Eye drops containing recombinant protein as well as preparation method and application of eye drops

Abstract

The invention relates to the technical field of biological medicine, in particular to eye drops containing recombinant protein as well as a preparation method and application of the eye drops. Comprising the following components: 0.01%-1% of recombinant human TFF3 protein, 0.1%-1% of an osmotic pressure regulator, 0.08%-2% of a pH regulator, 0.05%-0.15% of a thickening agent, 0.01%-0.1% of a surfactant, 0.01%-0.1% of a protective agent and the balance of water for injection, the traditional Chinese medicine composition can be used for treating the xerophthalmia, can promote wound healing and cell migration, has the effects of inhibiting inflammation and cell apoptosis, and can act on a plurality of target spots at the same time, so that the tear film stability is improved, ocular surface inflammation is inhibited, the vicious circle of the xerophthalmia is broken, and the xerophthalmia is treated more comprehensively and effectively; the problems that in the prior art, xerophthalmia medicine targets are single, and xerophthalmia cannot be comprehensively and effectively treated are solved.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine technology, and in particular relates to an eye drop containing recombinant protein, a preparation method and an application thereof. Background Art

[0002] Dry eye, also known as dry eye syndrome (DES), keratoconjunctivitis sicca, or tear dysfunction syndrome, is the most common ophthalmological disease. With changes in modern lifestyles and increasing reliance on electronic devices in both work and life, the incidence of dry eye has steadily increased, making it the fastest-growing of the three major eye diseases, along with myopia and cataracts. If left untreated, dry eye can lead to serious complications such as visual impairment, corneal and conjunctival lesions, and even vision loss. These complications can become increasingly difficult to control, severely impacting patients' daily lives.

[0003] Dry eye can be categorized by etiology into two types: aqueous-deficient dry eye and evaporative dry eye. Aqueous-deficient dry eye primarily manifests as insufficient tear secretion by the lacrimal glands, while evaporative dry eye manifests as insufficient lipid secretion by the meibomian glands, leading to rapid tear evaporation. These different types of dry eye share common symptoms, ranging from mild to severe pain, soreness, dryness, burning, eye fatigue, and ocular inflammation. Their core mechanisms are an imbalance in tear film stability and ocular surface inflammation. Tear film instability leads to ocular surface dryness and cell damage, further activating a series of inflammatory events on the ocular surface and releasing inflammatory mediators into the tears. This ocular surface inflammatory response damages the lacrimal and meibomian glands, rendering them incapable of functioning properly and further exacerbating tear film instability. This creates a vicious cycle of dry eye, characterized by tear film instability and ocular surface inflammation. Therefore, a drug that simultaneously acts on multiple targets is needed for the comprehensive and effective treatment of dry eye.

[0004] At present, the main treatments for dry eye include artificial tears, anti-inflammatory drugs and mucin secretagogues. Artificial tears can lubricate the ocular surface and keep the ocular surface hydrated. They are the first-line treatment for dry eye and are suitable for patients with mild dry eye symptoms. Anti-inflammatory drugs can improve dry eye symptoms by inhibiting ocular surface inflammation and are suitable for patients with moderate to severe dry eye. Mucin secretagogues can promote the secretion of mucin by conjunctival goblet cells, which helps stabilize the tear film. Although they can play a certain role in the treatment of dry eye, there is a problem of a single target for dry eye. For example, patent CN118948757A discloses a cyclosporine eye drop, its preparation method, and its use. Although cyclosporine eye drops have a certain effect on dry eye, and can relieve inflammation of the lacrimal gland and the surface of the eye by preventing the release of inflammatory factors and promoting tear secretion, they have the problem of a single drug target. Patent CN118948757A discloses a sodium hyaluronate eye drop and its preparation method. Although it can effectively stabilize the tear film and lubricate the ocular surface, it also has the problem of a single target and can only relieve the symptoms of dry eye but cannot cure it. In clinical practice, combination therapy is usually used to solve the problem of a single drug target in the existing technology, but combination therapy makes the treatment plan extremely complicated and increases the difficulty of treatment. In addition, the drugs used in combination may also interact with each other, affecting the absorption, distribution, metabolism, and excretion of the drug, thereby changing the efficacy of the drug or increasing the risk of adverse reactions. Summary of the Invention

[0005] In order to solve the problem that the existing dry eye drug targets are single and cannot comprehensively and effectively treat dry eye, the present invention provides an eye drop containing recombinant protein and its preparation method and application, which can treat dry eye from multiple targets.

[0006] Disclosed are eye drops containing recombinant proteins, comprising the following components: recombinant human TFF3 protein, an osmotic pressure regulator, a pH regulator, a thickener, a surfactant, a protective agent, and water for injection.

[0007] Furthermore, the eye drops include the following components in terms of mass percentage: 0.01% to 1% recombinant human TFF3 protein, 0.1% to 1% osmotic pressure regulator, 0.08% to 2% pH regulator, 0.05% to 0.15% thickener, 0.01% to 0.1% surfactant, 0.01% to 0.1% protective agent and the balance water for injection.

[0008] Preferably, the eye drops comprise the following components by mass percentage: 0.01% recombinant human TFF3 protein, 0.9% osmotic pressure regulator, 0.09% pH regulator, 0.1% thickener, 0.05% surfactant, 0.05% protective agent and the balance water for injection.

[0009] Furthermore, the osmotic pressure regulator is at least one of sodium chloride, potassium chloride or mannitol.

[0010] Furthermore, the pH adjuster is at least one of sodium dihydrogen phosphate, disodium hydrogen phosphate or boric acid.

[0011] Furthermore, the thickener is at least one of carboxymethyl cellulose, hydroxypropyl methyl cellulose or povidone.

[0012] Furthermore, the surfactant is at least one of poloxamer 188, Tween or tyloxapol.

[0013] Furthermore, the protective agent is at least one of disodium edetate, sodium citrate or condensed sodium phosphate.

[0014] The present invention also provides a method for preparing eye drops containing recombinant protein, comprising the following steps:

[0015] S1. Prepare recombinant human TFF3 protein using recombinant protein expression technology;

[0016] S2. Dissolve the formulated amount of osmotic pressure regulator, pH regulator, thickener, surfactant, and protective agent in the formulated amount of water for injection, and sterilize by high pressure after complete dissolution to obtain a solution;

[0017] S3. Add the recombinant human TFF3 protein obtained in S1 to the dissolved solution obtained in S2 in proportion and mix them evenly. After removing endotoxin, sterilize the solution through a filter membrane to finally obtain the eye drops containing the recombinant protein.

[0018] Furthermore, the method for removing endotoxins in step S3 is to use an endotoxin removal kit or to remove it through a column; the pore size of the filter membrane is 0.22 μm.

[0019] The present invention also provides a method for preparing a recombinant human TFF3 protein, comprising the steps of constructing a recombinant plasmid pGEX-5X-1-TFF3, inducing protein expression, and purifying the TFF3 protein; wherein the recombinant plasmid pGEX-5X-1-TFF3 is constructed by performing double enzyme digestion on pGEX-5X-1 and a TFF3 target gene fragment using a restriction endonuclease, and then connecting the TFF3 target gene fragment to a pGEX-5X-1 linearized expression vector at the restriction endonuclease cutting site;

[0020] The restriction endonucleases are EcoR I and Not I, the double enzyme digestion temperature is 37° C., and the time is 1 h; the ligation temperature is 16° C., and the time is 16 h.

