LAMP (loop-mediated isothermal amplification)-based visual biosensor for coagulase-negative staphylococcus

By constructing a visual biosensor of coagulase-negative Staphylococcus nucleic acid aptamer combined with LAMP, the problem of coagulase-negative Staphylococcus detection time and high culture negative rate in the prior art is solved, and a fast, low-cost and ultra-sensitive detection effect is achieved.

CN120424935APending Publication Date: 2025-08-05THE SECOND AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510561644.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

The prior art takes a long time to diagnose coagulase-negative staphylococci and has a high culture negative rate, making it difficult to achieve early, fast and accurate pathogen detection, which affects antibiotic selection and prognosis of patients with peritoneal dialysis.

Method used

A coagulase-negative Staphylococcus nucleic acid aptamer based on SELEX screening was constructed, and combined with LAMP visual biosensor, signal amplification was achieved through magnetic separation and LAMP amplification, and hydroxynaphthol blue color development was used for detection.

Benefits of technology

Fast, low-cost and ultra-sensitive detection of coagulase-negative staphylococci is achieved, with the detection range of 3×103~3×107CFU/mL, and the detection limit is as low as 318CFU/mL, which has good linear relationships and industrialization potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424935A_ABST
    Figure CN120424935A_ABST
Patent Text Reader

Abstract

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) visual biosensor for diagnosing coagulase negative staphylococcus. The LAMP visual biosensor comprises (1) a coagulase negative staphylococcus aptamer sequence; (2) optimizing reaction conditions of the coagulase negative staphylococcus aptamer molecular beacon fluorescent biosensor; and (3) detecting coagulase negative staphylococcus. And coupling the aptamer and the magnetic bead modified with the complementary chain through complementary base pairing to form a magnetic bead-complementary chain-aptamer compound. When the target exists, the aptamer identifies the target and dissociates from the complementary chain, and signal normalization is completed through magnetic separation. And performing amplification by using the magnetically separated supernatant as an LAMP template to realize signal amplification. In the LAMP amplification process, pyrophosphoric acid generated by decomposition of the dNTP is combined with Mg < 2 + >, and the concentration of Mg < 2 + > is reduced, so that hydroxynaphthol blue is triggered to develop, and visual output of signals is realized. The Ct value is generated based on LAMP amplification, and quantitative detection can be achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biosensors, in particular to a coagulase-negative staphylococcus visualization biosensor based on LAMP. Background Art

[0002] Coagulase-negative Staphylococci are the most common pathogens causing peritoneal dialysis-associated peritonitis (PD-associated peritonitis). PD-associated peritonitis is a common complication in peritoneal dialysis (PD) patients, occurring in over 40% of patients and a major cause of PD technical failure and peritoneal membrane failure. Currently, clinical diagnosis of the causative bacteria is generally performed through bacterial culture, but this is time-consuming and has a high negative culture rate. Therefore, early, rapid, and accurate identification of the pathogen is crucial for guiding antibiotic selection, avoiding the side effects of broad-spectrum antibiotics, and improving the prognosis of PD-associated peritonitis patients.

[0003] In 1990, aptamers were first screened in vitro by Ellington and Szostak using the systematic evolution of ligands by exponential enrichment (SELEX) method. Over the following three decades, a growing number of aptamers have been isolated, capable of binding to target molecules with both affinity and specificity. In terms of detection, aptamer biosensors have developed rapidly in recent years. They can generate output signals in a target-responsive manner, are stable, and are easy to transport and store. Loop-mediated isothermal amplification (LAMP) is a new nucleic acid amplification technology proposed by Notomi et al. in 2000. LAMP utilizes the strand-displacing Bst DNA polymerase and a primer set that specifically recognizes the target nucleic acid sequence. At a constant temperature, a dumbbell-shaped intermediate is formed, which then undergoes continuous extension and strand displacement to produce a single DNA strand with multiple repeats, thereby achieving in vitro amplification of the target gene. This allows for rapid amplification and detection of the target nucleic acid.

[0004] The present invention proposes a coagulase-negative staphylococcus nucleic acid aptamer obtained by SELEX screening, and successfully constructs a coagulase-negative staphylococcus LAMP visualization biosensor based on the aptamer, ultimately realizing rapid, low-cost, and ultrasensitive fluorescence detection of coagulase-negative staphylococci. Summary of the Invention

[0005] Based on this, the present invention proposes a coagulase-negative Staphylococcus nucleic acid aptamer and successfully constructs a coagulase-negative Staphylococcus LAMP visualization biosensor.

