E3 ubiquitin ligase gene ulA and application thereof

Abstract

The invention discloses an E3 ubiquitin ligase gene ulA, the nucleotide sequence of which is shown as SEQ ID NO: 1. The gene is knocked out from fusarium oxysporum by using a homologous recombination method to obtain a mutant strain ulA; compared with a wild strain, the mutant hulA has the advantages that the spore yield is reduced, the spore germination is delayed, the response capability to various abiotic stresses is reduced, the pathogenicity to panax notoginseng plants is reduced, and the sensitivity to six bactericides is increased, and experimental results show that the gene plays an important role in pathogenicity, drug resistance and the like of fusarium oxysporum. The gene can be used as a target gene for developing an anti-fusarium oxysporum preparation.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to an E3 ubiquitin ligase gene hulA and its application in preventing and controlling Fusarium oxysporum. Background Art

[0002] Panax notoginseng ( Panax notoginseng ( Burk FHChen, a perennial herb belonging to the genus Panax (Araliaceae), the same family as ginseng, holds high medicinal value in Traditional Chinese Medicine. Root rot of Panax notoginseng, caused by Fusarium oxysporum, severely impacts plant quality and yield. Root rot accounts for 70% to 85% of all losses from Panax notoginseng diseases.

[0003] Currently, the prevention and control of Panax notoginseng root rot caused by Fusarium oxysporum is mainly through chemical control, agricultural control and biological control, among which chemical control is a fast and effective means.

[0004] Fusarium oxysporum is a widely distributed soil-borne pathogenic fungus with strong host adaptability and pathogenicity. It is one of the main pathogenic fungi that causes Panax notoginseng root rot, posing a serious threat to the yield and quality of various economic crops, including Panax notoginseng. At present, there has been no fundamental breakthrough in the prevention and control strategies for root rot. Therefore, studying the pathogenic mechanism of Fusarium oxysporum will provide a theoretical basis for the development of more effective biological control strategies. E3 ubiquitin ligases are an important class of ubiquitin modification enzymes that maintain the dynamic balance of intracellular proteins by specifically recognizing target proteins. E3 ubiquitin ligases are involved in multiple physiological processes of fungi, including cell cycle regulation, hormone signaling, and environmental stress response. Therefore, fully exploring the ubiquitination-related genes of Fusarium oxysporum and conducting functional studies on them will help to fully understand the molecular pathogenic mechanism of Fusarium oxysporum and provide a theoretical basis for the prevention and control of Fusarium oxysporum. Summary of the Invention

[0005] The present invention provides an E3 ubiquitin ligase gene hulA , which is derived from Fusarium oxysporum ( Fusarium oxysporum ) was cloned from 4-1, the nucleotide sequence of which is shown in SEQ ID NO: 1, and it encodes a protein with the amino acid sequence shown in SEQ ID NO: 2.

[0006] Another object of the present invention is to transform the E3 ubiquitin ligase gene hulA Application in screening of resistance to Fusarium oxysporum ( Fusarium oxysporum ) preparations, and the preparations screened are used to inhibit or block the E3 ubiquitin ligase gene hulA Expression for purpose.

[0007] The ingredients (or active ingredients) of the preparations screened by the present invention are capable of inhibiting or blocking the E3 ubiquitin ligase gene hulA The expressed drug or interfering RNA may be added with one or more pharmaceutically acceptable excipients, or combined with other active ingredients to exert an inhibitory effect; in addition to being made into tablets, the preparation may also be made into various pharmaceutically acceptable forms such as pills, powders, capsules, granules, oral liquids and injections.

[0008] The present invention constructs E3 ubiquitin ligase gene hulA The knockout cassette was introduced into the protoplasts of Fusarium oxysporum and the E3 ubiquitin ligase gene was expressed by homologous recombination. hulA Knockout mutant Δ was obtained from Fusarium oxysporum hulA ; Then, the knockout mutant Δ hulA The growth performance and pathogenicity of wild-type Fusarium oxysporum were different; the experimental results showed that compared with wild-type Fusarium oxysporum, the knockout mutant Δ hulA The conidia production of the conidia was reduced, the germination of the conidia was delayed, the tolerance to environmental stress was reduced, and the sensitivity to various fungicides was significantly increased; the pathogenicity test showed that the E3 ubiquitin ligase hulA The deletion of the gene significantly reduced the pathogenicity of Fusarium oxysporum and affected the tolerance of Fusarium oxysporum to fungicides. hulA The gene is a pathogenicity-related gene of Fusarium oxysporum. Using its encoded protein as a drug target is expected to provide a new approach for the prevention and control of Fusarium oxysporum.