[0021] Furthermore, the ligation system used for the ligation includes a pGEX-5X-1 vector, a TFF3 target gene fragment, T4 DNA ligase, and a 10×T4 DNA ligase buffer; the molar ratio of the TFF3 target gene fragment to the pGEX-5X-1 vector is 1:10.

[0022] Furthermore, the nucleotide sequences of the cloning primers used in the process of obtaining the TFF3 target gene fragment are shown in SEQ ID NOs. 1 to 4.

[0023] Furthermore, the nucleotide sequence of the TFF3 target gene fragment is shown as SEQ ID NO.5, and the amino acid sequence is shown as SEQ ID NO.6.

[0024] Furthermore, the protein induced expression process is to transfer the recombinant plasmid pGEX-5X-1-TFF3 into Escherichia coli BL21 to obtain a BL21 recombinant strain, and then use IPTG to induce expression to obtain bacteria containing recombinant human TFF3 protein; the concentration of the IPTG is 0.5mM~4mM, and the induction time is 1~8h.

[0025] Preferably, the concentration of IPTG is 0.5 mM, 1 mM, 2 mM, 3 mM and 4 mM, more preferably 1 mM.

[0026] Preferably, the induction time is 1 h, 2 h, 4 h, 6 h, 7 h and 8 h, more preferably 7 h.

[0027] Furthermore, the TFF3 protein purification process includes bacterial lysis, GST-TFF3 purification and protein cutting and ultrafiltration purification, and the ultrafiltration tubes used for ultrafiltration purification are 30kDa ultrafiltration tubes and 3kDa ultrafiltration tubes.

[0028] The present invention provides the use of the eye drops containing the recombinant protein in the preparation of a medicine for treating dry eye.

[0029] The advantages of the present invention are:

[0030] The eye drops provided by the present invention, prepared using TFF3 recombinant protein, can promote wound healing and cell migration, have the effects of inhibiting inflammation and cell apoptosis, can act on multiple targets simultaneously, thereby simultaneously improving tear film stability and inhibiting ocular surface inflammation. They can be used to treat dry eye, breaking the vicious cycle of dry eye, and can solve the problem that dry eye drugs in the existing technology have a single target and cannot be treated comprehensively and effectively, achieving more comprehensive and effective treatment, and are expected to provide a better option for dry eye patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1Schematic diagram of the structure of the recombinant expression plasmid pGEX-5X-1-TFF3 of the present invention;

[0032] Figure 2 This is the PCR identification result of the recombinant expression plasmid pGEX-5X-1-TFF3 of the present invention;

[0033] Figure 3 This is the partial sequencing result of the recombinant expression plasmid pGEX-5X-1-TFF3 of the present invention;

[0034] Figure 4 This is the result of exploring the optimal induction concentration of IPTG;

[0035] Figure 5 This is the result of exploring the optimal induction time of IPTG;

[0036] Figure 6 This is the result of screening high-yield strains of the present invention;

[0037] Figure 7 is the monitoring result of the TFF3 induction and purification process of the present invention;

[0038] Figure 8 is a protein immunoblot of recombinant human TFF3 in Test Example 3 of the present invention;

[0039] Figure 9 This is a partial mass spectrometry analysis result of the recombinant human TFF3 protein in Test Example 4 of the present invention;

[0040] Figure 10 is the circular dichroism spectrum of the recombinant human TFF3 protein in Test Example 4 of the present invention;

[0041] Figure 11 This is the crystal violet staining result of the effect of TFF3 on the migration ability of MCF-7 breast cancer cells in Test Example 5 of the present invention;

[0042] Figure 12 This is the DAPI staining result of the effect of TFF3 on the migration ability of MCF-7 breast cancer cells in Test Example 5 of the present invention;

[0043] Figure 13 This is a quantitative statistical analysis of the DAPI staining results in Test Example 5 of the present invention;

[0044] Figure 14 This is a representative picture of mouse corneal fluorescein sodium staining in Test Example 6 of the present invention;

[0045] Figure 15 This is the scoring analysis result of mouse corneal sodium fluorescein staining in Test Example 6 of the present invention;

[0046] Figure 16is the proportion of Tregs cells in the ocular lymph nodes and spleen in Test Example 6 of the present invention;

[0047] Figure 17 This is the result of the cell scratch test in Test Example 7 of the present invention;

[0048] Figure 18 is the quantitative result of the cell scratch test in Test Example 7 of the present invention;

[0049] Figure 19 This is the result of the Transwell migration experiment in Test Example 7 of the present invention;

[0050] Figure 20 It is the quantitative analysis of the Transwell migration assay results in Test Example 7 of the present invention;

[0051] Figure 21 is the result of real-time quantitative fluorescence PCR in Test Example 8 of the present invention;

[0052] Figure 22 This is the ASC spot staining result in Test Example 9 of the present invention;

[0053] Figure 23 is the positive rate of ASC spots in corneal epithelial cells under normal conditions and hypertonic conditions in Test Example 9 of the present invention;

[0054] Figure 24 is the positive rate of ASC spots in corneal epithelial cells before and after TFF3 treatment under hypertonic conditions in Test Example 9 of the present invention;

[0055] Figure 25 This is the protein immunoblotting result of P10 activated under hypertonic conditions in Test Example 9 of the present invention;

[0056] Figure 26 The effect of TFF3 on the expression of inflammation-related proteins IFI16, AIM2, and P10 under hypertonic conditions in Test Example 9 of the present invention;

[0057] Figure 27 This is the effect of TFF3 on corneal epithelial cell apoptosis under hypertonic conditions in Test Example 10 of the present invention. DETAILED DESCRIPTION

[0058] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0059] It should be noted that the various installation methods and technical terms mentioned in the present invention are technical terms that have long been clearly known in the relevant technical field and therefore will not be further explained. In addition, the same reference numerals are used for the same components, but this does not affect nor constitute an accurate understanding of the technical solution by those skilled in the art.

[0060] Example 1

[0061] This example provides a method for preparing recombinant human TFF3 protein, which is prepared using recombinant protein expression technology and includes the following steps:

[0062] Step 1. Obtain the recombinant strain DH5α / pGEX-5X-1-TFF3:

[0063] 1.1 Obtaining the TFF3 target gene fragment

[0064] The plasmid pcDNA3.1-TFF3 containing the TFF3 fragment was purchased, and a TFF3 primer pair was designed. The nucleotide sequences of the forward primer and reverse primer in the primer pair are shown in SEQ ID NOs. 1 to 4, as shown in Table 1 for details. The plasmid pcDNA3.1-TFF3 was then subjected to secondary PCR amplification to obtain the TFF3 target gene fragment. The PCR reaction system and PCR reaction procedure used for PCR amplification are shown in Tables 2 and 3. The nucleotide sequence of the TFF3 target gene fragment finally obtained is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO. 6, as shown in Table 4 for details.

