Common bacteroides and application thereof

Abstract

The invention provides common bacteroides and application thereof. Specifically, a strain of common bacteroides capable of producing 3-indolepropionic acid is separated from human feces for the first time, and the strain of common bacteroides is preserved in the China General Microbiological Culture Collection Center (CGMCC) on April 25, 2025, and the preservation number is CGMCC NO.46398. The strain of common bacteroides can be used for producing 3-indolepropionic acid, and the strain of common bacteroides can be used for producing 3-indolepropionic acid. Furthermore, the invention provides an application of the common bacteroides disclosed by the invention in production of 3-indolepropionic acid. Furthermore, the invention provides a method for producing the 3-indolepropionic acid by using the common bacteroides disclosed by the invention, and an application of the common bacteroides disclosed by the invention in increasing the content of the 3-indolepropionic acid in an organism.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to a novel Bacteroides vulgaris and uses thereof. Background Art

[0002] Bacteroides plebeius exists in the human intestinal flora. There is relatively little research on its function at home and abroad. It has only been found that it can degrade complex polysaccharides in seaweed. There are currently no reports on in vivo experiments on its application.

[0003] 3-Indolepropionic acid (3-IPA), a metabolite of gut microbes, has garnered widespread attention in recent years. Studies have shown that elevated levels of 3-IPA are associated with improved insulin sensitivity, blood-brain barrier maintenance, improved renal function, maintenance of intestinal barrier function, and antioxidant and anti-inflammatory effects, making it a potential health-promoting factor. As the primary source of 3-IPA in the body, changes in the species and abundance of gut microbes directly influence 3-IPA production and bioactivity. Therefore, screening for human gut microbial strains capable of producing 3-IPA could not only increase 3-IPA production but also provide a richer and more effective microbial resource for the treatment of various diseases. Furthermore, biological production of 3-IPA is more environmentally friendly, while 3-IPA produced directly from human gut microbes has improved biocompatibility and potential for application. Summary of the Invention

[0004] Based on the existing technology, one object of the present invention is to provide a 3-IPA-producing human intestinal strain, Bacteroides vulgaris J2525, deposited at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 46398. This strain is a Gram-negative bacterium isolated and purified from human feces. It is an anaerobic bacterium that lives in the human intestine and exhibits advantages such as rapid reproduction (the strain can achieve exponential growth from OD value of 0.15 to 1.1 within 8 hours), metabolic stability (capable of producing 3-IPA both in vitro and in vivo), and high 3-IPA production (compared to other Bacteroides and Escherichia coli). 3-IPA is a metabolite of intestinal microorganisms that has various health-promoting effects, including improving glucose metabolism, anti-inflammatory, and antioxidant properties. The present invention also provides the use of Bacteroides vulgaris in the production of 3-IPA.

[0005] In this regard, the present invention includes but is not limited to the following: In one aspect, the present invention provides a Bacteroides vulgaris, characterized in that it was deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms on April 25, 2025, with a deposit number of CGMCC NO. 46398.

[0006] In another aspect, the present invention provides use of the Bacteroides vulgaris of the present invention in producing 3-indolepropionic acid.

[0007] In yet another aspect, the present invention provides a method for producing 3-indolepropionic acid, comprising: (1) anaerobically culturing the Bacteroides vulgaris of the present invention under suitable conditions; and (2) Isolate and purify 3-indolepropionic acid from the culture supernatant.

[0008] In one aspect, the culture medium used in step (1) of the method of the present invention is selected from brain heart infusion culture medium. Preferably, the formula of the brain heart infusion culture medium is: 10.0 g / L peptone, 12.5 g / L dehydrated calf brain extract powder, 5.0 g / L dehydrated buffalo heart extract powder, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, and pH value 7.4 ± 0.2.

[0009] In one aspect, hemin is further added to the culture medium of the present invention.

[0010] In one aspect, the gas conditions for culturing in step (1) of the method of the present invention are 90% nitrogen, 5% carbon dioxide and 5% hydrogen.

[0011] In one aspect, the culture temperature in step (1) of the method of the present invention is 35-37°C.

[0012] In one aspect, the culture temperature in step (1) of the method of the present invention is 35°C, 36°C or 37°C.

[0013] In one aspect, the culture temperature in step (1) of the method of the present invention is 37°C.

[0014] In another aspect, the present invention provides use of the Bacteroides vulgaris of the present invention in increasing the content of 3-indolepropionic acid in an organism.

