Application of corn ZmMKK5 gene in regulation and control of corn kernel development

Abstract

The invention discloses application of a corn ZmMKK5 gene in regulation and control of corn kernel development, and belongs to the technical field of genetic engineering, the nucleotide sequence of the ZmMKK5 gene is shown as SEQ ID NO.1, and the amino acid sequence of a ZmMKK5 gene coding protein is shown as SEQ ID NO.2. The invention further discloses a preparation method of the corn ZmMKK5 gene. It is found for the first time that by inhibiting expression of the coding gene ZmMKK5 of the ZmMKK5 protein, the length, width and hundred-grain weight of corn kernels and the diameter of corn kernel starch particles can be remarkably reduced, a scientific basis is provided for further fully excavating the corn production potential and improving the corn yield, and the application prospect is good; reasonable utilization of the ZmMKK5 gene has important guiding significance on improvement of corn yield and high and stable yield breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to an application of a maize ZmMKK5 gene in regulating maize grain development. Background Art

[0002] Maize (Zea mays L.), my country's top grain crop, is widely cultivated across the country and plays a vital role in agricultural production and economic development. Understanding the mechanisms of its grain development is crucial for ensuring food security. Kernel size, a core component of the three key yield factors (number of ears, number of kernels, and kernel weight), is influenced by a synergistic effect of genetic regulatory networks and the external environment. Numerous researchers, both domestically and internationally, have studied this trait. After years of research, considerable progress has been made in understanding the molecular genetic mechanisms of maize kernel size. However, genetic resources are relatively scarce, and the discovery and utilization of more superior alleles is urgently needed. Therefore, using genetic engineering techniques to select genes for breeding is a key research priority.

[0003] Mitogen-activated protein kinase kinase (MAPKK) is a key member of the mitogen-activated protein kinase (MAPK) cascade in plants. The MAPK cascade is a highly conserved signal transduction system consisting of MAPKKK-MAPKK-MAPK, which responds to external stimuli and regulates cell proliferation and differentiation through step-by-step phosphorylation. In plants, members of the MKK gene family are often involved in responses to various stresses, such as cold, salt, and drought. The MKK gene family also participates in plant growth and development. Furthermore, MKK gene family members play an important role in plant hormone signal transduction.

[0004] The maize ZmMKK gene belongs to the MAPK kinase kinase (MAPKK) family. Current research on the maize ZmMK K gene family mainly focuses on its potential functions in adverse stress response and plant growth and development. In terms of regulating maize kernel development, Jin Jiao et al. obtained a gene related to maize kernel development, ZmMKK 4, through positional cloning. This is the only ZmMKK gene related to maize kernel development found so far. The main manifestation is that the deletion mutant of this gene has smaller kernels than the wild-type, with wrinkled tops, and its endosperm is powdery and opaque, with an extremely low seedling rate, weak growth, and short plants (Jin Jiao, Positional Cloning of Maize Kernel Size Gene ZmMKK4, Henan Agricultural University, Issue 02, 2021). However, there is still a lack of evidence as to whether other maize MAPKK homologous genes are involved in kernel development. Summary of the Invention

[0005] In view of the deficiencies of existing research, the purpose of the present invention is to provide an application of the maize ZmMKK5 gene in regulating maize grain development. The maize ZmMKK5 gene has a stronger regulatory ability on maize grain development, providing more theoretical basis for breeding maize varieties with higher quality grains.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] The present invention provides an application of a maize ZmMKK5 gene in regulating maize grain development. The nucleotide sequence of the ZmMKK5 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ZmMKK5 gene is shown in SEQ ID NO.2.

[0008] As a further optimization scheme of the present invention, the expression of the ZmMKK5 gene promotes the development of corn kernels, and the functional loss of the ZmMKK5 gene inhibits the development of corn kernels.

[0009] As a further optimization scheme of the present invention, the corn kernel development includes the development of the length, width, and 100-kernel weight of the corn kernels and the development of the starch granules of the corn kernels.

[0010] As a further optimized solution of the present invention, the corn is the corn inbred line KN5585.

[0011] The present invention also provides a method for obtaining a new corn germplasm, wherein the ZmMKK5 gene in corn is edited by CRISPR-Cas9 gene editing technology to inhibit the expression of the ZmMKK5 gene, wherein the nucleotide sequence of the ZmMKK5 gene is shown in SEQ ID NO.1, and a ZmMKK5-CRISPR-Cas9 gene editing vector is constructed and then genetically transformed into corn, and the obtained positive seedlings, i.e., the new corn germplasm, have reduced length, width, and 100-grain weight of the grains, and reduced diameter of the starch granules of the grains; or, a ZmMKK5 gene overexpression vector is constructed by genetic engineering technology and genetically transformed into corn, and the obtained positive seedlings, i.e., the new corn germplasm, have increased length, width, and 100-grain weight of the grains, and increased diameter of the starch granules of the grains.

