Method for separating and culturing mouse palate center seam stem cells

Abstract

The invention relates to a method for separating and culturing mouse palate center seam stem cells, and belongs to the technical field of stem cell separation and culture. The method comprises the following steps: S1, separating maxillary tissues of a 3-5-day-old mouse, retaining a palate center seam and tissues on two sides of the palate center seam, and tearing the tissues on the two sides along the palate center seam to obtain unilateral palate center seam tissues; s2, using a culture medium containing serum, antibiotics and growth factors to culture the unilateral palate center seam tissue in the step S1 for 7 days or less to obtain primary mouse palate center seam stem cells; the growth factors comprise at least one of epidermal growth factors, fibroblast growth factors and transforming growth factors; and S3, carrying out subculture on the primary mouse middle palate seam stem cells in the step S2 to obtain subcultured mouse middle palate seam stem cells. According to the method, the experiment time is greatly shortened, the extracted palate central seam stem cells are high in stemness expression and convenient to operate, and a basis is provided for repairing congenital development malformation such as cleft palate.

Description

Technical Field

[0001] The present invention relates to the technical field of stem cell separation and culture, and in particular to a method for isolating and culturing mouse palatal suture stem cells. Background Art

[0002] The isolation and culture of mouse stem cells is fundamental to many biological experiments. Existing techniques primarily isolate and culture mesenchymal stem cells (MSCs) from mouse long bone marrow and other tissues. The most similar technique to this one uses the midline suture of the skull of newborn mice for extraction and culture of suture stem cells (SuSCs). The isolation and culture process involves incising the skin and subcutaneous tissue, removing the attached connective tissue and periosteum, separating the suture from the dura mater, cutting the bone fragments from the suture area into small pieces, and inoculating them into culture dishes. Primary suture stem cells are then allowed to adhere for 9–12 days before being passaged.

[0003] However, palatal suture stem cells and cranial suture stem cells have different biological characteristics. For example, the existing bone suture stem cell extraction method is often used to extract palatal suture stem cells, but it has the following disadvantages:

[0004] (1) The anatomical location, biological characteristics and clinical applications of palatal suture stem cells and cranial suture stem cells are different. Cranial suture stem cells or mesenchymal stem cells cannot be used to replace palatal suture stem cells. The palatal suture is located between the palatine bones of the maxilla, which is different from the location of the cranial suture. Therefore, the characteristic gene expression and function between palatal suture stem cells and cranial suture stem cells are also different. Palatal suture stem cells tend to differentiate into osteoblasts, chondrocytes and mesenchymal stromal cells related to palate development, and play an important role in the repair of cleft lip and palate and palate regeneration. Cranial suture stem cells tend to differentiate into osteoblasts, periosteum cells and skull mesenchymal cells, and play a key role in skull growth, cranial suture closure and skull repair. Therefore, it is necessary to extract palatal suture stem cells for the repair of congenital developmental deformities such as cleft palate, and accurately reach the palate to further achieve accurate autologous healing.

[0005] (2) Existing methods for extracting stem cells from cranial sutures are not suitable for extracting stem cells from the palatal suture because the tissues at the cranial sutures are relatively loose. When extracting stem cells from the cranial sutures, the skin, subcutaneous tissue, connective tissue, and dura mater can be removed, leaving only the bone tissue of the sutures for culturing stem cells from the cranial sutures. However, the tissues at the palatal sutures are dense, making it impossible to separate the mucosa, connective tissue, periosteum, and bone tissue. Therefore, it is impossible to separate the bone tissue of the palatal suture alone. Therefore, the extraction of stem cells from the palatal sutures is difficult and the purity is affected. Therefore, the culture method for stem cells from cranial sutures is not suitable for extracting stem cells from the palatal sutures. Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a simple and efficient method for isolating and culturing palatal suture stem cells.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] A method for isolating and culturing mouse palatal suture stem cells comprises the following steps:

[0009] S1: Isolate the maxillary tissue of 3-5 day old mice, keep the palatal suture and the tissues on both sides, tear the tissues on both sides along the palatal suture to obtain the unilateral palatal suture tissue;

[0010] S2: culturing the unilateral palatal suture tissue obtained in step S1 for less than 7 days using a culture medium containing serum, antibiotics, and growth factors to obtain primary mouse palatal suture stem cells; the growth factors include at least one of epidermal growth factor, fibroblast growth factor, and transforming growth factor;

[0011] S3: Subculture the primary mouse palatal raphe stem cells from step S2 to obtain subcultured mouse palatal raphe stem cells.

