Pennisetum americanum transcription factor gene PgC3H11 for improving plant cold resistance and application thereof

Abstract

The invention discloses a Pennisetum americanum transcription factor gene PgC3H11 for improving plant cold resistance and application thereof, and belongs to the technical field of gene engineering. The CDS sequence of the transcription factor gene PgC3H11 of the pennisetum americana is as shown in SEQ ID NO. 25. The zinc finger protein gene PgC3H11 is identified in pennisetum americana, the expression of the gene is induced by low-temperature stress, and the cold resistance of a transgenic plant can be enhanced by improving the expression level of the CBFs gene. The gene has important production value for improving the cold resistance of plants, creating excellent parent elements with high cold resistance and cultivating cold-resistant varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a Pennisetum gracilis transcription factor gene PgC3H11 for improving the cold resistance of plants and an application thereof. Background Art

[0002] Low temperature is one of the most common abiotic stresses encountered by plants during their life cycle, significantly limiting their geographical distribution, growth and development, yield quality, and post-harvest viability. Understanding the physiological and biochemical effects of low temperature on plants, as well as the molecular mechanisms underlying plant responses to low temperature stress, is crucial for breeding crop varieties with superior low-temperature tolerance.

[0003] Pennisetum, also known as royal millet and pearl millet, boasts rapid growth, rich nutrition, high yield, and strong resistance. Native to Africa, it is an excellent warm-season forage grass and the sixth-largest cereal crop worldwide, after rice, wheat, maize, barley, and sorghum, with a global cultivated area exceeding 31.2 million hectares. Furthermore, its high tolerance makes it suitable for cultivation on marginal lands, without competing with grain crops. As a high-quality forage grass, it plays a vital role in agricultural and livestock production. However, it is highly sensitive to low temperatures and has poor adaptability to cold environments. Chilling damage is particularly prevalent during the germination and early growth stages, which are crucial for plant morphology and yield. Cold stress inhibits seed germination and seedling growth, ultimately leading to yield reductions. Therefore, improving the resistance of Pennisetum and breeding new cold-tolerant varieties has become an important goal and direction. However, to date, little research has been conducted on the cold-tolerance genes in Pennisetum, and the mechanisms underlying its cold tolerance remain unclear.

[0004] Zinc finger proteins are characterized by zinc finger domains, which form a finger-like tetrahedral structure by binding zinc ions and are important domains in eukaryotic transcription factors. Based on their structural characteristics, zinc finger domains can be divided into several different categories. The most common zinc fingers in transcription factors are of the C2H2 or CCCC type, named after the configuration of cysteine (C) and histidine (H) in the zinc finger domain. Compared with other types of zinc finger proteins, CCCH zinc fingers are less common, accounting for approximately 0.8% of all zinc fingers, and these zinc fingers have their own specific biological functions. CCCH zinc finger proteins also regulate plant cold tolerance through post-transcriptional regulation. In tomatoes, SlC3H39 degrades cold-responsive genes by binding to cold-responsive gene mRNAs, thereby negatively regulating tomato cold tolerance. CCCH zinc finger proteins act as transcription factors to regulate the expression of downstream cold-related genes, thereby improving plant cold tolerance. In switchgrass, low temperature treatment significantly induces the expression of the CCCH zinc finger transcription factor gene PvC3H72. Overexpression of PvC3H72 improves cold tolerance in transgenic switchgrass plants by regulating the expression of the ICE1-CBF-COR complex and genes in the ABA signaling pathway. Under low temperature conditions, the survival rate of Arabidopsis thaliana AtTZF1-overexpressing lines was significantly higher than that of controls. The cold tolerance phenotype of Arabidopsis lines is consistent with the upregulation of ABA or cold-related genes KIN1, RD29A, and COR15A. DgC3H1 is a nuclear-localized CCCH zinc finger protein isolated and cloned from chrysanthemum (Chrysanthemum morifolium). This protein enhances cold stress resistance in chrysanthemum by positively regulating the cold stress-related genes DgCOR413, DgDREBa, DgCSD1, and DgCSD2.