[0012] As a further optimization scheme of the present invention, in the CRISPR-Cas9 gene editing technology, two sgRNA target sites were designed using the nucleotide sequence of the ZmMKK5 gene as a template to construct the ZmMKK5-CRISPR-Cas9 gene editing vector. The sgRNA target site sequences are as follows:

[0013] SEQ ID NO.3: Nucleotide sequence comprising target site 1: CCGCGGCACGGGGCGCCCCTACG;

[0014] SEQ ID NO.4: Nucleotide sequence comprising target site 2: CGGCATGTACGAGCGCGGCGGGG.

[0015] As a further optimization scheme of the present invention, the editing of the ZmMKK5 gene includes a 1 bp base insertion and a 1 bp base mutation at target site one and a 23 bp base deletion at target site two or a 139 bp base deletion between target site one and target site two.

[0016] The present invention provides the following beneficial effects:

[0017] The present invention discovered for the first time that by inhibiting the expression of the gene ZmMKK5 encoding the ZmMKK5 protein, the length, width, 100-grain weight of corn kernels and the diameter of corn kernel starch granules can be significantly reduced, providing a scientific basis for further fully tapping the production potential of corn and increasing corn yield. It has good application prospects, and the rational use of the ZmMKK5 gene has important guiding significance for increasing corn yield and breeding for high and stable yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Figure 2 is the identification diagram of the knockout mutants zmmkk5-KO1 and 2. WT is the wild-type KN5585;

[0019] Figure 2 Figure 2 is the identification diagram of the knockout mutants zmmkk4-KO1 and 2. WT is the wild-type KN5585;

[0020] Figure 3 Grain phenotype analysis of knockout mutants zmmkk5-KO1, 2, zmmkk4-KO1, 2 and wild type KN5585;

[0021] Figure 4 Scanning electron microscopy analysis of knockout mutants zmmkk5-KO1, 2, zmmkk4-KO1, 2 and wild-type KN5585. DETAILED DESCRIPTION

[0022] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0023] 1. Materials

[0024] The full-length CDS sequence (SEQ ID NO. 1) and protein sequence (SEQ ID NO. 2) of the maize ZmMKK5 gene were obtained from the Plant Genome Database website (https: / / phytozome.jgi.doe.gov / pz / portal.html);

[0025] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0026] 2. Methods

[0027] 2.1 Identification of the knockout mutant zmmkk5

[0028] Based on the full-length CDS sequence of the ZmMKK5 gene, a ZmMKK5-CRISPR-Cas9 gene editing vector was constructed and genetic transformation was performed to obtain maize mutant seeds. To ensure the accuracy of gene editing, a specific dual-target sequence was designed. Target site 1 was located on the antisense strand, and target site 2 was located on the sense strand. The sequence containing target site 1 was (SEQ ID NO.3: 5'-CCGCGGCACGGGGCGCCCCTACG-3'); the sequence containing target site 2 was (SEQ ID NO.4: 5'-CGGCATGTACGAGCGCGGCGGGG-3'). The maize leaf genome was extracted and the fragment containing the gene knockout target sequence was amplified for sequence alignment.

[0029] The results are as follows Figure 1 As shown, two successfully gene-edited homozygous maize lines, zmmkk5-KO1 and zmmkk5-KO2, were obtained. Among them, zmmkk5-KO1 had a 1bp insertion and a 1bp mutation at the first target site, and a 23bp deletion at the target site 2; zmmkk5-KO2 had a deletion between the first target site and the second target site, with a total deletion of 139bp bases, resulting in a frameshift in the nucleotide sequence of the ZmMKK5 gene and inability to encode the normal ZmMKK5 protein.

[0030] 2.2 Identification of the knockout mutant zmmkk4

[0031] Based on the full-length CDS sequence of the ZmMKK4 gene (Zm00001d018326) (shown in SEQ ID NO.7), a ZmMKK4-CRISPR-Cas9 gene editing vector was constructed and genetic transformation was performed to obtain maize mutant seeds. To ensure the accuracy of gene editing, specific dual-target sequences were designed. Target sites 1 and 2 were both located on the antisense strand. The sequence containing target site 1 was (SEQ ID NO.3: 5'-CCGCCGGGCACGCCGGGGCGGTC-3'); the sequence containing target site 2 was (SEQ ID NO.4: 5'-CCGCAGCGGGATCTGACCTCCCT-3'). The maize leaf genome was extracted and the fragment containing the gene knockout target sequence was amplified for sequence alignment.

[0032] The results are as follows Figure 2 As shown, two successfully gene-edited homozygous maize lines, zmmkk4-KO1 and zmmkk4-KO2, were obtained. Among them, zmmkk4-KO1 had a deletion between the first target site and the second target site, with a total deletion of 55bp bases; zmmkk4-KO2 had a 2bp base insertion at the first target site and a 1bp base deletion at the second target site, resulting in a frameshift in the nucleotide sequence of the ZmMKK4 gene and inability to encode the normal ZmMKK4 protein.