[0009] The environmental stress includes high temperature stress, high osmotic pressure stress, cell wall stress, cell membrane stress, and oxidative stress; high temperature stress is caused by 37°C, high osmotic pressure stress is caused by sodium chloride, potassium chloride, sorbitol, and calcium chloride, cell wall stress is caused by Congo red, cell membrane stress is caused by sodium dodecyl sulfate, and oxidative stress is caused by hydrogen peroxide.

[0010] Beneficial effects of the present invention: The present invention confirms that E3 ubiquitin ligase hulA The present invention constructs a homologous recombination gene knockout cassette, introduces it into the protoplasts of Fusarium oxysporum, and uses the homologous recombination method to knock out the gene from Fusarium oxysporum to obtain a knockout mutant △ hulA strain; by constructing a gene complementation vector and introducing it into hulA Protoplasts, to obtain complementation strains △hulA -C, complement strain △ hulA -C can be restored to levels equivalent to the wild type; By comparing with wild-type strains or complemented strains △hulA -C comparison, we found that the knockout mutant △ hulA The strain's conidia production was reduced, conidia germination was delayed, tolerance to environmental stress was reduced, and sensitivity to a variety of fungicides was significantly increased; pathogenicity experiments showed that the knockout mutant △ hulA The pathogenicity is significantly reduced. The above test proves that hulA The gene plays an important role in the conidia formation and germination, tolerance to abiotic stress and pathogenicity of Fusarium oxysporum. hulA The gene is a pathogenicity-related gene of Fusarium oxysporum, an E3 ubiquitin ligase hulA The genes help us gain a deeper understanding of the molecular mechanisms of Fusarium oxysporum pathogenicity and provide targets for the development of effective fungicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 E3 ubiquitin ligase hulA Gene amplification results diagram; Figure 2 for hulA PCR verification results of gene knockout mutants; Figure 3 for hulA Gene complementation strains △hulA -PCR verification results of C; Figure 4 The wild-type strain (WT) hulA Gene deletion mutants and hulA Gene complementation strains △hulA -C was cultured on PDA plates at 28°C for 5 days and the colony morphology was observed; Figure 5 The wild-type strain (WT) hulA Gene deletion mutants and hulA Gene complementation strains △hulA -C is the result of culturing on a PDA plate at 28°C for 5 days and measuring the growth diameter of the colonies at the same time point every day; Figure 6 The wild-type strain (WT) hulA Gene deletion mutants and hulA Gene complementation strains △hulA -C shows the growth diameter of the colonies after culturing on PDA plates at 28°C for 5 days; ns: indicates no significant difference between the two groups of data; Figure 7 for hulA Gene deletion mutants and hulA Gene complementation strains △hulA -C conidia yield and conidia germination experimental results, where Figure a is the spore yield; Figure b is the germination rate result; Figure 8 for hulA Gene deletion mutants and △hulA -C Experimental results on the ability of complement strains to respond to abiotic stress; Figure 9 for hulA Experimental results on the pathogenicity of gene deletion mutants to Panax notoginseng plants; Figure 10 for hulA Gene deletion mutants and △hulA -C complement strain tolerance test results to fungicides. DETAILED DESCRIPTION