[0012] Primary cells exhibited higher stemness at 7 days of culture. During the first 7 days of adherent culture, stem cells primarily crawled out of the palatal suture. After 7 days, other cells began to crawl out, affecting the stemness and purity of the palatal suture stem cells. Palatal suture stem cells isolated from mice younger than 5 days of age exhibited significantly higher stemness than those older than 5 days of age.

[0013] In a specific embodiment of the present invention, the mice in step S1 are 5 days old.

[0014] Furthermore, in step S1, the mice are disinfected and killed by immersing them in ethanol with a concentration greater than 75% v / v, preferably with an ethanol concentration of 75% v / v.

[0015] Furthermore, the soaking time is 1 to 2 minutes, preferably 2 minutes. Note that the soaking time should not be too long to prevent affecting the activity of the palatal suture stem cells.

[0016] Furthermore, in step S1, the midpalatal suture and 1-2 mm of tissue on either side are retained. The tissue at the midpalatal suture is dense, making it difficult to separate the mucosa, connective tissue, periosteum, and bone tissue. Therefore, it is impossible to isolate the bone tissue at the midpalatal suture alone. Therefore, it is necessary to retain the midpalatal suture and the tissue on either side before induction culture.

[0017] In a specific embodiment of the present invention, in step S1, the median palate suture and 2 mm of tissue on both sides thereof are retained. The maxillary tissue is trimmed under a stereomicroscope, and the median palate suture and 2 mm of tissue on both sides thereof are retained. Under a stereomicroscope, the median palate suture is highly translucent, and the tissues on both sides are low translucent, making them easier to distinguish. Only the median palate suture and 2 mm of tissue on both sides thereof are retained, and the remaining tissues including the maxillary sinus are cut off. Note that other tissues should be minimized in this step to reduce contamination from other cells. Note that this step should ensure that only separation is made from the median palate suture, and at the same time, do not cut the tissue into pieces to reduce contamination from other cells.

[0018] Furthermore, in step S1, the operation is performed under a stereo microscope to reduce tissue damage during the extraction of stem cells from the palatal suture.

[0019] Furthermore, the stereo microscope used in the present invention is a Leica M80 stereo microscope. It is equipped with a continuous zoom system and a cold light illumination system. During operation, the magnification is set at 16x to obtain a sufficiently clear view of the palatal suture structures and facilitate the identification of the palatal midline and suture boundaries. The procedure is performed under sterile conditions, with the laboratory bench equipped with a laminar flow clean bench. The operating area is thoroughly disinfected with 75% v / v ethanol, and all instruments are sterilized by autoclaving.

[0020] Furthermore, in step S2, the concentration of the growth factor is 5-20 ng / mL.

[0021] Preferably, in step S2, the growth factor is 10 ng / mL of epidermal growth factor, which can significantly enhance the expression level of CD44 in palatal suture stem cells and increase their ability to maintain stemness.

[0022] Furthermore, in step S2, during culturing, the unilateral palatal suture tissue is attached to the bottom of the culture dish with the palatal suture facing downward to ensure adherence to the wall.

[0023] Furthermore, in step S2, the culture time is 4 to 7 days. During the culture process, the culture medium should be moved as little as possible to prevent the unilateral palatal suture tissue from moving and floating. When adding the culture medium, the movements should be very gentle to avoid scouring the unilateral palatal suture tissue to prevent it from moving and floating.

[0024] In a specific embodiment of the present invention, in step S2, the culture time is 7 days. It can be seen that cells crawl out around the unilateral palatal suture tissue and are densely arranged in a spindle shape.

[0025] Furthermore, in step S2, the serum includes fetal bovine serum.

[0026] Furthermore, in step S2, the concentration of fetal bovine serum is 5-20% v / v, preferably 10% v / v.