[0015] In another aspect, the present invention provides use of the Bacteroides vulgaris of the present invention in the preparation of a medicament / preparation for increasing the content of 3-indolepropionic acid in a body.

[0016] Beneficial technical effects: The present invention isolated for the first time the human intestinal strain Bacteroides vulgaris with the ability to produce 3-IPA, and systematically verified its functional characteristics through single-bacteria in vitro fermentation experiments and in vivo intervention studies in mice. This discovery has significant innovation and practicality, which is mainly reflected in the following aspects: First, the new 3-IPA-producing Bacteroides vulgaris strain isolated by the present invention can provide a stable and efficient biological source for the large-scale production of 3-IPA. Compared with traditional chemical synthesis methods, biosynthesis has the advantages of less environmental pollution and strong sustainability. By optimizing the culture conditions, the output of 3-IPA can be significantly increased to meet the growing demand for 3-IPA in the fields of medicine, agriculture, etc. In addition, the Bacteroides vulgaris of the present invention can increase the concentration of 3-IPA in the body's blood, and may be developed as a probiotic with a good hypoglycemic effect, so that the strain can be applied clinically. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Shown is the growth curve of Bacteroides vulgaris J2525.

[0018] Figure 2 It showed that Bacteroides vulgaris J2525 cultured in vitro could produce 3-IPA.

[0019] Figure 3 It showed that Bacteroides vulgaris J2525 cultured in vitro could produce 3-IPA.

[0020] Figure 4 It showed that oral administration of Bacteroides vulgaris J2525 could significantly increase the content of 3-IPA in mouse serum. DETAILED DESCRIPTION

[0021] Example 1 In vitro fermentation experiment of Bacteroides vulgaris Experimental methods: 1. Screening, Identification, and Preservation of Bacteroides vulgaris J2525 1.1 Sample Source The strain used in the present invention is isolated from the feces of healthy adult males in Hangzhou.

[0022] 1.2 Isolation and purification of strains Take about 2g of fresh fecal sample and collect it with a sterile tube, and send it to the laboratory immediately for strain isolation. Take 1g of sample and put it into 9mL of brain heart infusion (h-BHI) liquid culture medium supplemented with hemin, vortex mix it and enrich it under anaerobic conditions at 37℃ for 24h; then take 1mL of enrichment liquid in a clean bench and make ten-fold gradient dilution with sterile saline, and select 10 -6 , 10 -7 , 10 -8Prepare three dilution gradients, with 100 μL of each dilution spread on h-BHI agar. Incubate at 37°C for 24–48 hours. After incubation, select a plate containing 50–150 colonies. Select a representative colony and purify it again on h-BHI agar. Then, select a single colony and amplify it on h-BHI agar. The amplified culture is then frozen (in 50% glycerol) and used for 16S rDNA sequencing.

[0023] 1.3 16S rDNA identification The genomic DNA of the bacterial solution was extracted using the TIANamp bacterial genomic DNA extraction kit. The extracted genomic DNA was used as a template for PCR amplification, and a 16S rDNA PCR experiment was performed using bacterial universal primers 27F and 1492R. After the PCR reaction was completed, the PCR product was taken for agarose gel detection and photography. The amplified fragment length was approximately 1.4 kbp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The result is shown in SEQ ID NO: 1. A BLAST sequence alignment was performed on the NCBI website. The results showed that the sequence had more than 99% homology with the identified 16S rDNA sequence of Bacteroides vulgaris, confirming that the screened strain was Bacteroides vulgaris.

[0024] The strain Bacteroides plebeius J2525 of the present invention is deposited under the name Bacteroides plebeius, and the deposited unit is the General Microbiology Center of China Culture Collection Administration Committee of Microorganisms, the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is CGMCC NO. 46398, and the deposit date is April 25, 2025.

[0025] In the present invention, the preparation method of the bacterial solution of Bacteroides vulgaris J2525 is as follows: the Bacteroides vulgaris J2525 stored in the glycerol tube is first activated by streaking on the h-BHI agar medium plate for 2 to 3 times, and then a single colony is picked and expanded in the h-BHI liquid medium at 37°C for 24-36 hours until the concentration of the bacterial solution reaches 10 9 ~10 10 CFU / mL, as a bacterial suspension. In actual use, the concentration can be adjusted using conventional methods.