[0005] In summary, the CCCH transcription factors that regulate plant cold tolerance are still limited, and no cold-tolerant CCCH transcription factors have been identified in Pennisetum americanum. Summary of the Invention

[0006] The present invention aims to provide a Pennisetum serrata transcription factor gene, PgC3H11, for enhancing plant cold tolerance and its application, addressing the aforementioned problems of the prior art. The present invention identifies a zinc finger protein gene, PgC3H11, in Pennisetum serrata. Its expression is induced by low-temperature stress, and its application can enhance the cold tolerance of transgenic plants by increasing the expression of CBFs genes. The availability of this gene has significant production value for improving plant cold tolerance, creating superior high-cold-tolerant parent elements, and breeding cold-resistant varieties.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a Pennisetum gracilis transcription factor gene PgC3H11 for improving the cold resistance of plants. The CDS sequence of the Pennisetum gracilis transcription factor gene PgC3H11 is shown in SEQ ID NO.25.

[0009] The present invention also provides a recombinant vector comprising the Pennisetum americanum transcription factor gene PgC3H11.

[0010] The present invention also provides a recombinant bacterium comprising the recombinant vector.

[0011] The present invention also provides the use of the Pennisetum americanum transcription factor gene PgC3H11, the recombinant vector or the recombinant bacteria in improving the cold resistance of plants.

[0012] The present invention also provides the use of the Pennisetum americanum transcription factor gene PgC3H11, the recombinant vector or the recombinant bacteria in cultivating plants with high cold resistance.

[0013] Optionally, the plants are Arabidopsis thaliana and Pennisetum americanum.

[0014] The present invention also provides a method for improving the cold resistance of plants, comprising the steps of introducing the Pennisetum americanum transcription factor gene PgC3H11 into the plant to achieve stable overexpression.

[0015] Optionally, the plants are Arabidopsis thaliana and Pennisetum americanum.

[0016] The present invention also provides a method for cultivating plants with high cold resistance, comprising the steps of introducing the Pennisetum americanum transcription factor gene PgC3H11 into plants to construct transgenic plants that overexpress PgC3H11.

[0017] Optionally, the plants are Arabidopsis thaliana and Pennisetum americanum.

[0018] The present invention discloses the following technical effects:

[0019] The present invention identified a zinc finger protein gene PgC3H11 in Pennisetum truncatum. The gene is 1803bp long and encodes 600 amino acids. The PgC3H11 protein contains a typical CCCH conserved domain at amino acid positions 259-286. qRT-PCR detection found that the expression of PgC3H11 was induced by low temperature stress. PgC3H11 is localized to the cell nucleus and exhibits significant transcriptional activation activity in a yeast system, indicating that PgC3H11 is a cold-responsive transcriptional activator. In addition, experiments have found that PgC3H11 enhances the cold tolerance of overexpressing Arabidopsis thaliana by increasing the expression level of CBFs genes. The acquisition of this gene has important production value for improving the cold tolerance of Pennisetum truncatum, creating excellent high-cold-resistant parent elements, and breeding cold-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is the relative expression analysis result of Pennisetum americanum PgC3H11 under different stress treatments;

[0022] Figure 2 The amino acid sequence phylogenetic tree and sequence alignment results of PgC3H11, SlC3H39, PvC3H72, PvC3H69, and PvSSG are shown;

[0023] Figure 3 The following are the results of cold-resistance phenotype analysis of PgC3H11 transgenic Arabidopsis thaliana under -10°C freezing treatment; A shows the phenotypes of the transgenic lines and wild-type plants after freezing treatment; B shows the statistical results of the survival rates of the transgenic lines and wild-type plants after freezing treatment;

[0024] Figure 4 The following are the results of cold-tolerance phenotypic analysis of PgC3H11 transgenic Arabidopsis thaliana under -5°C freezing treatment; A represents the phenotype of the transgenic line and wild-type plants after freezing treatment; BE represent the survival rate, leaf malondialdehyde content (MDA), electrolyte permeability (EL), and relative water content (RWC) of the transgenic line and wild-type plants under freezing treatment, respectively.