[0065] Table 1 TFF3 cloning primer sequence list

[0066] serial number name sequence SEQ ID NO.1 TFF3-F1 ACGAAGGTCGTGAGGAGTACGTGGGCCT SEQ ID NO.2 TFF3-R1 GTCCTGAGCAGGTCAGAAGGTGCATTCTGC SEQ ID NO.3 TFF3-F2 CGTGCGCCGGAATTCATCGAAGGTCGTGAGGAGTAC SEQ ID NO.4 TFF3-R2 TATCAAATGCGGCCGCAGTCCTGAGCAGGTCAGAAG

[0067] Table 2 PCR reaction system

[0068] Reagents Dosage pcDNA3.1-TFF3 / single amplification product 1 μg 10×buffer 2.5 μL dNTPMix 4 μL TFF3-F1 / TFF3-F2 2.5 μL TFF3-R1 / TFF3-R2 2.5 μL ExTaq enzyme 0.25 μL <![CDATA[ddH2O]]> Add to 25 μL

[0069] Table 3 PCR reaction program

[0070] Reaction temperature Reaction time 94℃ 5min 94℃ 30s 52℃ 30s 72℃ 40s 72℃ 10min

[0071] Table 4 Nucleotide sequence and amino acid sequence of TFF3 target gene fragment

[0072]

[0073]

[0074] 1.2 Obtain the pGEX-5X-1 linearized vector and the TFF3 target gene fragment with specific enzyme ends

[0075] pGEX-5X-1 and the TFF3 target gene fragment obtained in step 1.1 were double-digested with EcoRI and NotI enzymes (digestion conditions were 37°C, 1 h). The double-digestion system used is shown in Table 5. The digestion products were subjected to 1% and 4% agarose gel electrophoresis, respectively. The target bands were obtained and recovered using a gel recovery kit to obtain the pGEX-5X-1 linearized vector and the TFF3 target gene fragment with specific restriction endonucleases.

[0076] Table 5 Components of the double enzyme digestion system

[0077] Reagents Dosage pGEX-5X-1 vector / TFF3 1 μg 10×Quickcutbuffer 5μL EcoRⅠ 2μL NotⅠ 2μL <![CDATA[ddH2O]]> Add to 50 μL

[0078] 1.3 Construction of recombinant plasmid pGEX-5X-1-TFF3

[0079] The TFF3 target gene fragment with specific restriction end obtained in step 1.2 was ligated into the expression vector pGEX-5X-1 obtained in step 1.2 through the EcoRI and NotI restriction sites to complete the construction of the recombinant plasmid pGEX-5X-1-TFF3. The ligation conditions were 16°C for 16 h. The ligation system is shown in Table 6. The structural diagram of the obtained pGEX-5X-1-TFF3 recombinant expression plasmid is shown in Figure 6. Figure 1 As shown;

[0080] Table 6 Connection system

[0081] Reagents Dosage pGEX-5X-1 vector 100ng TFF3 target gene fragment The molar ratio of the carrier is 1:10 T4 DNA ligase 1 μL 10×T4 DNA ligase buffer Add to 10 μL

[0082] 1.4 Transformation of recombinant plasmid pGEX-5X-1-TFF3

[0083] Mix 3 μL of the recombinant plasmid pGEX-5X-1-TFF3 obtained in step 1.3 with 30 μL of competent DH5α cells in a 1.5 mL EP tube. Place on ice for 30 min to allow the cells and plasmid to mix thoroughly. Next, incubate in a 42°C water bath for 1 min to change the permeability of the cell membrane to facilitate the entry of the plasmid. Rapidly chill on ice for 2 min, add 400 μL of 37°C preheated SOC medium and flick to mix thoroughly to restore the cell state. Incubate in a 37°C water bath for 1 h, flicking every 15 min. After the water bath, take the bacterial solution and spread it on Amp-resistant LB solid medium. Finally, incubate in a 37°C incubator upright for 30 min and invert overnight for 16-18 h to obtain the recombinant strain DH5α / pGEX-5X-1-TFF3. This was then identified (see Test Example 1 for details on the identification method and process). After confirming that the recombinant plasmid pGEX-5X-1-TFF3 was successfully constructed, it was stored in a -80°C refrigerator.

[0084] Step 2. Protein induction expression to obtain bacteria containing recombinant human TFF3 protein

[0085] 2.1 Re-extract the recombinant plasmid:

[0086] Single clones were picked from the LB plate and placed in LB liquid medium and cultured overnight at 37°C at 180 rpm in a shaker. The bacterial suspension was then aliquoted into 1.5 mL EP tubes and centrifuged (4°C, 10,000 rpm, 5 min). The supernatant was discarded, and the precipitate was retained. 100 μL of Buffer I (containing 2% RNase A) was added to each tube and the suspended bacteria were shaken. 200 μL of Buffer II (prepared immediately before use) was added to each tube and mixed 10 times with rapid addition. 150 μL of Buffer II was added to each tube. Buffer III, quickly mix 10 times; then place on ice for 30 minutes, centrifuge at 4°C, 12000 rpm for 15 minutes, take the supernatant and put it into a new tube (be careful not to touch the precipitate), centrifuge again to take the supernatant, add 1 mL of ice ethanol to each tube, mix well, place at -80°C for sedimentation for 1 hour, centrifuge again at 4°C, 20 minutes, 12000 rpm, discard the supernatant and keep the precipitate; each tube was washed twice with 85% ethanol, centrifuged at 4°C, 12000 rpm for 20 minutes, aspirated the liquid, and dried the precipitate; then added water to dissolve it back, measured the concentration, and used 1% agarose gel electrophoresis to obtain the plasmid extraction results. Finally, the recombinant plasmid was successfully extracted; the formulas of plasmid extraction reagents Buffer I, Buffer II and Buffer III are shown in Table 7.

[0087] Table 7 Plasmid extraction reagent formula

[0088]

[0089] 2.2 The recombinant plasmid pGEX-5X-1-TFF3 was transformed into Escherichia coli BL21 to induce expression to obtain bacteria containing recombinant human TFF3 protein (this example provides the best induction process. The best induction conditions used were obtained from the induction experiment of Experimental Example 1. Other conditions in Experimental Example 1 can also be used to induce protein expression):

[0090] The recombinant plasmid pGEX-5X-1-TFF3 was transformed into Escherichia coli BL21 to obtain a BL21 recombinant strain using the same transformation method as in step 1.4. A single colony was then picked from the BL21 transformation plate and inoculated into 5 mL of LB liquid medium containing 100 μg / mL Amp, and cultured overnight at 37°C, 180 rpm for 16 h. The overnight culture was inoculated into 100 mL of fresh 2YT liquid medium containing 100 μg / mL Amp at a ratio of 1:100. Four bottles were inoculated, each containing 100 mL, and cultured at 37°C, 180 rpm until the OD600 value of the culture was 0.6-0.8. IPTG was added to a final concentration of 1 mM and induced at 16°C, 35 rpm for 7 h. After induction, the cells were collected by centrifugation at 4°C, 9000 rpm for 15 min, washed with 1× PBS, centrifuged, and stored in a -80°C refrigerator.

[0091] Step 3. TFF3 protein purification

[0092] 3.1 Bacterial lysis

[0093] First, a lysis solution was prepared according to the formula of 10 mL of PBS, 10 μL of 1 M DTT, and 2 μL of 500 mM EDTA (pH 8.0). The bacteria were then resuspended with 10 mL of lysis solution (the bacteria containing recombinant human TFF3 protein obtained in step 2, in order to obtain better results, the screening experiment shown in Experimental Example 2 can also be performed to screen high-yield strains). The bacteria were then disrupted using an ultrasonic disruptor (the ultrasonic conditions in this embodiment were 2 @ 6 rods, on for 2 seconds, off for 3 seconds, 50% power ratio, 2-3 min, and ultrasonication until the bacteria solution was transparent). After the disruption, Triton X-100 was added to the disrupted bacteria solution at a ratio of 1:1000 and mixed evenly. The mixture was centrifuged at 4 ° C, 9500 rpm, and 20 min. The supernatant was collected after centrifugation and filtered through a 0.45 μm filter to remove impurities.