[0026] The above strain isolation and culture were carried out at 37°C in an anaerobic incubator with a gas atmosphere of 90% nitrogen, 5% carbon dioxide, and 5% hydrogen. Under these conditions, Bacteroides vulgaris can achieve rapid exponential growth from an OD value of 0.15 to 1.1 within 8 hours (see Figure 1The detailed recipe for h-BHI medium is as follows: peptone 10.0 g; dehydrated calf brain extract powder 12.5 g; dehydrated ox heart extract powder 5.0 g; sodium chloride 5.0 g; glucose 2.0 g; sodium hydrogen phosphate 2.5 g. Adjust the pH to 7.4 ± 0.2, make up to 1 L, and sterilize by autoclaving at 121°C for 15 minutes.

[0027] Bacteroides vulgaris ( Bacteroides plebeius ) strain J2525 was isolated from a human fecal sample, and 16s rRNA sequencing was performed, and the result is shown in SEQ ID NO: 1.

[0028] >BP.16S-27FSEQ ID NO: 1: CTCGGCTTACCATGCAGTCGAGGGGCAGCGGGATTGAAGCTTGCTTCAATTGCCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCGTACACTCAGGGATAGCCTTTCGAAAGAAAGATTAATACCTGATGGTATGATGAGATTGCATGATAGCATCATTAAAGATTTATCGGTGTACGATGGGGATGCGTTCCATTAGGTAGTAGGCGGGGTAACGGCCCACCTAGCCTACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGTCCTACGGATTGTAAACTTCTTTTATAAGGGAATAAAACCTCCCACGTGTGGGAGCTTGTATGTACCTTATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTGCGGTTGAGGTGTGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCACACTAAGCCGTAACTGACGTTCATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACGGTAAACGATGGATACTCGCTGTTGGCGATATACAGTCAGCGGCTTAGCGAAAGCGTTAAGTATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAAAGGAATGATCTGGAAACAGGTCAGTC。

[0029] 2. In vitro transformation experiments of Bacteroides vulgaris To verify the ability of Bacteroides vulgaris to produce 3-IPA (3-IPA), we conducted an in vitro conversion experiment. The experimental design included three treatment groups (4 replicates each): (1) BHI medium as the control group (CON); (2) BHI medium supplemented with Bacteroides vulgaris; (3) BHI medium supplemented with Escherichia coli ( Escherichia coli ) served as a negative control. All incubations were performed under anaerobic conditions at 37°C for 72 hours. After treatment, the supernatant was collected by centrifugation and analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS). Metabolite identification was achieved by comparing the precise molecular weight and retention time with the 3-IPA standard. Quantification was performed using multiple reaction monitoring mode, using the transition m / z 188 → 59. For mass spectrometry results, see Figure 2 .

[0030] 3. Detection of 3-IPA in the culture supernatant This analysis was performed using an ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) system consisting of an Agilent 1290 Infinity II ultra-performance liquid chromatograph coupled to an Agilent 6545 Q-TOF / MS mass spectrometer (Agilent). Chromatographic separation was achieved using an ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 μm). The mobile phase consisted of: phase A: 10 mM formic acid in water; phase B: methanol. The flow rate was set at 0.30 mL / min, and the elution program was as follows: initial 20% phase B for 1 minute; linear gradient to 95% phase B over 6 minutes; maintain 95% phase B for 2 minutes; linear gradient to 20% phase B over 0.5 minutes; equilibration at 20% phase B for 1.5 minutes. The injection volume was 2 μL. Mass spectrometric data were acquired in electrospray ionization negative (ESI-) mode with a mass scan range of 200–1200 m / z. Key mass spectrometry parameters were as follows: sheath gas temperature: 300°C; sheath gas flow rate: 11 L / min; VCap voltage: 3500 V; capillary current: 0.09 mA; nozzle voltage: 0 V; drying gas temperature: 275°C; fragmentor voltage: 150 V; and deflector voltage: 65 V. Raw data were processed using Profinder 10.0 software (Agilent Technologies) for peak detection, peak alignment, and peak area integration.

[0031] 4. Experimental Results Depend on Figure 2 The mass spectrometry results show that the precise molecular weight and retention time of 3-IPA in the sample are consistent with those of the standard, and the detection method is reliable, indicating that the Bacteroides vulgaris J2525 of the present invention can produce 3-IPA in the in vitro fermentation experiment.