[0027] Furthermore, in step S2, the antibiotic includes at least one of penicillin, streptomycin and amphotericin B.

[0028] Furthermore, in step S2, the concentration of penicillin is 50-200 U / mL, the concentration of streptomycin is 50-200 μg / mL, and the concentration of amphotericin B is 0.125-0.5 μg / mL.

[0029] Preferably, in step S2, the concentration of penicillin is 100 U / mL, the concentration of streptomycin is 100 μg / mL, and the concentration of amphotericin B is 0.25 μg / mL.

[0030] The antibiotics penicillin and streptomycin have a combined effective antimicrobial effect against both gram-positive and gram-negative bacteria and are used to prevent bacterial contamination of cell cultures. Amphotericin B inhibits multicellular fungi and yeasts and can be used to prevent fungal contamination of cell cultures.

[0031] Furthermore, in step S3, the primary mouse palatal raphe stem cells in step S2 are washed with PBS buffer and then digested.

[0032] Furthermore, in step S3, the primary mouse palatal suture stem cells are digested with a digestive solution containing trypsin and ethylenediaminetetraacetic acid and then subcultured.

[0033] Furthermore, in step S3, the concentration of pancreatic enzyme is 0.1-0.5 mg / mL, and the concentration of ethylenediaminetetraacetic acid is 0.01-0.25 mg / mL.

[0034] Preferably, the concentration of pancreatin is 0.25 mg / mL, and the concentration of EDTA is 0.02 mg / mL.

[0035] Furthermore, in step S3, the ratio of the digestion fluid to the diameter of the culture dish of the unilateral palatal suture tissue in the culture step is 0.5-2 mL:10 cm, preferably 1 mL:10 cm.

[0036] Furthermore, in step S3, the digestion time is 1 to 2 minutes, preferably 1 minute, and 60% to 70% of the cells can be observed floating under a microscope. Note that the digestion time should not be too long to prevent affecting the activity of the palatal suture stem cells.

[0037] Furthermore, in step S3, after digestion, the digestion is terminated using the culture medium described in step S2, and the volume of the culture medium used to terminate the digestion is the same as that of the digestion solution.

[0038] Furthermore, in step S3, after digestion, centrifugation is performed at 300-1500 rpm for 3-10 minutes, the supernatant is discarded, and the palatal suture stem cells are collected; preferably, centrifugation is performed at 1000 rpm for 5 minutes.

[0039] Furthermore, in step S3, the palatal raphe stem cells are resuspended in the culture medium of step S2 to obtain a palatal raphe stem cell suspension.

[0040] Furthermore, in step S3, during subculture, the seeding density of mouse palatal suture stem cells is not less than 1×10 4 pieces / cm 2 Cells that are too sparse are not conducive to cell proliferation, and cells that are too dense are also not conducive to cell proliferation.

[0041] Furthermore, the seeding density of mouse palatal suture stem cells was 1-4×10 4 pieces / cm 2 .

[0042] Furthermore, the seeding density of mouse palatal suture stem cells was 2-4×10 4 pieces / cm 2 .

[0043] Furthermore, in step S3, the culture time for each subculture is 2 to 3 days, preferably 3 days.

[0044] Furthermore, in step S3, the number of subculture generations is within 5 generations, so that good cell stemness can be maintained.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] (1) Because the tissue at the palatal suture is dense, it is impossible to separate the bone tissue at the suture alone. This makes it difficult to extract stem cells using cranial suture methods, and the purity of palatal suture stem cells is extremely low after 9 to 12 days of culture. The method of the present invention does not require the removal of the palatal mucosa and submucosal tissue. Instead, the palatal tissue is directly torn apart at the palatal suture under a stereomicroscope to separate the middle suture portion of the palatal suture. During adherent culture, the palatal suture stem cells can be ensured to crawl out of the suture. The purity of the palatal suture stem cells is high on the 7th day of adherent culture. This provides a simple and efficient palatal suture stem cell separation and extraction technology.