[0094] 3.2 GST-TFF3 purification and protein cleavage

[0095] The supernatant obtained from the broken bacteria was passed through a GST affinity chromatography column at low temperature, with one drop for 10 seconds, and the GST-TFF3 fusion protein was hung on the column. The column was then washed with 10 mL of 1×PBS. After washing, the protein was eluted from the GST affinity chromatography column using a GSH eluent (the formula of the GSH eluent in this embodiment is 10 mM GSH and 50 mM Tris-HCl, pH 8.0). The eluted protein was centrifuged through a 10 kDa ultrafiltration tube to concentrate the protein (the conditions for ultrafiltration tube centrifugation in this embodiment are 4°C, 7000g, 1 h), and then the protein buffer was replaced with Xabuffer (the formula of Xabuffer in this embodiment is 20 mM Tris-HCl, pH 6.5 and 50 mM NaCl). After the buffer was replaced, the concentration of the GST-TFF3 fusion protein was determined using the BCA method, and Factor Xa protease and Xa were added according to the protein concentration. Buffer and CaCl2 were cleaved at room temperature for 24 h to cleave the GST tag from the TFF3 protein;

[0096] 3.3 Ultrafiltration purification of TFF3 protein

[0097] After the cutting is completed in step 3.2, first pass it through a 30kDa ultrafiltration tube to remove impurities such as GST (the main purpose of passing it through a 30kDa ultrafiltration tube is to separate the cut GST from the TFF3 protein. GST will remain in the upper part of the 30kDa membrane, and TFF3 will flow to the lower part of the membrane). Take the lower part of the membrane and continue to pass it through a 3kDa ultrafiltration tube. The upper part of the 3kDa ultrafiltration tube membrane is the purified TFF3 protein.

[0098] Example 2

[0099] The present embodiment provides an eye drop containing a recombinant protein. The added amount of each component per 100 g is: 10 mg of recombinant human TFF3 protein, 0.9 g of osmotic pressure regulator, 0.09 g of pH regulator, 0.1 g of thickener, 0.05 g of surfactant, 0.05 g of protective agent, and water for injection to make up to 100 g (the corresponding mass percentages are 0.01% of recombinant human TFF3 protein, 0.9% of osmotic pressure regulator, 0.09% of pH regulator, 0.1% of thickener, 0.05% of surfactant, 0.05% of protective agent, and the balance is water for injection).

[0100] The steps for preparing the eye drops containing recombinant protein are as follows:

[0101] S1. Prepare recombinant human TFF3 protein using the method in Example 1;

[0102] S2. Dissolve 0.9 g of an osmotic pressure regulator (the osmotic pressure regulator in this embodiment is sodium chloride), 0.09 g of a pH regulator (the pH regulator in this embodiment is anhydrous disodium hydrogen phosphate), 0.1 g of a thickener (the thickener in this embodiment is hydroxypropyl methylcellulose), 0.05 g of a surfactant (the surfactant in this embodiment is poloxamer 188), and 0.05 g of a protective agent (the protective agent in this embodiment is EDTA) in water for injection to a total mass of 100 g. After complete dissolution, sterilize by autoclaving to obtain a solution.

[0103] S3. Add the recombinant human TFF3 protein obtained in S1 to the dissolved solution obtained in S2 in proportion and mix well. Remove endotoxins using an endotoxin removal kit, and sterilize through a 0.22 μm filter membrane to finally obtain the eye drops containing the recombinant protein.

[0104] Example 3

[0105] The formula composition and preparation method of the recombinant protein-containing eye drops provided in this example are the same as those in Example 2, except that the content of each component is different. The formula comprises the following components, calculated by mass percentage: 0.01% recombinant human TFF3 protein, 1% osmotic pressure regulator, 0.08% pH regulator, 0.05% thickener, 0.01% surfactant, 0.1% protective agent, and the balance water for injection.

[0106] In this embodiment, the osmotic pressure regulator is potassium chloride, the pH regulator is anhydrous sodium dihydrogen phosphate, the thickener is carboxymethyl cellulose, the surfactant is tyloxapol, and the protective agent is condensed sodium phosphate.

[0107] Example 4

[0108] The formula composition and preparation method of the recombinant protein-containing eye drops provided in this example are the same as those in Example 2, except that the content of each component is different. The formula comprises the following components, calculated by mass percentage: 1% recombinant human TFF3 protein, 0.1% osmotic pressure regulator, 2% pH regulator, 0.15% thickener, 0.1% surfactant, 0.01% protective agent, and the balance water for injection.

[0109] In this embodiment, the osmotic pressure regulator is mannitol, the pH regulator is boric acid, the thickener is povidone, the surfactant is Tween, and the protective agent is sodium citrate.

[0110] Comparative Example 1

[0111] The preparation method of the eye drops provided in this comparative example is the same as that in Example 2, except that the formula composition is different and no recombinant human TFF3 protein is added in this comparative example.

[0112] Experimental Example 1

[0113] This experiment is to optimize the induction conditions of recombinant human TFF3 protein. The purpose is to screen the optimal induction concentration and time of IPTG. The specific process is as follows:

[0114] A single colony was picked from the BL21 transformation plate and inoculated into 4 mL of LB liquid medium containing 100 μg / mL Amp, and cultured overnight at 37°C and 180 rpm in a shaker for 16 h. The overnight culture was inoculated into 4 mL of fresh 2YT liquid medium containing 100 μg / mL Amp at a ratio of 1:100, and the culture was shaken at 37°C and 180 rpm until the OD600 value of the bacterial solution reached 0.6-0.8. The BL21 recombinant strain was induced at 16°C and 35 rpm in a shaker at different IPTG concentrations of 0 mM, 0.5 mM, 1 mM, 2 mM, 3 mM, and 4 mM and at different induction times of 1 h, 2 h, 4 h, 6 h, 7 h, and 8 h. After induction, the bacteria were collected by centrifugation at 4°C and 9000 rpm for 15 min.

[0115] The cells were lysed and protein samples were prepared for SDS-PAGE gel electrophoresis. The results of the optimal IPTG concentration experiment were as follows: Figure 4 As shown, Figure 4 The lanes from left to right in a are protein marker, IPTG 0mM, 0.5mM, 1mM, 2mM, 3mM, 4mM, Figure 4 b is correct Figure 4 The results of grayscale analysis of the target protein band in a show that the protein can be induced at IPTG concentrations of 0 to 4 mM. However, when the IPTG concentration is 1 mM, the GST-TFF3 fusion protein between 25 and 33 kDa is stained the darkest, indicating the highest protein induction amount. The experimental results of the optimal induction time are shown in Figure 1. Figure 5 As shown, Figure 5 The lanes from left to right in a are protein marker, induction 1h, 2h, 4h, 6h, 7h, 8h, Figure 5 b is correct Figure 5 The results of grayscale analysis of the target protein band in a show that the protein can be induced at an induction time of 1-8 h. When the induction time is 7 h, the GST-TFF3 fusion protein is stained the darkest. Therefore, it can be determined that the optimal induction concentration of IPTG is 1 mM and the optimal induction time is 7 h.