[0006] In one aspect, the present application provides a coagulase-negative staphylococcal nucleic acid aptamer.

[0007] The coagulase-negative staphylococcal nucleic acid aptamer sequence is: 5'-CTCTGGGTGTTCCCTCTGCTGCCCCGGTGT-3', as shown in SEQ ID NO: 1.

[0008] In another aspect, the present invention provides a coagulase-negative staphylococcus LAMP visual biosensor, characterized by: (1) a coagulase-negative staphylococcus nucleic acid aptamer sequence linked to a LAMP primer; (2) coagulase-negative staphylococcus detection;

[0009] The coagulase-negative staphylococcus LAMP visualization biosensor sequence is: 5'-TTTATATAATATATAAATCTGGATCGCATTCCGGTGTCCATATCGTCCCAGCCCCGTTACCACGCACCGCAGCCAAGCCGGAAACATCTTTTTATATATTATATAAA-3', as shown in SEQ ID NO: 2;

[0010] The signal reporter molecule of the coagulase-negative staphylococcus LAMP visualization biosensor is a hydroxynaphthol blue reagent;

[0011] The concentration of hydroxynaphthol blue in the solution of the coagulase-negative staphylococcus LAMP visual biosensor is 200 μM;

[0012] The detection of coagulase-negative staphylococci is based on the addition of coagulase-negative staphylococci, which dissociates the aptamer from the magnetic bead-complementary strand. The supernatant after magnetic separation is then used as a LAMP template for amplification to achieve signal amplification and output. Under specific amplification conditions, the Ct value exhibits a gradient change with the concentration of coagulase-negative staphylococci in the solution, thereby enabling the detection of coagulase-negative staphylococci.

[0013] The specific steps for establishing the standard curve are as follows: 20 μL of 1 μM aptamer was mixed with 18 nt cDNA (final concentration 50 nM), then placed in a PCR instrument for gradient cooling, and then incubated with 60 μL of 10 mg / mL streptavidin-modified magnetic beads to prepare the magnetic beads-complementary chain-aptamer complex. The complex was vortexed and mixed with different concentrations of coagulase-negative Staphylococcus aureus, the concentrations of coagulase-negative Staphylococcus aureus were 3×10 3 , 3×10 4 , 3×10 5 , 3×10 6 , 3×10 7CFU / mL, incubated at room temperature for 10 min, magnetically separated, and the supernatant was used as LAMP template for real-time fluorescence quantitative amplification. The standard curve was drawn with the Ct value as the vertical axis and the logarithm of the bacterial concentration as the horizontal axis. The results showed that the coagulase-negative Staphylococcus LAMP visual biosensor was 3×10 3 to 3×10 7 There was a good linear relationship between the concentration range of CFU / mL coagulase-negative staphylococci (R 2 =0.9972), the linear regression equation was Y=5.188X+42.04, and the detection limit was as low as 318 CFU / mL.

[0014] On the other hand, it relates to the application of the biosensor in the development of coagulase-negative staphylococcus detection methods or clinical detection.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. The present invention obtained a new coagulase-negative Staphylococcus nucleic acid aptamer through SELEX screening, which has good affinity and an affinity constant of 69.88nM;

[0017] 2. The two ends of the nucleic acid aptamer of the present invention are connected to the stem-loop LAMP primer to form a dumbbell-shaped structure, thereby achieving efficient LAMP amplification;

[0018] 3. The coagulase-negative staphylococcus LAMP visualization biosensor proposed in this invention is 3 ~3×10 7 There was a good linear relationship between the concentration range of CFU / mL coagulase-negative staphylococci (R 2 =0.9972), the linear regression equation was Y=5.188X+42.04, and the detection limit was as low as 318 CFU / mL;

[0019] 4. The coagulase-negative staphylococcus LAMP visualization biosensor proposed in the present invention can achieve rapid, low-cost, stable and ultra-sensitive detection of coagulase-negative staphylococci, and has certain versatility and industrialization potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The secondary structure of the coagulase-negative staphylococcal aptamer.