[0012] The present invention is further described in detail below by way of examples, but the content of the present invention is not limited thereto. In the present examples, the methods are operated according to conventional methods unless otherwise specified, and the reagents used are conventional reagents or reagents prepared according to conventional methods unless otherwise specified. In the embodiment, Fusarium oxysporum ( Fusarium oxysporum ) 4-1 strain, which is recorded in the literature "Wen Zengye, Li Dinghua, Dai Mengyao, et al. Analysis of biological characteristics of Fusarium oxysporum, the pathogen of Panax notoginseng root rot [J]. Chinese Medicinal Materials, 2019, 42(9): 1978-1984."; The Panax notoginseng plants used for the test were those grown in a greenhouse at the College of Life Sciences and Technology, Kunming University of Science and Technology, Yunnan Province; The recipes for PDA solid medium, YPD medium, LB medium, YEPD medium, TB3 medium, MM regeneration medium, low melting point MM regeneration medium, and T-top regeneration medium refer to the literature "Liu Jia. Mechanism of action of Rho2 GTPase in the growth and development of Fusarium oxysporum [D]. Kunming University of Science and Technology, 2021." Medium recipe; Example 1: E3 ubiquitin ligase gene hulA Acquisition 1. Extraction of Fusarium oxysporum genome (1) Inoculate Fusarium oxysporum strain 4-1 into PDA medium. After culturing for 5-7 days, scrape the mycelium into a pre-cooled mortar, grind it into powder with liquid nitrogen, add 1 mL of CTAB extraction buffer, and dispense it into EP tubes. (2) Incubate in a 60°C water bath for 1 hour, gently shake to mix every 20 minutes, centrifuge at 15,000 rpm for 10 minutes, and transfer the supernatant to a new EP tube; (3) Add an equal volume of chloroform and isoamyl alcohol (24:1) mixture, shake for 8-10 seconds, centrifuge at 15,000 rpm for 10 minutes, and transfer the supernatant to a new EP tube; (4) Add an equal volume of pre-cooled isopropanol and mix well. Let it stand at -20℃ for 1 hour. Centrifuge at 15000 rpm for 10 minutes and discard the supernatant. (5) Add 70% ethanol, mix well, and centrifuge at 15,000 rpm for 10 minutes to wash. Repeat this operation once; (6) Dissolve the DNA in 35 μL TE buffer and check the genome quality by 1% agarose gel electrophoresis.

[0013] 2. E3 ubiquitin ligase genes hulA Acquisition The gene fragment was amplified using primers 1 and 2 using the above-extracted Fusarium oxysporum genome as a template. The reaction system consisted of 1 μL template, 1 μL each of the above primers, 10 μL Premix Taq, and 7 μL deionized water. Primer 1: 5′-ATGACCAGTCGCACCGATTCTAAGT-3′; Primer 2: 5′-CTACTCTTGGCCAAAACCCATAGTT-3′; The PCR amplification conditions were as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 2 min 10 s, for a total of 30 cycles, and a final extension at 72°C for 10 min. The samples were stored at 4°C. The gel electrophoresis results were as follows: Figure 1 As shown, the sequenced fragment was 2432 bp, which was determined to be an E3 ubiquitin ligase gene after sequence alignment.

[0014] Example 2: E3 ubiquitin ligase gene hulA Construction of knockout cassette 1. According to the NCBI database of Fusarium oxysporum ( Fusarium oxysporum ) genomic DNA sequences, respectively, in the E3 ubiquitin ligase gene hulA Primers were designed for about 1000 bp upstream and downstream of the coding region. Using the genome extracted in step 1 of Example 1 as a template, primers 3 and 4 were used to amplify the upstream homology arm fragment. Primer 3: 5′-GTCGTCTAGTCATCTGTAGG-3′; Primer 4: 5′-CTTCAATATCATCTTCTGTC GGTGTCACCTCTTGCGCTGC -3'; (the underlined part is the hygromycin HY sequence) Primers 5 and 6 were used to amplify the fragment of the downstream homology arm; Primer 5: 5'- CACTTAACGTTACTGAAATC ACGATAACGACATTACTTTC-3'; (the underline is the hygromycin YG part of the sequence) Primer 6: 5′-TACTCACGATAAAGACTTCC-3′; 2. Primers were designed based on the hygromycin resistance gene (HYG). Using plasmid (pCSN44) as a template, primers 7 and 8 were used to amplify the HY (1098 bp) fragment, and primers 9 and 10 were used to amplify the YG (1017 bp) fragment. Primer 7: 5'- GCAGCGCAAGAGGTGACACC GACAGAAGATGATATTGAAG -3'; (the underline is the partial sequence of the upstream homology arm of the target gene) Primer 8: 5′-TCCATACAAGCCAACCACGG-3′; Primer 9: 5′-AAAGTTCGACAGCGTCTCCG-3′; Primer 10: 5'-GAAAGTAATGTCGTTATCGTGATTTCAGTA ACGTTAAGTG-3'; (the underline indicates the partial sequence of the downstream homology arm of the target gene); 3. Using overlapping polymerase chain reaction (overlapping PCR), with the upstream homology arm fragment of the target gene obtained in step 1 and the hygromycin resistance gene HY fragment as templates, primers 3 and 8 were used to amplify a fusion fragment of the upstream homology arm of the target gene and the hygromycin resistance gene HY fragment; using the hygromycin resistance gene YG fragment and the downstream homology arm fragment of the target gene as templates, primers 9 and 6 were used to amplify a fusion fragment of the hygromycin resistance gene YG fragment and the downstream homology arm of the target gene; the upstream homology arm fragment + HY fragment and the YG fragment + downstream homology arm fragment were the target gene knockout cassettes.