[0116] Experimental Example 2

[0117] This experiment is a screening experiment for high-yield strains. The purpose is to screen the BL21 recombinant strain with the highest expression of GST-TFF3 protein. The specific process is as follows:

[0118] Seven single colonies of BL21 E. coli successfully transformed in step 2.2 were picked and numbered 1, 2, 3, 4, 5, 6, and 7 and inoculated into 4 mL of LB liquid medium containing Amp, and cultured overnight at 37°C, 180 rpm for 16 h; 40 μL of the overnight culture was inoculated into 4 mL of 2YT medium containing Amp, and cultured at 37°C, 180 rpm for 3.5 h until OD600 = 0.6-0.8, and then IPTG was used to induce protein expression. After induction, the bacteria were lysed to extract the protein, determine the protein concentration, and prepare the sample. Finally, the protein sample was subjected to gel electrophoresis and Coomassie Brilliant Blue staining. The results are as follows: Figure 6 As shown, Figure 6 a is the target protein band comparison, Figure 6 b is correct Figure 6 The results of grayscale analysis of the target protein band in a. From the figure, we can see that the GST-TFF3 band of strain No. 2 is the darkest, which means that it expresses the most GST-TFF3 protein, and this strain is a high-yield strain.

[0119] Test Example 1

[0120] This test example identified the recombinant plasmid pGEX-5X-1-TFF3 in the recombinant strain DH5α / pGEX-5X-1-TFF3 obtained in Example 1. The steps are as follows: 5 single colonies were picked from the transformation plate of the recombinant plasmid pGEX-5X-1-TFF3 (the transformation plate during the transformation of the recombinant plasmid into E. coli DH5α) and inoculated into 4 mL of LB liquid culture medium containing Amp. The culture was carried out at 37°C, 180 rpm, and overnight for 16 hours until turbidity. The plasmids were extracted and identified by PCR and sequencing. The PCR identification results of the recombinant expression plasmid are shown in Figure 2. Figure 2 As shown, M is DNA Marker (2000bp), lane 1 is a negative control, lanes 2, 3, 4, 5, and 6 are recombinant plasmids, and lane 7 is a positive control. Figure 2 It can be seen that the PCR band of the plasmid extracted from a single colony has a band near 100bp (177bp), and the position is consistent with the positive control; the sequencing results of the recombinant expression plasmid are as follows Figure 3 As shown, based on the sequencing results of the recombinant plasmid, we can know that the measured sequence is consistent with the TFF3 nucleic acid sequence, thereby identifying that the recombinant plasmid pGEX-5X-1-TFF3 was successfully constructed.

[0121] Test Example 2

[0122] The process of protein induction expression and purification in Example 1 was monitored using Coomassie Brilliant Blue staining. The experimental process was as follows:

[0123] First, prepare 100mL of Coomassie brilliant blue staining solution (take 0.25g of R250 and dissolve it in 45mL of methanol, 10mL of glacial acetic acid and 45mL of distilled water, and filter it with filter paper) and 500mL of decolorizing solution (mixed with 25mL of ethanol, 50mL of glacial acetic acid and 425mL of distilled water). Then perform gel electrophoresis on the prepared protein sample. After the electrophoresis, cut the gel and use the prepared Coomassie brilliant blue staining solution to stain it for 1 hour. After the staining is completed, use the prepared decolorizing solution to decolorize it. The decolorizing solution is changed every 2 hours. The results are as follows. Figure 7 As shown, M is a 6.5-270 kDa protein marker, lane 1 is the protein expressed by Escherichia coli without IPTG induction, lane 2 is the protein expressed by Escherichia coli after IPTG induction, and by comparing lanes 1 and 2, it can be seen that the expression level of GST-TFF3 protein increases after the addition of the inducer, lane 3 is the GST-TFF3 fusion protein that has not been cut, lane 4 is the membrane portion that has passed through a 30 kDa ultrafiltration tube after cutting, and lane 5 is the purified TFF3 protein.

[0124] Test Example 3

[0125] This test example uses a protein immunoblotting experiment to detect the immunogenicity of the recombinant protein prepared in Example 1. The test process is as follows:

[0126] The prepared protein sample was subjected to gel electrophoresis, and the target protein was transferred to a PVDF membrane. After the transfer, skim milk powder was used to block the membrane for 1 hour, incubated with the primary antibody, washed with TBST, and then incubated with the secondary antibody for 2 hours, and finally developed and exposed. Figure 8 As shown by Figure 8 The position where the 6.5 kDa band appears is the recombinant human TFF3 protein prepared in Example 1.

[0127] Test Example 4

[0128] This test example performed structural identification on the recombinant protein prepared in Example 1:

[0129] First, the primary structure of the protein was detected by mass spectrometry. The detection steps were as follows: the purified recombinant human TFF3 protein was reduced with DTT to open the disulfide bonds, alkylated with iodoacetamide, and cut into peptides with trypsin and lyophilized. The lyophilized peptides were sent to Zhongke New Life Biotechnology Co., Ltd. for mass spectrometry analysis and the mass spectrometry analysis results were obtained. Figure 9 As shown, according to the analysis of the protein amino acid sequence by mass spectrometry results, it can be known that the primary structure of the recombinant human TFF3 protein prepared in Example 1 is correct.

[0130] Then, circular dichroism spectroscopy was used to detect the secondary structure of the protein. The detection steps were as follows: recombinant human TFF3 protein was dissolved in 10mM sodium phosphate buffer with a pH of 7.4 to a final protein concentration of 50μM. 250μL of the test solution was placed in a quartz colorimetric cell with a light path of 1mm. The circular dichroism spectrum was obtained using a MOS-500 circular dichroism spectrometer. The scanning area was the far ultraviolet spectral region of 190-250nm with a step size of 1nm. The results are as follows Figure 11 As shown, TFF3 protein contains α-helix, and its characteristic peak is a positive peak at 193nm and two negative peaks at 208nm and 222nm. Figure 10 It can be seen that the secondary structure of the recombinant human TFF3 protein prepared in Example 1 is correct.

[0131] Based on Test Example 3 and Test Example 4, it can be determined that the protein purified in Example 1 is TFF3 protein, and its immunogenicity, amino acid sequence and secondary structure are correct.

[0132] Test Example 5

[0133] This test example detects the biological activity of the recombinant human TFF3 protein purified in Example 1, and the process is as follows:

[0134] First, the frozen cells were rapidly thawed in a 37°C water bath, centrifuged at 1000 rpm for 3 minutes, and the cryopreservation solution was discarded. The cells were resuspended in culture medium (the culture medium used was prepared with DMEM basal medium + 1% penicillin-streptomycin + 10% FBS), and the cell suspension was placed in a T25 culture flask and cultured in a 37°C, 5% CO2 incubator to obtain MCF-7 breast cancer cells;

[0135] Then, the Transwell experimental technology was used to perform a migration experiment on MCF-7 breast cancer cells, and 0μg / mL, 10μg / mL, 50μg / mL, and 100μg / mL of recombinant human TFF3 protein were used to attract MCF-7 breast cancer cells. Specifically, 600μL of DMEM culture medium containing 10% FBS was added to the lower chamber, and the concentrations of TFF3 in the culture medium of each well in the upper chamber were 0μg / mL, 10μg / mL, 50μg / mL and 100μg / mL, respectively. 4×104 MCF-7 breast cancer cells were inoculated in each well, and the total volume of the upper chamber was 200μL; cultured in the incubator for 16h; removed the chamber, aspirated the culture medium in the upper chamber, and repeatedly smeared the upper side of the upper chamber with a cotton swab to ensure that the remaining non-migrating cells were removed; then gently rinsed the chamber twice with 1mL PBS, fixed the migrated cells with 70% ethanol, placed the chamber in an empty well to dry the membrane, and finally stained with crystal violet and DAPI.