[0021] Figure 2 The figure shows the results of measuring the affinity constant of nucleic acid aptamer for coagulase-negative staphylococci by flow cytometry.

[0022] Figure 3 Schematic diagram of the coagulase-negative staphylococcal aptamer molecular beacon fluorescent biosensor.

[0023] Figure 4 Figure 1 shows the optimization results of the LAMP amplification system. A. Enzyme concentration optimization, B. Magnesium concentration optimization, C. Betaine concentration optimization, D. Primer concentration optimization, and E. Reaction temperature optimization.

[0024] Figure 5 Figure 3. Optimization of cDNA length for the coagulase-negative Staphylococcus aureus LAMP visual biosensor. A. Histogram of Ct values for LAMP amplification corresponding to cDNAs of varying lengths. B. Lane 1: Maker; Lanes 2-6: LAMP amplification products corresponding to cDNAs of varying lengths. C. Magnesium pyrophosphate precipitate generated by LAMP amplification causes increased turbidity in the system. D. Magnesium pyrophosphate generated by LAMP amplification causes the hydroxynaphthol blue solution to turn from purple to blue.

[0025] Figure 6 Figure 3. Optimization of cDNA concentration for the coagulase-negative Staphylococcus aureus LAMP visual biosensor. A. Histogram of Ct values for LAMP amplification corresponding to different cDNA concentrations. B. Lane 1: Maker; Lanes 2-6: LAMP amplification products corresponding to different cDNA concentrations. C. Magnesium pyrophosphate precipitate generated by LAMP amplification causes increased turbidity in the system. D. Magnesium pyrophosphate generated by LAMP amplification causes the hydroxynaphthol blue solution to turn from purple to blue.

[0026] Figure 7 Figure 3. Optimization of magnetic bead dosage for the coagulase-negative Staphylococcus LAMP visualization biosensor. A. Histogram of Ct values for LAMP amplification corresponding to different magnetic bead dosages. B. Middle lane 1: Maker; lanes 2-6: LAMP amplification products corresponding to different magnetic bead dosages. C. Magnesium pyrophosphate precipitate produced by LAMP amplification causes increased turbidity in the system. D. Magnesium pyrophosphate produced by LAMP amplification causes the hydroxynaphthol blue solution to turn from purple to blue.

[0027] Figure 8 Optimization of the target incubation time for the coagulase-negative Staphylococcus aureus LAMP visualization biosensor. A. Histogram of LAMP amplification Ct values corresponding to different incubation times. B. Middle lane 1: Maker; lanes 2-6: LAMP amplification products corresponding to different incubation times. C. Magnesium pyrophosphate precipitate produced by LAMP amplification causes increased turbidity in the system. D. Magnesium pyrophosphate produced by LAMP amplification causes the hydroxynaphthol blue solution to turn from purple to blue.

[0028] Figure 9 The standard curve of the coagulase-negative Staphylococcus LAMP visual biosensor. A. Standard curve based on Ct value, B. Gel electrophoresis results of LAMP amplification products, from left to right are 3×10 3 to 3×10 7CFU / mL, C. LAMP system with hydroxynaphthol blue solution added, from right to left are blank control, 3×10 3 to 3×10 7 CFU / mL. DETAILED DESCRIPTION

[0029] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0030] Example 1. SELEX screening of coagulase-negative staphylococcal aptamers

[0031] The nucleotide sequences involved in the present invention are shown in Table 1.

[0032] Table 1. Coagulase-negative Staphylococcus aptamer sequences

[0033]

[0034] The present invention provides a method for screening coagulase-negative staphylococcal nucleic acid aptamers, comprising the following steps:

[0035] (1) Random library preparation

[0036] The random sequence was placed in a 95°C metal bath for denaturation for 10 minutes, and then immediately placed in an ice bath for 10 minutes;

[0037] (2) Target incubation

[0038] Add target coagulase-negative Staphylococcus to the denatured library and incubate to form a single-stranded DNA-target complex;

[0039] (3) Sequence separation

[0040] First, remove the unadsorbed and weakly bound nucleic acid sequences by centrifugation and washing, and then heat at 95°C for 10 minutes to denature the bound sequences and separate them from the bacterial surface;

[0041] (4) PCR amplification

[0042] The single-stranded DNA bound to the target is used as a template for PCR amplification;

[0043] (5) Enzymatic digestion and purification

[0044] The amplified product of step (4) is digested with Lambda exonuclease to prepare single strands, and the secondary library is obtained by recovery and purification;

[0045] (6) Multiple rounds of screening

[0046] The screening library in step (1) is replaced by the secondary library obtained in step (5), and steps (1) to (5) are repeated for multiple rounds of screening;

[0047] (7) High-throughput sequencing

[0048] After the screening is completed, the latest secondary library is subjected to high-throughput sequencing analysis to obtain candidate coagulase-negative Staphylococcus aureus nucleic acid aptamers to be tested.

