6. The method according to claim 5, characterized in that, The PCR reaction system is: 2×PCR Premix 10µL, primer mixture 0.4µL, probe 0.4µL, pure water 7.2µL, DNA template 2µL; In the primer mixture, the concentrations of primers KUT2-F and KUT2-R are both 10 mM; The concentration of the probe is 10 mM.

7. The method according to claim 6, characterized in that, The PCR reaction conditions are: 90~95°C for 30~120 s; 90~95°C for 5~30 s, 56~60°C for 10~60 s, for 20~40 cycles; fluorescence signals are collected at the end of each cycle.

8. The method according to any one of claims 4 to 7, characterized in that, Judgment is made according to the amplification results. If Cq ≤ 35, it is judged as positive, that is, the sample to be tested contains Vibrio parahaemolyticus serotype KUT2 strains; if Cq > 35, it is judged as negative, that is, the sample to be tested does not contain Vibrio parahaemolyticus serotype KUT2 strains.

Images