[0136] Crystal violet staining results Figure 11 As shown, the DAPI staining results are as follows Figure 12 The results of quantification of DAPI-stained cells are shown in Figure 13 As shown, comprehensive Figure 11 、 12 ,13 It can be seen that 10 μg / mL recombinant human TFF3 protein significantly improved the migration ability of MCF-7 breast cancer cells compared with the control. Therefore, we know that the recombinant human TFF3 protein we purified has biological activity.

[0137] Test Example 6

[0138] This test example uses eye drop treatment detection to analyze the efficacy of the eye drops containing human recombinant protein TFF3 prepared in Example 2 and the eye drops without TFF3 prepared in Comparative Example 1 on dry eye. The test process is as follows:

[0139] (1) First, the experimental mice were grouped: 16-week-old NOD mice were randomly divided into the Model group, the Ctrl group, the TFF3-50 treatment group, and the TFF3-100 treatment group, with 8 mice in each group. In addition, 8 16-week-old BALB / c normal mice were set as the Normal group (the NOD mice used have spontaneous lacrimal gland lymphocytic infiltration and are a commonly used animal model for aqueous-deficient dry eye).

[0140] (2) Then perform corneal fluorescein sodium staining experiment:

[0141] The mice in the Normal group and the Model group did not receive any treatment. The mice in the Ctrl group were dripped with excipients. The TFF3-50 treatment group was dripped with eye drops containing 50 μg / mL TFF3 protein mixed with excipients. The TFF3-100 treatment group was dripped with eye drops containing 100 μg / mL TFF3 protein mixed with excipients. Each group was treated with eye drops 4 times a day for 4 consecutive weeks. Clinical indicators of dry eye were observed by corneal sodium fluorescein staining every two weeks. Clinical indicators of dry eye were observed as follows: 4% chloral hydrate was prepared and injected intraperitoneally to anesthetize the mice. 1% sodium fluorescein was prepared. After the mice were dilated, 0.5 μL sodium fluorescein was dripped into both eyes. A cotton swab was used to carefully assist the mice in blinking to evenly distribute the sodium fluorescein. The Phoenix small animal imaging system was used to take pictures and record the coloration of sodium fluorescein on the corneal surface. The corneal staining score of each group of mice was recorded according to the four-quadrant method. The results are shown in Figure 14-15 As shown, Figure 14 This is a representative picture of mouse cornea stained with sodium fluorescein. Figure 15 is the result of scoring fluorescein sodium staining. Figure 15 and 15 It can be seen that after 4 weeks of treatment, the corneal sodium fluorescein staining scores of the TFF3-50 and TFF3-100 treatment groups decreased significantly, indicating that the recombinant human TFF3 protein we prepared can effectively promote the repair of corneal epithelial cell damage in dry eye mice.

[0142] (3) Finally, immune cell analysis experiment:

[0143] After 4 weeks of treatment, mice in each group were killed, and the ocular draining lymph nodes and spleens of the mice were collected to prepare single cell suspensions. The cells were permeabilized overnight and stained with antibodies. Tregs cell surface proteins were stained with FITC anti-mouse CD4 antibody at 4°C for 20 minutes, and Tregs intracellular cytokines were stained with PE anti-mouse Foxp3 antibody at room temperature for 1 hour. After staining, immune cell subsets were analyzed using flow cytometry. The analysis results of Tregs cells are shown in Figure 2. Figure 16 As shown, Tregs cells are immunosuppressive cells. It can be concluded that the Tregs cells in the TFF3-50 and TFF3-100 groups were higher than those in the model group and the control group.

[0144] Based on the results of corneal sodium fluorescein staining and ocular immune cell analysis, it can be inferred that the target of TFF3 in treating dry eye is on the ocular epidermal cells.

[0145] Test Example 7

[0146] This test case uses a scratch test and Transwell migration to test the effect of recombinant human TFF3 protein. The test process is as follows:

[0147] (1) Primary human corneal epithelial cell culture:

[0148] Culture medium preparation: DMEM / F12 basal medium + 10% FBS + 1% P / S + 10 ng / mL epidermal growth factor + 100 ng / mL insulin;

[0149] Cell recovery: HCEC cells in the cryopreserved tube were shaken in a 37°C water bath to rapidly thaw, centrifuged at 1000 rpm for 3 min, 4 mL of culture medium was added to a T25 culture flask, and the cells were resuspended in 1 mL of culture medium. The cell suspension was then placed in a T25 culture flask and cultured in a 37°C, 5% CO2 incubator.

[0150] Cell passaging: Pour out the culture medium, wash with 3 mL of 1× PBS, aspirate the PBS, add 2 mL of trypsin and digest at 37°C for 3 min, discard the trypsin, pipette with culture medium, and pass the cells at a 1:3 ratio.

[0151] (2) Perform scratch test

[0152] HCEC cells were digested and seeded into 24-well plates at 5 × 10 cells per well. 4Cells were cultured in a 37°C, 5% CO2 cell culture incubator until the cells formed a confluent monolayer. The cell surface was quickly scraped with a 200μL pipette tip and washed three times with PBS to remove the detached cells. Then, culture medium without recombinant human TFF3 protein and culture medium containing 10μg / mL recombinant human TFF3 protein were added respectively and cultured in a 37°C, 5% CO2 cell culture incubator for 24h. The cell scratches at 0h and 24h were recorded using a microscope (in order to minimize the error caused by cell proliferation, the culture medium used after scraping the cells in this experiment only contained 1% FBS). The results of the cell scratch experiment are shown in Figure 2. Figure 17 As shown in Figure 2, the quantitative results of the cell scratch test are as follows: Figure 18 As shown in the figure, the wound closure rate was significantly increased after treatment with recombinant human TFF3 protein, indicating that recombinant human TFF3 protein has the effect of promoting wound healing.

[0153] (3) Conduct Transwell migration experiments

[0154] The culture medium in the upper chamber of Transwell did not contain FBS, while the culture medium in the lower chamber contained 10% FBS. HCEC cells were digested and seeded in the upper chamber, with 5×10 cells per chamber. 4 The culture medium in the upper chamber was a culture medium without recombinant human TFF3 protein and a culture medium containing 10 μg / mL recombinant human TFF3 protein, respectively. After inoculation, the cells were cultured in a cell culture incubator at 37°C and 5% CO2 for 30 hours. Non-migrated cells were wiped off with a cotton swab, taking care not to damage the chamber membrane. The cells were washed twice with 1×PBS and fixed with 70% ethanol for 25 minutes. After fixation, the cells were stained with crystal violet for 20 minutes. The excess crystal violet was washed off with PBS and photographed under a microscope. The results of the Transwell migration experiment are shown in Figure 2. Figure 19 The results of the Transwell migration assay were quantified as shown in Figure 20 As shown, the number of cells migrating across the membrane increased significantly when TFF3 was present in the culture medium, demonstrating that recombinant human TFF3 protein has the ability to promote wound healing and cell migration.

[0155] It can be concluded that this test example verifies that the recombinant human TFF3 protein in the eye drops containing recombinant human TFF3 protein has the effect of promoting wound healing and cell migration, and at the same time verifies the speculative conclusion in Test Example 6, confirming that the target of TFF3 in treating dry eye is on the ocular epidermal cells.