[0015] Example 3: Preparation of Fusarium oxysporum protoplasts (1) Prepare spore suspension. Inoculate wild-type Fusarium oxysporum strain into 100 mL YPD liquid medium, culture at 28°C and 180 rpm for 3-5 days, filter the spore suspension, and adjust the concentration to 2×10 8 / mL; (2) Take 1 mL of spore suspension and inoculate it into YEPD medium containing ampicillin and culture overnight; (3) Use sterile gauze to filter the bacterial liquid to collect the mycelium, rinse it with sterile water first, then wash the mycelium with 1.2 M KCl solution, then take an appropriate amount of mycelium and place it in 20 mL of enzymatic hydrolysis solution (200 mg of lysine is dissolved in 20 mL of 1.2 M KCl solution, dissolve it at 28°C and 120 rpm for 1 hour, then centrifuge it at 8000 rpm for 1 minute, take the supernatant and pass it through a 0.22 μm filter. The filtrate is the enzymatic hydrolysis solution). Enzymatic hydrolysis is carried out for 2-3 hours, filter and centrifuge, discard the supernatant, resuspend and wash the protoplasts with STC buffer, and store the protoplasts for later use.

[0016] Example 4: hulAKnockout mutant hulA Acquisition 1. Protoplast transformation of Fusarium oxysporum (1) Take 100 μL of protoplasts, 2.5 μg of the upstream homology arm fragment + HY fragment fusion fragment, and 2.5 μg of the YG fragment + downstream homology arm fragment fusion fragment, mix them, and place them on ice for 20 minutes; add PEG solution (12 g polyethylene glycol 4000, 2.5116 g 3-(N-morpholinyl)propanesulfonic acid dissolved in 20 mL of distilled water, heat and stir to dissolve, and filter sterilize with a 0.22 μm filter membrane) and centrifuge to discard the supernatant. Resuspend the precipitate with STC buffer (14.575 g sorbitol, 5 mL 1 mol / L calcium chloride, 1 mL 1 mol / LTris-HCl pH 7.5 in 100 mL of water); (2) After transformation, the protoplasts were mixed with MM regeneration medium and spread on plates. After incubation at 28°C for 18-24 h, the plates were covered with TB3 medium containing 200 μg / mL hygromycin. The plates were incubated at 28°C for 5-7 days until transformants appeared on the plates covered with TB3 regeneration medium containing hygromycin. (3) Transformants were inoculated into PDA solid medium containing 200 μg / mL hygromycin, numbered, stored, and cultured for 3-5 days before rescreening; (4) Pick a single colony and inoculate it into PDA solid medium containing 200 μg / mL hygromycin. Screen the transformants three times to obtain the transformants.

[0017] 2. hulA Identification of gene knockout mutants Based on the principle of homologous recombination, three pairs of primers were designed for PCR verification of successful gene knockout: Primer 11 and Primer 12 were used to detect hulA The gene knockout sequence (2063 bp) was detected by primers 13 and 14, and the upstream (1005 bp) homologous recombination fusion fragment was detected by primers 15 and 16, and the downstream (1071 bp) homologous recombination fusion fragment was detected by primers 15 and 16.

[0018] Primer 11: 5′-ACCGATTCTAAGTAAGTCCATT-3′; Primer 12: 5′-CTTTGCCAAGCATCATCTT-3′; Primer 13: 5′-CTTGTTCCCTGGCTGATGG-3′; Primer 14: 5′-GTCCTCGTTCCTGTCTGCTAAT-3′; Primer 15: 5′-CGTTATGTTTATCGGCACTT-3′; Primer 16: 5′-GACCCAGGTCTGTCCACTC-3′; See the results Figure 2 , no hulA Gene bands ( Figure 2 a), the knockout mutant contains upstream and downstream homology arms ( Figure 2 b, c), the results show that the construction was successful hulA Knockout mutant hulA .

[0019] Example 5: hulA Gene complementation strains △hulA -C build 1. Use pKNTG vector to construct complementation strain and select Sma I and Bam HI was used as the restriction endonuclease site at the 5' and 3' ends. Using the wild-type strain DNA of Fusarium oxysporum extracted in Example 1 as a template, PCR amplification was performed using primers 17 and 18 to obtain the complemented gene fragment; Primer 17: 5′-ATCGAATTCCTGCAGCCCGGGATGACCAGTCGCACCGATTC-3′; Primer 18: 5′-TCAGTAACGTTAAGTGGATCCATACGTTTCTCGATGCGCCA-3′; The pKNTG vector was double-digested with restriction endonucleases. The reaction system was: 25 μL of pKNTG vector plasmid, 5 μL of CutSmart Buffer, Bam HI 1 μL, Sma I 1 μL, deionized water 18 μL; react at 37°C for 3 hours. Detect and recover the digested products by agarose gel electrophoresis.