[0025] Figure 5 The relative expression analysis results of CBFs genes in PgC3H11 transgenic Arabidopsis thaliana after low temperature treatment at 4°C; A is the relative expression analysis result of CBF1 gene; B is the relative expression analysis result of CBF2 gene; C is the relative expression analysis result of CBF3 gene;

[0026] Figure 6 The results of subcellular localization analysis of PgC3H11 are shown;

[0027] Figure 7 This is the result of validating the transcriptional activity of PgC3H11. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The primer sequence information designed in the following examples of the present invention is shown in Table 1.

[0034] Table 1 Primer sequence information

[0035]

[0036]

[0037] Example 1 Analysis of relative expression of PgC3H11 gene under different stress treatments

[0038] Tifleaf 3 seedlings of uniform growth were exposed to normal conditions (H2O), high temperature (45 / 40°C), low temperature (4°C), drought (20% PEG6000), cadmium (50 μM CdCl2), ABA (100 μM), and salt stress (250 mM NaCl). Total RNA was extracted from leaves collected after treatment using a plant RNA extraction kit (R4150, HiPure Plant RNA Plus Kit, Magen Biotechnology Co., Ltd.). The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit. Fluorescence quantitative polymerase chain reaction (PCR) was performed using the primers listed in Table 1 (SEQ ID NO. 1 and SEQ ID NO. 2) to determine the relative expression of PgC3H11 under different stress conditions and at different time points. PgUBC-E2 from Tifleaf 3 was used as an internal reference gene. The primers for the internal reference gene are shown in Table 1 (SEQ ID NO. 3 and SEQ ID NO. 4).

[0039] See the results Figure 1 The PgC3H11 gene in Pennisetum serrata was significantly induced by high temperature, low temperature, and salt stress within 48 hours. Notably, the expression level of the PgC3H11 gene was highest after 24 hours of low temperature (4°C).

[0040] Example 2 Cloning of PgC3H11 gene

[0041] The PCR method was used, with Pennisetum americanum cDNA as the template, and 5'UTR upstream primer F and 3'UTR primer R (SEQID NO.5 and SEQ ID NO.6) were used to perform the first round of PCR amplification. CDS region-specific primers (SEQ ID NO.7 and SEQ ID NO.8) were designed again, and the PCR recovered product obtained from the first PCR was used as a template for the second round of amplification. After the PCR reaction was completed, the PCR product was detected by 1% agarose gel electrophoresis and recovered. The PCR product was digested with enzymes and then ligated to the entry vector (Entry Vector) pENTR / D vector in the Gateway cloning system using T4 ligase and sent to the company for sequencing. The sequencing results were compared with the genomic reference sequence.

[0042] The PCR amplification system is shown in Table 2; the amplification program is: 98°C for 1 min, 98°C for 10 s, 56°C for 30 s, 72°C for 2 min, 30 cycles, 72°C for 5 min, and storage at 4°C; the enzyme digestion system is shown in Table 3; the enzyme digestion reaction conditions are 37°C for 2 h.