[0156] Test Example 8

[0157] This test example tests the inhibition of AIM2, IFI16, and NLRC4 mRNA expression levels by recombinant human TFF3 protein. The test process is as follows:

[0158] Cells were seeded in six-well plates. After the cells adhered, HCEC corneal epithelial cells were treated with culture medium containing or without recombinant human TFF3 protein at 10 μg / mL for 24 hours. Total RNA was then extracted and reverse transcription and real-time quantitative fluorescence PCR were performed twice to observe the effect of TFF3 on the mRNA expression levels of AIM2, IFI16, and NLRC4.

[0159] The steps for extracting total RNA from cells are as follows (the entire operation is performed in the absence of enzymes):

[0160] a. Add 1 mL of PBS to each well to wash the cells and discard the PBS;

[0161] b. Add 500 μL of Trizol to each well, shake gently on ice for 10 minutes, and pipette the liquid into an EP tube;

[0162] c. Add 100 μL of chloroform to each tube, shake gently, and place on ice for 2-3 minutes;

[0163] d. Centrifuge at 4°C, 12,000 g, for 10 min and transfer the supernatant to a new tube;

[0164] e. Add 300 μL of isopropanol to each tube and place in a -80°C refrigerator for 2 hours;

[0165] f. Centrifuge at 4°C, 12,000 g, 20 min, and discard the supernatant.

[0166] g. Wash the RNA by adding 1 mL of 85% ice-cold ethanol twice, then aspirate the supernatant and air dry.

[0167] h. Preheat DEPC water at 37°C, add appropriate amount of DEPC water to dissolve RNA and measure the concentration.

[0168] The first reverse transcription was performed by placing reverse transcription system 1 in a PCR instrument at 70°C for 10 minutes and then rapidly cooling on ice for 2 minutes. The second reverse transcription was performed by mixing system 1 and system 2 and then placing them in a PCR instrument. The procedure is shown in Table 9, and the reverse transcription system is shown in Table 8.

[0169] Table 8 Reverse transcription system composition

[0170]

[0171]

[0172] Table 9 Second reverse transcription procedure

[0173] Reaction temperature Reaction time 16℃ 30min 42℃ 60min 70℃ 15min

[0174] The real-time quantitative fluorescence PCR system and procedure are shown in Tables 10 and 11. The qPCR primer pairs used are AIM2-F / R, IFI16-F / R, and NLRC4-F / R, respectively. Their corresponding nucleotide sequences are shown in SEQ ID NOs. 7 to 12, respectively. See Table 12 for details.

[0175] Table 10 qPCR system

[0176] Reagents Dosage TBGreen 10 μL Upstream primers AIM2-F / IFI16-F / NLRC4-F (10 μM) 0.4μL Downstream primers AIM2-R / IFI16-R / NLRC4-R (10 μM) 0.4μL ROX 0.4μL cDNA 1 μL <![CDATA[ddH2O]]> Add to 20 μL

[0177] Table 11 qPCR program

[0178]

[0179] Table 12 qPCR primer sequence list

[0180] serial number name sequence SEQ ID NO.7 AIM2-F 5'-AAGATCAACACGCTTCAAACTCAG-3' SEQ ID NO.8 AIM2-R 5'-TTCATTGTGTCCTCGTTTCTAACC-3' SEQ ID NO.9 IFI16-F 5'-TGATGTGAATGCTGACCGAAAC-3' SEQ ID NO.10 IFI16-R 5'-CTTCCATCTTCCCGTATTATCTTGTAT-3' SEQ ID NO.11 NLRC4-F 5'-TTGGCGGGAAATCGTGTG-3' SEQ ID NO.12 NLRC4-R 5'-TTCTGACTAATGCTGGATCAGGTAG-3'

[0181] The final real-time quantitative fluorescence PCR results are as follows Figure 21 As shown, Figure 21 a is the amplification curve of AIM2, Figure 21 b is the amplification curve of IFI16, Figure 21 c is the amplification curve of NLRC4, Figure 21 d is the analysis of the relative mRNA expression levels of AIM2, IFI16 and NLRC4 without and with TFF3. As can be seen from the figure, TFF3 can reduce the mRNA expression levels of AIM2, IFI16 and NLRC4 in HCEC cells.

[0182] Test Example 9

[0183] Inflammasomes are a class of large multi-protein complexes composed of pattern recognition receptors (PRRs) such as NOD-like receptor family members NLRP1 and NLRP3, or ALR family members AIM2 and IFI16, CARD-containing apoptosis-associated speck-like protein (ASC), and caspase-1. When cells are damaged, inflammasomes are activated, caspase-1 is activated, and cells release pro-inflammatory factors, thereby triggering a series of inflammatory responses. Inflammasome assembly is an upstream event of the inflammatory response. When inflammasomes assemble, ASC assembles to form "ASC spots" and can be observed using confocal fluorescence microscopy. This test example uses immunofluorescence experiments and protein immunoblotting experiments to analyze the inhibition of inflammasome activation in HCEC cells under hypertonic conditions by human recombinant TFF3 protein to verify the inflammation-suppressing function of human recombinant TFF3 protein. The test process is as follows:

[0184] (1) Cell treatment before immunofluorescence experiment:

[0185] Place the slides in a 12-well plate and add 1×10 4 Cells were inoculated on slides, and 5 slides were inoculated in total. Subsequent experiments were performed after the cells adhered to the wall. The 5 slides were divided into control group, hypertonic treatment 16h (TFF3-) group, hypertonic treatment 16h (TFF3+) group, hypertonic treatment 24h (TFF3-) group, and hypertonic treatment 24h (TFF3+) group. The cells in control group were not treated with any treatment. The cells in hypertonic treatment 16h (TFF3-) group were cultured with 550mOsM hypertonic medium without TFF3 for 16 h. The cells in hypertonic treatment 16h (TFF3+) group were cultured with 550mOsM hypertonic medium containing 10μg / mL TFF3 for 16 h. The cells in hypertonic treatment 24h (TFF3-) group were cultured with 550mOsM hypertonic medium without TFF3 for 24 h. The cells in hypertonic treatment 24h (TFF3+) group were cultured with 10μg / mL The cells were cultured in TFF3's 550 mOsM hypertonic medium for 24 h. To block caspase activation, the cells were incubated with 20 μM zVAD-FMK pan-caspase inhibitor while undergoing hypertonic treatment.

[0186] (2) Immunofluorescence experiment:

[0187] a. After treatment, cells were washed twice with PBS;

[0188] b. Fix with 4% paraformaldehyde for 15 minutes and wash twice with PBS;

[0189] c. Incubate with 0.3% Triton X-100 at room temperature for 15 minutes to permeabilize the cell membrane, and then wash twice with PBS;

[0190] d. Block with 5% BSA for 1 hour;

[0191] e. Incubate with ASC antibody at 4°C overnight;

[0192] f. Recover the primary antibody to room temperature and then wash twice with PBS;

[0193] g. Incubate with FITC secondary antibody at room temperature for 1 hour, then wash twice with PBS;

[0194] h. DAPI staining of nuclei for 10 min, followed by PBS wash twice;

[0195] i. Mount the slides with 90% glycerol and take pictures using a confocal fluorescence microscope.