[0020] Homologous recombination reaction was carried out, and the reaction system was as follows: 2 μL of complemented gene fragment, 3 μL of enzyme-digested vector, 2 μL of 5×CE II Buffer, 1 μL of Exnase II, and 3 μL of deionized water; the recombination reaction system was reacted at 37°C for 30 minutes for ligation reaction to obtain pKNTG- hulA replenishing carriers; Refer to the method of Example 3 to use Fusarium oxysporum hulA The gene knockout mutant was used as the experimental material to prepare protoplasts, and the constructed pKNTG- hulAThe complementing vector is introduced into the protoplasts. After transformants are cultured, the transformants are inoculated into PDA medium containing G418, numbered and stored, and cultured for 3-5 days before rescreening to obtain gene-complemented strain transformants; 2. Verification of gene complementation strains The genome of the gene-complemented strain transformant was extracted according to the method of Example 1. The gene was used as a template and PCR was performed using primers 19 and 20. The PCR reaction system was 1 μL of template, 10 μL of Premix Taq, 1 μL of each primer, and 7 μL of deionized water. Primer 19: ATGACCAGTCGCACCGATTCT; Primer 20: GGCCAAGCCGACAACAC; The results of PCR product gel electrophoresis were as follows Figure 3 As shown, this embodiment successfully constructed hulA Gene complementation strains △hulA -C.

[0021] Example 6: Wild type Fusarium oxysporum, hulA Knockout mutant hulA 、 hulA Gene complementation strains △ hulA Observation on the mycelial growth morphology of -C The plate culture method was used to compare the wild type strain of Fusarium oxysporum, △ hulA strains, △hulA -C complement strain growth characteristics, respectively, the same growth of the wild type strain, △ hulA strain, △ hulA -C complemented strains were inoculated on PDA plates and cultured at 28°C for 5 days. The morphological characteristics of the colonies of different strains were observed, and the radial expansion rate of the colonies was measured at the same time point for 5 consecutive days. The diameter change was used as the evaluation index, and three replicates were set for each group. The results are as follows Figure 4-6 As shown, hulA strains and △hulA The mycelial growth rate of the -C complemented strain was not significantly different from that of the wild-type strain, and there was no significant difference in the colony diameters of the three strains after 5 days of culture. This result shows that hulA Gene deletion had no significant effect on the vegetative hyphal growth and morphology of Fusarium oxysporum.

[0022] Example 7: Wild type Fusarium oxysporum, hulA Knockout mutant hulA 、 hulA Gene complementation strains △ hulA -C conidia production and germination Determination of spore production: Prepare wild-type strains of Fusarium oxysporum, hulA strains and △ hulA -C complemented strain spore suspension (containing about 1.4×10 8 Conidia were inoculated into 25 mL of PDB liquid medium and cultured at 28°C and 180 rpm for 48 h. After the culture was completed, 1 mL of bacterial liquid was taken and the number of conidia was counted using a hemocytometer. Three replicates were set for each strain.

[0023] Germination rate determination: wild-type strain of Fusarium oxysporum, hulA strains and △ hulA -C complemented strain spore suspension (containing about 1 × 10 8 Each strain was inoculated with 1 mL of germination medium and cultured at 28°C and 180 rpm in a shaking incubator for 8, 12, and 16 h, respectively. The germination rate of each strain was calculated by microscopic examination (germination rate = germination ÷ (germination + non-germination) × 100%). Three replicates were set for each strain.

[0024] Different strains of Fusarium oxysporum (WT, △ hulA ,△ hulA -C) and the spore production and spore germination rates at different times (8, 12, and 16 hours) are as follows Figure 7 As shown, the spore production was calculated by shaking the culture at 28°C and 180 rpm for 48 hours. Figure 7 As shown in a, hulA The spore production of the strain was significantly lower than that of the wild-type strain; △hulA The spore production of the -C strain was not significantly different from that of the wild-type strain, indicating that gene complementation restored the spore production. Figure 7 As shown in b, hulA The germination rate of the strain at 8 hours was significantly lower than that of the wild-type strain, and there was no significant difference between the strain and the wild-type strain at 12 hours and 16 hours; △hulA -C strain had no significant difference in germination rate at 8, 12, and 16 hours compared with the wild type strain. hulA Gene deletion leads to decreased conidia production and delayed conidia germination in Fusarium oxysporum.