[0043] Table 2 PCR amplification system

[0044]

[0045]

[0046] Table 3 Restriction Enzyme Digestion System

[0047]

[0048] After sequencing, the CDS sequence of the PgC3H11 gene is as follows:

[0049] ATGTGCTCCGGACCTCGCAAACCGTCGACACCGCCGCTGCCGGCTGCGACGGCCA

[0050] AGGAATCGGCGGAGATGGCGGCGCTGCTCCTGGAGCTCGCGGCGGCGGACGACCTCGT

[0051] GGCGTTCAGGCGCGCCGTCGAGGACGACAAAGTCTCGGCCTTGGACGCCGCGTGCCAG

[0052] TGGTACGGGCCTTCCGCCGCCGCCGCGGCGGCGGGTGGTGCCGCCCGGCCGCGCCTCG

[0053] AGGTGCGCACGCCGGCCATGGTAGCCGCGCTCTACGGGAGCACGGGGGTGCTTGCCTA

[0054] CGTGCTGTCCGCCGCGCCGGCGGAGGCGGCGCGCGCGTCGCCCACCGACGGCGCCACG

[0055] CCGCTCCACCTCGCCGCGGCGGGCGGCGCCGCGGGCGCCGTCGCGGCCACGCACCTCC

[0056] TCCTCGCCGCGGGCGCGTCCGCTGACGCGCTCGCCTTCTCGGGCCTCCGCGCCGGGGAC

[0057] CTCCTCCCGCGCGCCAACGCCGCGGCCGAGAGGGACAGGGCGCTCCGCGTGCTCCTCA

[0058] AGTCCCCCGCGGCGTCGCCGTCGTCCTCCCCGAAGAAGTCCGCCTCGCCTCCCCCGGCC

[0059] GTCCCGGAGCCGAGGAAGGAGTACCCTCCCGACCTCACCCTCCCTGACCTCAAGAGCG

[0060] GCCTCTTCAGCACCGACGAGTTCCGCATGTACAGCTTCAAGGTGAAGCCCTGCTCCCGC

[0061] GCCTACTCCCACGACTGGACCGAGTGCCCCTTCGTGCACCCCGGCGAGAACGCGCGCC

[0062] GCCGCGACCCGCGCCGCTACTCCTACAGCTGCGTCCCCTGCCCCGAGTTCCGCAAGGGC

[0063] GGCGCCTGCCGCAAGGGGGACAACTGCGAGTACGCGCACGGCGTCTTCGAGTGCTGGC

[0064] TCCACCCGGCGCAGTACCGCACCCGCCTCTGCAAGGACGAGGTCGGCTGCGCGCGCCG

[0065] CATCTGCTTCTTCGCCCACAAGCACGAGGAGCTCCGCTCCGTCAACCCCTCCGCGGTCT

[0066] CCGTCGGCATGCAGCCCACCGTGTCGTCGCCGCGCTCCTCGCCGCCCAACGGCCTCGAC

[0067] ATGGGCGGCATGCTCAACGCCGCCGCGTGGCCCTCCTCCCCGGCGGGCAGGCTCAAGA

[0068] CCGCGCTCGCCGGCCGGGAGCTGGACTTCGACCTCGAGCTGCTCGCGCTGGACCAGTA

[0069] CCAGCAGAAGCTCTTCGACAAGGTGTCGTCGCCGAGGGCCAGCTGGGGCTCGGCCGGC

[0070] GGGATCGGCTCCCCGCTGCCCACCGCGGCGCCGCCCGCCAGGGCCGTGCCGGACTACA

[0071] CGGACCTGCTCGGCTCCGTCGACCCGGCCATGCTGTCCCAGCTGCACGCGCTGTCGCTG

[0072] AAGCAGTCCGGTGACATGCCGGCGTACAGCTCCATGCCGGACGCGCAGATGCACATGCC

[0073] GACCTCACCCATGGTGGGCGCGAACACCGCGTTCGGGCTCGACCACTCCATGGCCAAG

[0074] GCCATCATGAGCTCCCGCGCCTCGGCGTTCGCCAAACGCAGCCAGAGCTTCATCGACCG

[0075] CGGCGGCCGCGCGCCGGCCGCCCGCTCGCTCATGTCGCAGCCCACCACTGGCGCGCCG

[0076] TCCATGCTCTCCGACTGGGGATCGCCGGACGGCAGGCTGGACTGGGGCGTCCAGGGCG

[0077] ACGAGCTCCACAAGTTCCGCAAGTCCGCGTCCTTCGCTTTCCGCGGGCAATCCCCGGCG

[0078] CCGGTGCCGACCCCCGCCGAGCCAGACGTCTCATGGGTGAACTCTCTTGTCAAGGACG

[0079] GCCACGCCGGCGACATATTTGCGCAGTGGCCGGAGCAGGAGCAGATGGTGGCCTAA

[0080] (SEQ ID NO.25)。

[0081] To explore the novelty and specificity of PgC3H11, its amino acid sequence was aligned and homologous to the published CCCH zinc finger proteins that are mainly cold-related. The results are shown in Table 4. The amino acid homology between PgC3H11 and SlC3H39 is 47.21%, and the amino acid homology between PgC3H11 and the reported switchgrass cold transcription factor PvC3H72 is only 36.29%. The other two genes have been reported not to be cold-related genes. The amino acid homology between PgC3H11 and PvC3H69 is 61.83%, and the amino acid homology between PgC3H11 and PvSSG is 68.18%. At the same time, these amino acid sequences all contain a conserved CCCH domain (see Figure 2 ), which indicated that PgC3H11 in Pennisetum americanum was a novel cold-regulated CCCH protein.