[0047] (2) The stemness of palatal suture stem cells extracted from mice younger than 5 days old was significantly higher than that of those extracted from mice older than 5 days old. The method of the present invention significantly shortens experimental time, and the extracted palatal suture stem cells have high stemness expression and are easy to operate, providing a foundation for the repair of congenital developmental deformities such as cleft palate.

[0048] (3) The addition of 10 ng / mL EGF to the culture medium of the present invention significantly enhanced the expression level of CD44 and its ability to maintain stemness. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Schematic diagram of separating the midpalatal suture tissue.

[0050] Figure 2 To separate the palatal suture tissue under a stereomicroscope.

[0051] Figure 3 For adherent culture, culture the palatal suture tissue.

[0052] Figure 4 The growth of palatal suture stem cells after adherent culture of palatal suture tissue.

[0053] Figure 5 Figure 3. Effect of adherent culture time on the stemness and purity of palatal suture stem cells. Figure A represents adherent culture for 7 days; Figure B represents adherent culture for 8 days.

[0054] Figure 6 Figure 2 shows the effect of mouse age on the stemness of palatal suture stem cells. A is a 5-day-old mouse; B is a 6-day-old mouse.

[0055] Figure 7 The effects of different concentrations of EGF, FGF and TGF-β on the expression level of CD44 in palatal suture stem cells.

[0056] Figure 8 Figure 2 shows the differences in mRNA expression between palatal suture stem cells and cranial suture stem cells. A represents BMP2, B represents Runx2, C represents Wnt3a, and D represents Axin2.

[0057] Figure 9 The effects of different concentrations of EGF, FGF and TGF-β on the expression level of CD44 in cranial suture stem cells. DETAILED DESCRIPTION

[0058] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below with reference to specific examples. Other materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0059] Example 1 Isolation, Extraction and Culture of Palatal Rape Tissue and Palatal Rape Stem Cells

[0060] The following steps are performed in a clean bench:

[0061] 1. Take three 3-day-old newborn mice and place them in a 50 mL centrifuge tube containing 75% (v / v) ethanol for 2 minutes to disinfect the newborn mice and then sacrifice them. Be careful not to soak in alcohol for too long to prevent affecting the activity of the palatal suture stem cells.

[0062] 2. Use ophthalmic forceps and ophthalmic scissors to dissect and separate the maxillary tissue from the mouth of the mouse treated in step 1. Note that this process should be gentle, as mouse tissue is fragile and easily broken.

[0063] 3. Rinse the maxillary tissue isolated in step 2 in a six-well plate containing PBS (phosphate-buffered saline) containing 1% (w / v) tertiary antibody (Gibco's penicillin-streptomycin-amphotericin B mixed solution (100X tertiary antibody), a mixture of 10,000 U / mL penicillin, 10,000 μg / mL streptomycin, and 25 μg / mL amphotericin B) to clean blood and other tissue adherent to the maxillary tissue.

[0064] 4. A stereo microscope (Leica M80) with a continuous zoom system and cold light illumination was used. The magnification was set at 16× during the procedure to obtain a sufficiently clear view of the palatal suture structures and facilitate the identification of the palatal midline and suture boundaries. The procedure was performed under aseptic conditions using a laminar flow clean bench. The operating area was thoroughly disinfected with 75% (v / v) ethanol, and all instruments were autoclaved.

[0065] Trim the maxillary tissue processed in step 3 under a stereomicroscope, retaining the palatal suture and 2 mm of tissue on either side to obtain the trimmed palatal suture tissue. Under a stereomicroscope, the palatal suture is highly translucent, while the tissue on either side is less translucent, making it easier to distinguish. Only the palatal suture and 2 mm of tissue on either side are retained, while the remaining tissue, including the maxillary sinus, is removed. Note that during this step, minimal other tissue should be present to minimize contamination from other cells.

[0066] 5. If Figure 1 and Figure 2 As shown, under a stereomicroscope, take the palatal suture tissue trimmed in step 4, gently grasp the tissue on both sides of the palatal suture with two ophthalmic forceps, and gently pull to separate the intact palatal suture tissue from the suture. If separation from the suture is difficult, try blunt separation from the suture with ophthalmic forceps. Once a gap is created, tear the tissue apart with ophthalmic forceps to obtain the separated palatal suture tissue. Note that in this step, try to separate only from the palatal suture and do not cut the tissue into pieces to reduce contamination from other cells.