[0196] ASC spot staining results Figure 22 As shown, Figure 23This is the statistics of the ASC spot positivity rate of cells in the control group, hypertonic treatment 16h (TFF3-) group, and hypertonic treatment 24h (TFF3-) group (the positive rate of ASC spots in corneal epithelial cells under normal conditions and hypertonic conditions). It can be seen from the figure that hypertonic treatment for 16h and 24h can induce the formation of ASC spots. Figure 24 This is a statistical analysis of the ASC spot positivity rate of cells in the hypertonic treatment 16h (TFF3-) group, hypertonic treatment 16h (TFF3+) group, hypertonic treatment 24h (TFF3-) group and hypertonic treatment 24h (TFF3+) group (the positive rate of ASC spots in corneal epithelial cells before and after TFF3 treatment under hypertonic conditions). It can be concluded from the figure that TFF3 significantly reduces the formation of ASC spots.

[0197] (3) Western blotting experiment:

[0198] 3 × 10 cells were seeded per well in a six-well plate. 5 After the cells adhered, they were treated with different conditions, including control group, 550mOsM hypertonic medium treatment group for 12 hours, 550mOsM hypertonic medium (containing 10μg / mL TFF3) treatment group for 12 hours, 550mOsM hypertonic medium treatment group for 24 hours, and 550mOsM hypertonic medium (containing 10μg / mL TFF3) treatment group for 24 hours. After the cell treatment, protein extraction, protein concentration determination, protein sample preparation and Western Blot experiment were performed.

[0199] Western blotting results Figure 25 、 26 As shown, in Figure 25 In the experiment, hypertonic treatment for 12h and 24h would lead to the increase of P10, thus causing inflammation. Figure 26 Compared with the control group, hypertonic treatment led to increased expression levels of IFI16, AIM2, and P10 proteins, but TFF3 effectively inhibited the increase in expression levels of IFI16, AIM2, and P10 proteins. Figure 22 、 23 , 24 , 25 , 26 , it can be concluded that TFF3 can effectively inhibit inflammasome assembly and activation.

[0200] Test Example 10

[0201] This test example uses flow cytometry to detect whether recombinant human TFF3 protein affects HCEC cell apoptosis under hypertonic conditions. The detection process is as follows:

[0202] First, cells were treated and seeded in 6-well plates, with 2 × 10 5The cells were cultured for 12 h in a 550 mOsM hypertonic medium without TFF3 for 12 h, the cells were cultured for 12 h in a 550 mOsM hypertonic medium with 10 μg / mL TFF3 for 12 h, the cells were cultured for 24 h in a 550 mOsM hypertonic medium with 10 μg / mL TFF3 for 24 h, and the cells were cultured for 24 h in a 550 mOsM hypertonic medium with 10 μg / mL TFF3 for 24 h.

[0203] Then, the cells were digested with EDTA-free trypsin and centrifuged, and the cells were resuspended in binding buffer to a concentration of 10 5 Take 100 μL of the single-cell suspension with a concentration of 10 cells / mL for FITC and PI staining. After staining, add 250 μL of Binding Buffer to each tube, mix well, and measure on the instrument.

[0204] The results of cell apoptosis Figure 27 As shown, we can see that in the two hypertonic treatment groups of 12h and 24h, the addition of TFF3 can inhibit hypertonicity-induced HCEC cell apoptosis.

[0205] In summary, it can be concluded that the eye drops containing recombinant protein provided by the present invention can be used to treat dry eye, can promote wound healing and cell migration, have the effects of inhibiting inflammation and inhibiting cell apoptosis, can act on multiple targets simultaneously, thereby simultaneously improving tear film stability and inhibiting ocular surface inflammation, breaking the vicious cycle of dry eye, and thus treating dry eye more comprehensively and effectively.

[0206] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention may be implemented in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the present invention is defined by the appended claims rather than the foregoing description. It is intended that all variations that fall within the meaning and range of equivalents of the claims be embraced within the present invention. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

[0207] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any minor modifications, equivalent replacements, and improvements made to the above embodiments based on the technical essence of the present invention shall be included in the scope of protection of the technical solution of the present invention.

Claims

1. An eye drop containing a recombinant protein, characterized in that: The invention comprises the following components: recombinant human TFF3 protein, osmotic pressure regulator, pH regulator, thickener, surfactant, protective agent and water for injection.

2. The eye drops containing recombinant protein according to claim 1, characterized in that Calculated by mass percentage, the composition includes the following components: 0.01% to 1% recombinant human TFF3 protein, 0.1% to 1% osmotic pressure regulator, 0.08% to 2% pH regulator, 0.05% to 0.15% thickener, 0.01% to 0.1% surfactant, 0.01% to 0.1% protective agent and the balance water for injection.

3. The eye drops containing recombinant protein according to claim 1 or 2, characterized in that The osmotic pressure regulator is at least one of sodium chloride, potassium chloride or mannitol; the pH regulator is at least one of sodium dihydrogen phosphate, disodium hydrogen phosphate or boric acid; the thickener is at least one of carboxymethyl cellulose, hydroxypropyl methylcellulose or povidone; the surfactant is at least one of poloxamer 188, Tween or tyloxapol; and the protective agent is at least one of disodium edetate, sodium citrate or condensed sodium phosphate.

4. A method for preparing the eye drops containing recombinant protein according to claim 1 or 2, characterized in that: The following steps are involved: S1. Prepare recombinant human TFF3 protein using recombinant protein expression technology; S2. Dissolve the formulated amount of osmotic pressure regulator, pH regulator, thickener, surfactant, and protective agent in the formulated amount of water for injection, and sterilize by high pressure after complete dissolution to obtain a solution; S3. Add the recombinant human TFF3 protein obtained in S1 to the dissolved solution obtained in S2 in proportion and mix them evenly. After removing endotoxin, sterilize the solution through a filter membrane to finally obtain the eye drops containing the recombinant protein.

5. The eye drops containing recombinant protein according to claim 4, characterized in that The method for removing endotoxin in step S3 is to use an endotoxin removal kit or to remove it through a column; the pore size of the filter membrane is 0.22 μm.

6. A method for preparing recombinant human TFF3 protein in the recombinant protein-containing eye drops according to claim 1 or 2, characterized in that: Including the construction process of recombinant plasmid pGEX-5X-1-TFF3, protein induction expression process and TFF3 protein purification process; The construction process of the recombinant plasmid pGEX-5X-1-TFF3 is to use restriction endonucleases to double-digest the pGEX-5X-1 and TFF3 target gene fragments, and then connect the TFF3 target gene fragment to the pGEX-5X-1 linear expression vector through the restriction endonuclease cutting site; The restriction endonucleases are EcoR I and Not I, the double enzyme digestion temperature is 37° C., and the time is 1 h; the ligation temperature is 16° C., and the time is 16 h.

7. The method for preparing the recombinant human TFF3 protein according to claim 6, characterized in that: The ligation system used for the ligation includes a pGEX-5X-1 vector, a TFF3 target gene fragment, T4 DNA ligase, and a 10×T4 DNA ligase buffer; the molar ratio of the TFF3 target gene fragment to the pGEX-5X-1 vector is 1:

10.

8. The method for preparing the recombinant human TFF3 protein according to claim 6, wherein: The nucleotide sequence of the TFF3 target gene fragment is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.

6.

9. The method for preparing the recombinant human TFF3 protein according to claim 6, wherein: The protein induction expression process is as follows: the recombinant plasmid pGEX-5X-1-TFF3 is transferred into Escherichia coli BL21 to obtain a BL21 recombinant strain, and then IPTG is used to induce expression to obtain bacteria containing recombinant human TFF3 protein; the concentration of the IPTG is 0.5mM to 4mM, and the induction time is 1 to 8h.

10. Use of the eye drops containing the recombinant protein according to claim 1 or 2 in the preparation of a drug for treating dry eye.

Images