[0082] Table 4 Homology of PgC3H11 and cold-related CCCH zinc finger proteins

[0083]

[0084] Example 3 Acquisition and identification of PgC3H11 transgenic plants

[0085] 1. Ligate PgC3H11 with the pENTR vector to construct the pENTR-PgC3H11 vector, and perform positive verification using primers M13-F and M13-R (SEQ ID NOs. 11-12). Digest the pENTR-PgC3H11 vector with PvuI restriction endonuclease, then use LR recombinase to reconstitute the digested product with the pEarlyGate103 expression vector. Perform positive verification using universal vector primers 103-F and 103-R (SEQ ID NOs. 13-14) to form the pEG103-PgC3H11 recombinant expression vector, which is then transformed into Agrobacterium AGL1.

[0086] 2. Obtaining Arabidopsis transgenic lines

[0087] Agrobacterium carrying the constructed pEG103-PgC3H11 vector was cultured to an OD of 0.6. The culture was collected and resuspended to obtain an Agrobacterium infection solution with an OD of 0.8. Arabidopsis inflorescences were immersed in the Agrobacterium infection solution. After mature Arabidopsis seeds were plated on 1 / 2 MS + Basta medium, positive Arabidopsis were screened.

[0088] 3. Identification of transgenic Arabidopsis

[0089] T0 generation Arabidopsis seeds were plated on 1 / 2 MS solid medium containing 20 mg / L Basta. After growing for approximately two weeks, green, healthy seedlings were transferred to nutrient soil for further cultivation. Arabidopsis leaves were collected, and genomic DNA was extracted for PCR identification. Transgenic positive lines with correct sequencing were further cultured, and their T1 generation seeds were collected. Lines with a progeny segregation ratio close to 3:1 were screened and harvested, ultimately yielding three T3 generation homozygous lines (OE1, OE2, and OE6) for functional validation.

[0090] 4. Analysis of cold-tolerance phenotype of transgenic Arabidopsis

[0091] 4.1 T3 transgenic Arabidopsis seeds were plated on 1 / 2 MS solid medium supplemented with 20 mg / L Basta. When the Arabidopsis had grown 2-4 cotyledons, they were transferred to square Petri dishes containing 1 / 2 MS solid medium. After culturing for another week, transgenic and wild-type Arabidopsis seedlings were subjected to freeze-injury treatment according to the method of Yang Shuhua et al. The specific procedure was as follows: Before treatment, phenotypic images were taken (24°C, 12 days). The seedlings were then placed in a refrigerated incubator at 4°C for 1 day, then the temperature was lowered by 1°C per hour until the designated temperature (-10°C) was reached. After 3 hours of freeze-injury treatment, the incubator temperature was raised to 4°C and kept in the dark for 12 hours. The seedlings were then transferred to a 24°C tissue culture room for recovery. After 6 days, the survival rate was calculated and photographed. Seedlings that grew new leaves were considered viable. A control group was also maintained at a normal temperature.