[0049] Example 2. Structure prediction and affinity determination of coagulase-negative staphylococcal aptamers

[0050] First, the structure of the coagulase-negative Staphylococcus aureus nucleic acid aptamer (shown in SEQ ID NO: 1) obtained by sequencing was predicted. The secondary structure of the aptamer was predicted using DNAfold WebServer. The results are as follows: Figure 1 shown.

[0051] Subsequently, the affinity of the coagulase-negative staphylococcal nucleic acid aptamer (shown in SEQ ID NO: 1) was verified using flow cytometry. The principle is that when coagulase-negative staphylococci are present in the system, the aptamer will specifically bind to the coagulase-negative staphylococci. After separating the unbound aptamer, the binding of the aptamer to the coagulase-negative staphylococci at different concentrations was measured using flow cytometry. The specific experimental steps are as follows:

[0052] The FAM-modified aptamer solution was gradiently diluted to 10 μM and 1 μM dilutions, denatured at 95°C for 5 minutes, and immediately placed in an ice box for 10 minutes. Different volumes of coagulase-negative staphylococcal solution and the same concentration volume were mixed in a brown EP tube to prepare suspensions with final aptamer concentrations of 10 nM, 50 nM, 100 nM, 200 nM, 400 nM, and 600 nM, respectively. After incubation at low temperature in the dark on a shaker at 200 rpm for 45 minutes, the fluorescence value of each sample was measured using a flow cytometer, and the curve was plotted using Graphpad Prism 10 and K was analyzed. d The values are fitted.

[0053] like Figure 2 As shown, the screened coagulase-negative Staphylococcus aureus aptamer (shown in SEQ ID NO: 1) has good affinity for the target, and the average fluorescence value increases with increasing aptamer concentration. Nonlinear fitting of the flow cytometry results revealed that the affinity constant of the coagulase-negative Staphylococcus aureus aptamer (shown in SEQ ID NO: 1) is 69.88 nM.

[0054] Example 3. Optimization of coagulase-negative staphylococcal LAMP visualization biosensor

[0055] During the LAMP amplification process, Mg 2+ The concentration is reduced, and the hydroxynaphthol blue colorimetric reagent is introduced to realize the output of the signal. The specific detection principle is: through base complementary pairing, the aptamer is coupled with the magnetic beads modified with the complementary chain to form a magnetic bead-complementary chain-aptamer complex. When coagulase-negative staphylococci are present, the aptamer will specifically recognize the target, thereby dissociating from the complementary chain, and the aptamer sequence is separated by magnetic separation to complete signal normalization. The supernatant after magnetic separation is used as a LAMP template for amplification to achieve signal amplification. During the LAMP amplification process, the pyrophosphate produced by the decomposition of dNTP will react with Mg 2+ Binding, reducing Mg 2+ The concentration triggers the color development of hydroxynaphthol blue to achieve visual output of the signal ( Figure 3 ).

[0056] The conditions in the LAMP reaction system were optimized, and the results were as follows Figure 4 As shown, the second pair of primers has better amplification efficiency, and the optimal enzyme concentration in the LAMP reaction system is 0.40U / μL, the optimal magnesium concentration is 4mM, the optimal enzyme concentration is 0.2M, the optimal primer concentration is 1.0μM, and the optimal reaction temperature is 62℃. The various conditions in the sensor were optimized. When the complementary chain length is 18nt ( Figure 5 ), the complementary chain concentration is 50nM ( Figure 6 ), the magnetic bead dosage is 60 μL ( Figure 7 ), incubation time was 10 min ( Figure 8 ) when the Ct value is the lowest and the amplification effect is the best.