[0067] 6. If Figure 3 As shown, place the unilaterally separated palatal suture tissue from step 5 in a 100 mm culture dish. Place six pieces of unilateral palatal suture tissue per 100 mm dish and allow them to adhere to the bottom of the dish for 10 minutes. Note that the dish should be placed with the palatal suture facing downward.

[0068] 7. Slowly and gently add 10 mL of complete DMEM (supplemented with 10% v / v fetal bovine serum, 1% w / v triple antibody, and 10 ng / mL epidermal growth factor (EGF)) to the culture dish from step 6. Be very gentle when adding the culture medium to avoid rinsing the tissue blocks, which may cause them to float.

[0069] 8. Place the tissue and culture dish treated in step 7 in an incubator and culture them at 37°C, 5% CO2, and 95% humidity for 7 days. Avoid moving the culture medium during this period to prevent the tissue from floating.

[0070] 9. Observe the palatal suture tissue cultured in step 8 under an inverted microscope. Figure 4 As shown, cells can be seen crawling out around the tissue block and arranged densely in a spindle shape.

[0071] 10. Gently remove the culture medium and tissue fragments from step 8. Gently rinse the cells twice with 5 mL of PBS buffer. Add 1 mL of 0.25% Trypsin-EDTA (a solution containing 0.25 mg / mL trypsin and 0.02 mg / mL ethylenediaminetetraacetic acid) and incubate for 1 minute. Be careful not to overdo the digestion time to prevent affecting the activity of the palatal suture stem cells.

[0072] 11. Observe under a microscope that 60% to 70% of the cells are floating after digestion in step 10. Immediately add 1 mL of DMEM complete medium (supplemented with 10% v / v fetal bovine serum, 1% w / v triple antibody, and 10 ng / mL EGF) to stop the digestion reaction and gently rinse the culture dish (gently rinse off non-floating cells). Collect all the liquid in the culture dish into a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 min, and discard the supernatant.

[0073] 12. Resuspend the cell pellet from step 11 with 3 mL of DMEM complete medium (supplemented with 10% v / v fetal bovine serum, 1% w / v triple antibody, and 10 ng / mL EGF) to obtain a cell suspension. The cell number of the cell suspension was measured to be 1.2 × 10 5 The cell suspension was inoculated into a 60 mm culture dish and cultured in an incubator for 3 days. Be careful to resuspend gently to prevent cell breakage. Note that the inoculation density should be no less than 1×10 4 pieces / cm 2 , cells that are too sparse are not conducive to cell proliferation, and cells that are too dense are also not conducive to cell proliferation.

[0074] 13. Observe the cells cultured in step 12 under an inverted microscope. The cells basically cover the culture dish and the cell density should be 2.5×10 4 pieces / cm 2 To maintain cell stemness, it is recommended to use cells that have been passaged for less than 5 generations for subsequent cell experiments.

[0075] Example 2 Identification of cell stemness

[0076] 1. Cells cultured for 7 days and 8 days in step 8 of Example 1 were taken, digested and resuspended according to the method of steps 10 to 12 to obtain a cell suspension, 1 μL of anti-CD44 monoclonal antibody (CD44 is a cell surface glycoprotein, the dilution ratio is 1:200, that is, the anti-CD44 monoclonal antibody is diluted 200 times) and 1 μL of anti-Sca-1 monoclonal antibody (Sca-1 is stem cell antigen 1, the dilution ratio is 1:200, that is, the anti-Sca-1 monoclonal antibody is diluted 200 times) were added, and the suspension was incubated at room temperature in the dark for 20 minutes. After centrifugation at 250g for 5 minutes, the supernatant was discarded, and the cells were washed twice with PBS. The cells were resuspended in 400 μL of PBS and analyzed by flow cytometry.

[0077] When the first generation cells were cultured for 7 days ( Figure 5 A) is significantly higher than that of 8 days ( Figure 5 B) The stemness indicates that during the first 7 days of adherent culture, stem cells mainly crawl out, but after 7 days, other cells begin to crawl out, affecting the stemness.