[0092] See the results Figure 3 As can be seen, after freezing treatment and transfer to normal temperature for recovery, almost all leaves of wild-type Arabidopsis seedlings died, while the leaves of PgC3H11 transgenic Arabidopsis gradually returned to green, and the survival rate of PgC3H11 transgenic Arabidopsis was significantly higher than that of the wild type, indicating that PgC3H11 improved the freezing tolerance of Arabidopsis.

[0093] 4.2 T3 transgenic Arabidopsis seedlings of identical growth and four weeks of growth were selected and transplanted into soil. Wild-type Arabidopsis served as a control and subjected to a -5°C freeze-injury treatment. The specific process was as follows: Before treatment, phenotypic photographs were taken (22°C, 30 days) and samples were collected for subsequent physiological parameter testing. The plants were then placed in a refrigerated incubator at 4°C for 3 days, then the temperature was lowered directly to the designated temperature (-5°C). One and a half days after the freeze-injury treatment, phenotypic photographs were taken. The treated materials were transferred to a growth chamber at 22°C for 4 days of recovery, after which they were photographed and sampled. Phenotypes were observed and physiological parameters tested during the treatment.

[0094] The methods for measuring physiological indicators are as follows:

[0095] (1) Determination of malondialdehyde content (MDA)

[0096] Add 1 mL of the reaction solution to 0.5 mL of the crude enzyme solution. Incubate in a 95°C water bath for 15 minutes (using a refrigerated centrifuge tube). Quickly cool to room temperature on an ice bath, shaking the tube to prevent bubbles. Centrifuge at 12,000 × g for 10 minutes. Remove any bubbles with a pipette. Aspirate 200 μL of the supernatant and measure absorbance on a microplate reader (532 nm (λ2) and 600 nm (λ1)). Subtract the absorbance at 600 nm from the absorbance at 532 nm.

[0097] The crude enzyme extraction process is as follows: Weigh approximately 0.1g of fresh plant tissue, grind it, add 1.5ml of pre-chilled 150mmol / L PBS phosphate buffer (pH 7.0), and centrifuge at 12,000×g for 20 minutes at 4°C. The supernatant is the crude enzyme extract. The reaction solution is: 20% (w / v) trichloroacetic acid (TCA) + 0.5% (w / v) thiobarbituric acid (TBA).

[0098]

[0099] Where A: Absorbance difference A 532 -A 600 ; ι: length of the light path through the sample in cm; ε: extinction coefficient 155mM-1cm-1; c: MDA concentration; V: total volume of the extracted crude enzyme solution; W: fresh weight of the material in g.

[0100] (2) Determination of electrolyte leakage rate (EL)

[0101] Take 0.1g of fresh plant leaves, wrap them in absorbent paper, and place them in a 50mL centrifuge tube filled with 30mL of deionized water, ensuring that the sample is fully immersed in the water. Set up five biological replicates, seal the tube, and place it on a shaker for 24 hours. After that, use a conductivity meter to measure the initial conductivity (C0). The centrifuge tube with the initial conductivity measurement is then sealed and placed in a boiling water bath for 20 minutes to fix the greenness. Remove the tube, cool it to room temperature, and place it on a shaker for 24 hours. The conductivity (C1) is then measured again. The conductivity is calculated using the formula: EL = C0 / C1 × 100%.