[0057] Example 4. Sensitivity evaluation of coagulase-negative staphylococcal LAMP visual biosensor

[0058] A coagulase-negative staphylococcus nucleic acid aptamer (as shown in SEQ ID NO: 2) connected to a LAMP primer was used to detect coagulase-negative staphylococci of known concentrations, and a standard curve was prepared based on the change in Ct value. 20 μL of 1 μM aptamer was mixed with 18 nt cDNA (final concentration 50 nM), then placed in a PCR instrument for gradient cooling, and then incubated with 60 μL of 10 mg / mL streptavidin-modified magnetic beads to prepare a magnetic bead-complementary chain-aptamer complex. The aptamer was vortexed and mixed with different concentration gradients of coagulase-negative staphylococci. The concentrations of coagulase-negative staphylococci were 3×10 3 , 3×10 4 , 3×10 5 , 3×10 6 , 3×107 CFU / mL, incubated at room temperature for 10 min, magnetically separated, and the supernatant was used as the LAMP template for real-time fluorescence quantitative amplification. A standard curve was drawn with the Ct value as the vertical axis and the logarithm of the bacterial concentration as the horizontal axis.

[0059] like Figure 9 As shown, the coagulase-negative Staphylococcus LAMP visualization biosensor was used at 3×10 3 ~3×10 7 Within the concentration range of coagulase-negative staphylococci CFU / mL, the Ct value decreased with the increase of coagulase-negative staphylococci concentration, showing a good detection trend. In addition, the coagulase-negative staphylococci LAMP visualization biosensor was 3 ~3×10 7 There was a good linear relationship between the concentration range of CFU / mL coagulase-negative staphylococci (R 2 =0.9972), the linear regression equation was Y=5.188X+42.04, and the detection limit was as low as 318 CFU / mL.

Claims

1. A coagulase-negative staphylococcal nucleic acid aptamer, characterized in that: The nucleic acid aptamer sequence is: 5'-CATATCGTCCCAGCCCCGTTACCACGCACC-3', as shown in SEQ ID NO:

1.

2. Use of the aptamer sequence according to claim 1 in the development of a method for detecting coagulase-negative Staphylococci.

3. Use of the aptamer sequence according to claim 1 in a coagulase-negative staphylococcus detection kit.

4. A coagulase-negative staphylococcus LAMP visual biosensor, characterized in that: The biosensor comprises: (1) a coagulase-negative staphylococcus nucleic acid aptamer sequence linked to a LAMP primer; (2) detection of coagulase-negative staphylococci; The coagulase-negative staphylococcus LAMP visualization biosensor sequence is: 5'-TTTATATAATATATAAATCTGGATCGCATTCCGGTGTCCATATCGTCCCAGCCCCG TTACCACGCACCGCAGCCAAGCCGGAAACATCTTTTTATATATTATATAAA-3', as shown in SEQ ID NO:

2.

5. The coagulase-negative staphylococcus LAMP visualization biosensor according to claim 4, characterized in that: The primer contains a stem-loop structure, and the adaptor after connecting with the primer has a dumbbell-shaped structure.

6. The coagulase-negative staphylococcus LAMP visualization biosensor according to claim 4, characterized in that: The signal reporting molecule of the biosensor is hydroxynaphthol blue.

7. The coagulase-negative staphylococcus LAMP visualization biosensor according to claim 4, characterized in that: The concentration of hydroxynaphthol blue in the solution of the biosensor is 200 μM.

8. The method for quantitatively detecting coagulase-negative staphylococci using the coagulase-negative staphylococci LAMP visualization biosensor according to claims 4 to 7, characterized in that: Establishment of standard curve: The aptamer was mixed with cDNA and then placed in a PCR instrument for gradient cooling. The mixture was then incubated with streptavidin-modified magnetic beads to prepare a magnetic bead-complementary chain-aptamer complex. The complex was vortex-mixed with bacterial solutions of different concentration gradients. After incubation at room temperature, the complex was magnetically separated and the supernatant was used as a LAMP template for real-time fluorescence quantitative amplification. A standard curve was drawn with the Ct value as the vertical axis and the logarithm of the bacterial solution concentration as the horizontal axis.

9. Use of the biosensor according to any one of claims 4 to 7 or the method according to claim 8 in the development of a coagulase-negative staphylococcus detection method or clinical detection.

10. Use of the biosensor according to any one of claims 4 to 7 or the method according to claim 8 in the development of a clinical detection kit for coagulase-negative Staphylococcus.