[0033] 2.3 Identification of grain phenotypes of knockout mutants zmmkk5 and zmmkk4

[0034] The identified knockout strains zmmkk5-KO1-2, zmmkk4-KO1-2 and wild type KN5585 were planted in the Nongcuiyuan experimental field of Anhui Agricultural University, and harvested after maturity. The grain phenotypes were observed and the grain length, grain width and 100-grain weight (such as Figure 3 ).like Figure 3 As shown, compared with the wild type, the grain shapes of zmmkk5-KO1-2 and zmmkk4-KO1-2 were smaller than those of the wild type (e.g. Figure 3 A); the length and width of the grains of zmmkk5-KO1-2 and zmmkk4-KO1-2 were also significantly smaller than those of the wild type (e.g. Figure 3 AC); the 100-grain weight of zmmkk5-KO1-2 and zmmkk4-KO1-2 grains was significantly smaller than that of the wild type (e.g. Figure 3 D), among which the length, width and 100-grain weight of the zmmkk5-KO1-2 mutant were more significant than those of the zmmkk4-KO1-2 mutant. This result indicates that reducing the expression of the ZmMKK5 gene significantly inhibited the development of grain size and greatly reduced crop yield.

[0035] 2.4 Effects of knockout mutants zmmkk5 and zmmkk4 on grain starch development

[0036] The main storage material in corn kernels is starch. The development of starch is closely related to the size of the kernels. To clearly observe the morphology of starch granules in corn kernels, this study used scanning electron microscopy to observe the longitudinal sections of corn kernels of the knockout mutants zmmkk5-KO1, zmmkk4-KO1, and the wild-type KN5585 (WT). Figure 4 As shown in A, the granules of zmmkk5-KO1 and zmmkk4-KO1 mutants are significantly smaller than those of the wild type. 100 starch granules of zmmkk5-KO1, zmmkk4-KO1 mutants and wild type were randomly selected and the diameter data were statistically analyzed using imageJ software. The results are shown in Figure 4 As shown in B, compared with the wild type, the diameters of starch granules in zmmkk5-KO1 and zmmkk4-KO1 mutants were shortened, among which the diameter of starch granules in zmmkk5-KO1 mutant was shortened more significantly. This result indicates that reducing the expression of ZmMKK5 gene will significantly inhibit the development of starch granules, thereby affecting the development of grain size.

[0037] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that variations and improvements are possible without departing from the scope of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. An application of the maize ZmMKK5 gene in regulating maize kernel development, characterized in that: The nucleotide sequence of the ZmMK K5 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ZmMKK5 gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The expression of the ZmMKK5 gene promotes corn kernel development, and the functional loss of the ZmMKK5 gene inhibits corn kernel development.

3. The use according to claim 1, characterized in that The corn kernel development includes the development of the length, width, and 100-kernel weight of the corn kernels and the development of the starch granules of the corn kernels.

4. The use according to claim 3, characterized in that The corn is the corn inbred line KN5585.

5. A method for obtaining new corn germplasm, characterized by: Editing the ZmMKK5 gene in maize using CRISPR-Cas9 gene editing technology to inhibit the expression of the ZmMKK5 gene, wherein the nucleotide sequence of the ZmMKK5 gene is shown in SEQ ID NO. 1, constructing a ZmMKK5-CRISPR-Cas9 gene editing vector and then genetically transforming maize, resulting in positive seedlings, i.e., new maize germplasm, with reduced kernel length, width, and 100-kernel weight, and reduced diameter of the grain starch granules; or, By using genetic engineering technology to construct a ZmMKK5 gene overexpression vector and carry out corn genetic transformation, the positive seedlings obtained are new corn germplasms with larger grain length, width, 100-grain weight and larger diameter of grain starch granules.

6. The method for obtaining new corn germplasm according to claim 5, characterized in that: In CRISPR-Cas9 gene editing technology, two sgRNA target sites were designed using the nucleotide sequence of the ZmMKK5 gene as a template to construct the ZmMKK5-CRISPR-Cas9 gene editing vector. The sgRNA target site sequences are as follows: Nucleotide sequence comprising target site 1: SEQ ID NO. 3: CCGCGGCACGGGGCGCCCCTACG; The nucleotide sequence comprising the second target site: SEQ ID NO.4: CGGCATGTACGAGCGCGGCGGGG.

7. The method for obtaining new corn germplasm according to claim 6, characterized in that: The editing of the ZmMKK5 gene includes a 1 bp base insertion and a 1 bp base mutation at target site one and a 23 bp base deletion at target site two or a 139 bp base deletion between target site one and target site two.

Images