[0032] Depend on Figure 3 As shown in the in vitro fermentation experiments, the Bacteroides vulgaris J2525 strain of the present invention was able to produce 3-IPA, significantly increasing the 3-IPA concentration in the culture supernatant. However, Escherichia coli lacked the ability to produce 3-IPA. This suggests that 3-IPA production is a unique function of Bacteroides vulgaris.

[0033] Example 2 In vivo intervention experiment of Bacteroides vulgaris J2525 1. Experimental Design Thirty-two healthy, eight-week-old male C57BL / 6 mice of similar weight were randomly divided into four groups: a blank control group (8 mice), an Escherichia coli-treated group (8 mice), a Bacteroides monocytogenes-treated group (8 mice), and a Bacteroides vulgaris J2525-treated group (8 mice). All mice were housed in a standard SPF environment with a temperature of 20-24°C, a relative humidity of 40%-60%, a 12-hour day-night cycle, and a normal diet and water supply.

[0034] 2. Bacterial colonization test Escherichia coli, Bacteroides monocytogenes intervention group and Bacteroides vulgaris J2525 were all isolated from the feces of healthy people. The experiment set up 4 groups: (1) Normal group (blank control, CON, n = 8 / group): basal diet + 100 μL normal saline gavage for 1 week; (2) Bacteroides vulgaris J2525 intervention group (n = 8 / group): basal diet + 100 μL Bacteroides vulgaris gavage for 1 week; (3) Escherichia coli intervention group (negative control group 1, n = 8 / group): basal feed + 100 μL Escherichia coli gavage for 1 week; (4) Bacteroides monocytogenes intervention group (negative control group 2, n = 8 / group): basal feed + 100 μL Bacteroides monocytogenes gavage for 1 week; Each group of 8 mice underwent a one-week bacterial colonization experiment. The mice were gavaged once a day with a volume of 100 μL and a bacterial load of 10 8 CFU / day. After the experiment, mice were anesthetized with isoflurane and blood was collected from the heart. The collected blood was immediately and gently pipetted into a standard EP tube. The tube was allowed to stand at room temperature before being centrifuged at 1000g for 10 minutes at 4°C. After separation, the upper layer of pale yellow transparent liquid was removed and the serum was carefully pipetted and transferred to a pre-labeled sterile cryovial. The tube was then stored in a -80°C freezer until testing.

[0035] 3. Experimental Results The 3-IPA concentration in mouse serum was detected by the detection method of 3-IPA in Reference Example 1. Figure 4 As shown. Figure 4It can be seen that Bacteroides vulgaris J2525 intervention can significantly increase the concentration of 3-IPA in mouse serum, while Escherichia coli and Bacteroides monomorpha, which also belong to the Bacteroides genus, do not have this metabolic function. The results show that Bacteroides vulgaris J2525 can metabolize and produce 3-IPA in the body.

Claims

1. A Bacteroides vulgaris, characterized in that It was deposited in the General Microbiology Center of China Culture Collection Administration on April 25, 2025, with the deposit number CGMCC NO. 46398.

2. Use of the Bacteroides vulgaris according to claim 1 in the production of 3-indolepropionic acid.

3. A method for producing 3-indolepropionic acid, characterized in that: include: (1) anaerobically culturing the Bacteroides vulgaris according to claim 1 under suitable conditions; as well as (2) Isolate and purify 3-indolepropionic acid from the culture supernatant.

4. The method according to claim 3, wherein The culture medium used in step (1) is selected from brain heart infusion culture medium. Preferably, the formula of the brain heart infusion culture medium is: peptone 10.0 g / L, dehydrated calf brain extract powder 12.5 g / L, dehydrated ox heart extract powder 5.0 g / L, sodium chloride 5.0 g / L, glucose 2.0 g / L, disodium hydrogen phosphate 2.5 g / L, pH value 7.4 ± 0.

2.

5. The method according to claim 4, characterized in that Hemin was also added to the culture medium.

6. The method according to claim 3, characterized in that The gas conditions for the culture in step (1) are 90% nitrogen, 5% carbon dioxide and 5% hydrogen.

7. The method according to claim 3, characterized in that The culture temperature in step (1) is 35-37°C.

8. Use of the Bacteroides vulgaris according to claim 1 in increasing the content of 3-indolepropionic acid in an organism.

9. Use of the Bacteroides vulgaris according to claim 1 in the preparation of a medicament / preparation for increasing the content of 3-indolepropionic acid in a body.

Images