[0025] Example 8: Wild type Fusarium oxysporum, hulA Knockout mutant hulA 、 hulA Gene complementation strains △ hulA -C responses to abiotic stress To explore the wild type strains of Fusarium oxysporum, hulA strains, and the responses of △hulA-C complement strains to abiotic stress. First, prepare △ hulA strain, △ hulA -C complemented strain and wild-type strain spore suspension, take 5 μL containing gradient concentrations (about 10 6 , 10 5 , 10 4 Conidia (1000 cells / mL) were inoculated onto YPD solid medium supplemented with the following ingredients and cultured at 28°C for 2 days: (1) Cell membrane stress: 0.0125% sodium dodecyl sulfate (SDS) was added to the culture medium; (2) Cell wall stress: Congo red (CR) 300 μg / mL was added to the culture medium; (3) Hyperosmotic stress: 1.25 M sorbitol was added to the culture medium; (4) Oxidative stress: 1 M H2O2 was added to the culture medium; (5) High temperature stress: culture at 37°C for 4 days; (6) Salt stress: 1 M sodium chloride, 1.2 M potassium chloride, and 1 M calcium chloride were added to the culture medium.

[0026] YPD medium without stress agent was used as control, and three replicates were set for each group. Figure 8 , it can be seen from the figure that on the blank control YPD medium, △ hulA The phenotype of the strain is similar to that of the wild type strain and △hulA There was no significant difference in the phenotype of the -C complemented strain. However, on the medium supplemented with sodium dodecyl sulfate, Congo red, sorbitol, hydrogen peroxide, and calcium chloride stress agents, △ hulA The mycelial growth of the strain was lower than that of the wild type strain and △hulA -C strain, under high temperature (37℃) stress, △ hulA The inhibition degree of the strain was higher than that of the wild type strain and △hulA -C complement strains should be high, indicating hulA The deletion of the gene makes Fusarium oxysporum more sensitive to sodium dodecyl sulfate, Congo red, sorbitol, hydrogen peroxide, calcium chloride and high temperature stress.

[0027] Example 9: Wild type Fusarium oxysporum, △ hulA Pathogenicity of gene deletion mutants to Panax notoginseng plants With a concentration of 1×10 8 / mL of wild-type strains and △ hulA The spore suspension of the strain was used to treat healthy two-year-old Panax notoginseng plants with the same growth conditions. After culturing at room temperature under shade conditions for 21 days, the results were as follows: Figure 9 As shown, the wild-type strain and △ hulA strains all caused symptoms, but △ hulA The degree of lesions in Panax notoginseng plants infected by the strain was relatively mild. The experimental results showed that hulAGenes associated with pathogenicity of Fusarium oxysporum.

[0028] Example 10: Wild type Fusarium oxysporum, hulA Knockout mutant hulA 、 hulA Gene complementation strains △ hulA -C sensitivity to fungicides To explore the wild type strains of Fusarium oxysporum, hulA strains, △hulA -C complement strains to different fungicides sensitivity, first prepare △ hulA strains, △hulA- C complemented strain and wild type strain spore suspension, take 5 μL containing gradient concentration (about 10 6 , 10 5 , 10 4 A conidia suspension of 1 μg / mL was inoculated on YPD solid medium supplemented with 1 μg / mL thiram (TMTD), hymexzol, methyl thiophanate (MBC), difenoconazole (TEB), fludioxonil (Cymoanil), and pyraclostrobin (PPZ) and cultured at 28°C for 2 days. The experimental results are as follows Figure 10 As shown in Figure 2, the fungicides showed significant inhibitory effects on the mycelial growth of the three strains of Fusarium oxysporum. However, at the same concentration of fungicides, hulA The mycelial growth of the strain was inhibited more significantly, which indicated that hulA The mutations make the strain more sensitive to these fungicides.

Claims

1. An E3 ubiquitin ligase gene huL , whose nucleotide sequence is shown in SEQ ID NO:

1.

2. To inhibit or block the E3 ubiquitin ligase gene according to claim 1 huL Expression for the purpose of screening for resistance to Fusarium oxysporum ( Fusarium oxysporum ) application in preparations.

Images