[0102] (3) Determination of relative water content (RWC)

[0103] Accurately weigh 0.1 g of plant leaf fresh weight (FW) using a 1 / 10,000 balance. Wrap the leaf in absorbent paper and immerse it in a 10 mL centrifuge tube filled with 10 mL of deionized water. Seal the tube and let it sit at room temperature for 24 hours. Then, remove the leaf and wipe dry with absorbent paper. Quickly weigh the saturated fresh weight (TW) of the leaf. Place the leaf in an envelope and dry it in an oven (65°C) until constant weight is reached. Finally, weigh the leaf dry weight (DW). The formula for calculating leaf relative water content is: RWC = (FW - DW) / (TW - DW) × 100%.

[0104] See the results Figure 4 It can be seen that compared with the leaves before freezing treatment, the leaves of wild-type Arabidopsis thaliana wilted significantly after freezing treatment, while the leaves of overexpressing Arabidopsis thaliana remained relatively upright; after 4 days of recovery, the leaves of wild-type Arabidopsis thaliana almost died, withered and turned yellow, while the leaves of transgenic Arabidopsis thaliana turned slightly purple but still grew healthily ( Figure 4 Before freezing treatment, there was no significant difference in malondialdehyde content, ion permeability and relative water content between wild type and overexpressing Arabidopsis thaliana. However, after freezing treatment, malondialdehyde content and ion permeability of PgC3H11 overexpressing Arabidopsis thaliana were significantly lower than those of wild type, while relative water content was significantly higher than that of wild type ( Figure 4 B, D and E), and the survival rate of the wild type was significantly lower than that of the transgenic Arabidopsis ( Figure 4 C), indicating that the cell membrane damage of PgC3H11 transgenic Arabidopsis was less after low temperature stress, and the degree of plant cell membrane lipid peroxidation was weaker, and PgC3H11 enhanced the freezing resistance of Arabidopsis.

[0105] 5. Detection of cold-responsive gene expression

[0106] Using a plant RNA extraction kit, leaves of WT and PgC3H11 transgenic Arabidopsis thaliana grown at 22°C for 30 days were treated with subzero temperatures (4°C) for 1 and 3 days. Samples were collected at each time point, with three biological replicates, and total RNA was extracted from these samples. Plant RNA was reverse transcribed into cDNA using a reverse transcription kit. Primers were designed and the relative expression levels of cold-responsive CBFs genes (CBF1, CBF2, and CBF3) were detected by RT-qPCR, using Arabidopsis thaliana ACTIN2 as an internal reference gene. Primer sequences are shown in Table 1 (SEQ ID NOs. 17-24). qRT-PCR was performed using the RT-PCR EasyM I kit (Fuji Biotechnology Co., Ltd., Chengdu, China). qRT-PCR experiments were performed using a Bio-RAD CFX Connect instrument. The total reaction volume was 20 μL, containing 5 μL cDNA, 0.8 μL upstream primer, 0.8 μL downstream primer, 10 μL SYBR enzyme, and RNase-free ddH2O to 20 μL. The reaction program was 95°C for 30 s; 95°C for 5 s, 58°C for 30 s, 40 cycles; the melting curve was set by default. 2 -ΔΔCt The relative expression levels of genes were calculated.

[0107] See the results Figure 5 By detecting the expression levels of CBFs genes, it was found that the expression levels of CBF1, CBF2, and CBF3 genes in overexpressing Arabidopsis were significantly higher than those in the wild type (WT) after cold treatment. These results suggest that the enhancement of cold tolerance by PgC3H11 in Arabidopsis may be related to the CBF pathway.

[0108] 6. Subcellular localization

[0109] Take a 3-5-week-old, robust T3 transgenic Arabidopsis plant and remove a fully expanded leaf. Seal the lower epidermis with standard scotch tape and the upper epidermis with sterilization indicator tape. Gently peel the tape from both sides, separating the lower epidermis from the leaf. Place the leaf, with the sterilization indicator tape still attached (with the exposed mesophyll side facing downward), into a Petri dish containing 5 mL of enzymatic hydrolysis solution. Gently shake the dish on a horizontal shaker (40 rpm) for 2 hours until most of the protoplasts are hydrolyzed. Transfer the protoplasts and the enzyme solution to a 50 mL centrifuge tube, centrifuge at 100 × g for 3 minutes, rinse twice with ice-cold W5 solution, and place on ice for 30 minutes. The protoplasts, suspended in 0.2 mL of MMg solution, are mixed with plasmid DNA (pEG103-PgC3H11). Add freshly prepared mannitol solution and incubate at room temperature for 5 minutes. Then slowly add 3mL of W5 solution to wash the protoplasts, mix evenly, collect the protoplasts by centrifugation at 100×g for 1min, and repeat the washing. After washing, suspend with 1mL of W5 solution and culture in the dark at room temperature for 12-16h. At the end of the culture, add DAPI solution (final concentration of 10μg / mL), incubate at room temperature for 5min, and observe eGFP fluorescence using a Leica ultra-high resolution confocal microscope (excitation wavelength of 488nm, scanning wavelength of 505-530nm). The results are shown in Figure 6 , it can be seen that PgC3H11 is localized in the cell nucleus.

[0110] 7. Verification of transcriptional activity

[0111] Using the pENTR-PgC3H11 recombinant plasmid as a template, corresponding homology arm primers BD-PgC3H11-F and BD-PgC3H11-R (SEQ ID NOs. 9-10) were designed to ligate PgC3H11 to the pGBTK7 vector. Positive clones were detected using the universal vector primers T7 and 3-BD (SEQ ID NOs. 15-16), resulting in the pGBKT7-PgC3H11 recombinant plasmid. The pGBKT7-PgC3H11 recombinant plasmid was transformed into Y2H competent yeast cells. After single yeast colonies grew, the cells were shaken and diluted to various dilutions. The cells were then spotted on SD / -Trp or SD / -Trp-His-Ade (+25 mM 3AT) selective media, respectively. After incubation at 30°C for 3 days, yeast growth was observed and photographed. PvSSG protein was used as a negative control.

[0112] See the results Figure 7, it can be seen that yeast containing "pGBKT7-PgC3H11" can grow on the triple-deficient selection medium, indicating that PgC3H11 has transcriptional activation activity. These results indicate that PgC3H11 is a cold-responsive CCCH transcriptional activator.

[0113] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A Pennisetum gracilis transcription factor gene PgC3H11 for improving plant cold tolerance, characterized in that: The CDS sequence of the Pennisetum americanum transcription factor gene PgC3H11 is shown in SEQ ID NO.

25.

2. A recombinant vector comprising the Pennisetum americanum transcription factor gene PgC3H11 according to claim 1.

3. A recombinant bacterium comprising the recombinant vector according to claim 2.

4. Use of the Pennisetum americanum transcription factor gene PgC3H11 according to claim 1, the recombinant vector according to claim 2, or the recombinant bacterium according to claim 3 in improving the cold resistance of plants.

5. Use of the Pennisetum americanum transcription factor gene PgC3H11 according to claim 1, the recombinant vector according to claim 2, or the recombinant bacterium according to claim 3 in cultivating plants with high cold resistance.

6. The use according to claim 4 or 5, characterized in that The plants are Arabidopsis thaliana and Pennisetum americanum.

7. A method for improving the cold resistance of plants, characterized in that: The method comprises the steps of introducing the Pennisetum gracilis transcription factor gene PgC3H11 according to claim 1 into a plant to stably overexpress the gene.

8. The method according to claim 7, characterized in that The plants are Arabidopsis thaliana and Pennisetum americanum.

9. A method for cultivating plants with high cold resistance, characterized in that: The method comprises the steps of introducing the Pennisetum americanum transcription factor gene PgC3H11 according to claim 1 into a plant to construct a transgenic plant overexpressing PgC3H11.

10. The method according to claim 9, characterized in that The plants are Arabidopsis thaliana and Pennisetum americanum.

Images