[0078] 2. Newborn mice of 5 and 6 days old were taken, and palatal suture tissue was isolated, extracted and cultured according to the method of Example 1 to obtain palatal suture stem cells, and the stemness of the cells was identified according to the method of Step 1 of Example 2.

[0079] Mice younger than 5 days old ( Figure 6 A) The stemness of the extracted palatal suture stem cells was significantly higher than that of mice older than 5 days ( Figure 6 B) Stemness of extracted palatal suture stem cells.

[0080] Example 3 Effects of epidermal growth factor (EGF), fibroblast growth factor (FGF) and transforming growth factor-β (TGF-β) on the expression level of CD44 in palatal suture stem cells

[0081] In Example 1, the concentrations of EGF were set to 0, 5, 10 and 20 ng / mL, respectively, to explore the effects of different concentrations of EGF on the expression level of CD44 in palatal suture stem cells.

[0082] The EGF in Example 1 was replaced by FGF or TGF-β, and the effects of different concentrations (0, 5, 10 and 20 ng / mL) on the expression level of CD44 in palatal suture stem cells were investigated.

[0083] Flow cytometry was performed according to the method of Example 2 to obtain the expression levels of CD44 in palatal raphe stem cells under different conditions.

[0084] like Figure 7 As shown, CD44 +The cell ratio reached 98.5%, which significantly enhanced the expression of CD44 in palatal suture stem cells and increased their ability to maintain stemness. However, even with increased concentrations of FGF and TGF-β, the increase in CD44 expression was relatively limited, remaining in the range of 70-80%.

[0085] Example 4 Identification of mRNA Expression Differences between Palatal Raise Stem Cells and Cranial Raise Stem Cells

[0086] mRNA was extracted from palatal suture stem cells (palatal suture stem cells isolated and cultured according to the method of Example 1 and subcultured to the third generation) and cranial suture stem cells cultured by conventional methods, and then reverse transcribed into cDNA. TM qTR-PCR experiments were performed using the RTMaster Mix (Perfect Real Time) kit to detect and analyze the mRNA expression of BMP pathway-related genes (BMP2, Runx2) and Wnt pathway-related genes (Wnt3a, Axin2) in each cell line. The primers used are shown in Table 1.

[0087] Table 1

[0088] Gene Upstream primer Downstream primer BMP2 TCTTCCGGGAACAGATACAGG TGGTGTCCAATAGTCTGGTCA Runx2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA Wnt3a CTCCTCTCGGATACCTCTTAGTG CCAAGGACCACCAGATCGG Axin2 ATGAGTAGCGCCGTGTTAGTG GGGCATAGGTTTGGTGGACT

[0089] The conventional method for culturing cranial suture stem cells is:

[0090] Five-day-old newborn mice were placed in a 50 mL centrifuge tube containing 75% (v / v) ethanol and immersed for 3 minutes to disinfect the newborn mice and kill them at the same time.

[0091] Under sterile conditions, the skin and subcutaneous tissue were incised along the median suture of the mouse skull, and the attached connective tissue and periosteum were removed. Bone blocks of 1 mm on each side of the median suture were retained, carefully cut off, and separated from the dura mater to obtain separated bone blocks in the median suture area.

[0092] Rinse the isolated suture bone fragments repeatedly with PBS buffer, cut them into small pieces, and place them in α-DMEM medium supplemented with 10% (v / v) fetal bovine serum. Plate the fragments in a culture dish until the bone fragments are covered. Incubate the fragments in a 37°C, 5% CO2 incubator. Monitor the medium level every 4-5 hours and replenish it as needed. After 2-3 days of culture, cells will emerge from the central suture region of the fragments. Change the medium every 3 days. After 9-12 days of culture, when the cells reach 80%-90% confluence, aspirate the medium, rinse the cells 2-3 times with PBS, add 1 mL of 0.25% Trypsin-EDTA, and subculture them at a 1:2 ratio (dilute the cells from the original culture dish equally between two duplicate dishes, achieving half the cell concentration in the original dish). Change the medium every 3 days thereafter, closely monitoring cell growth. Once the cells are nearly confluent, continue serial subculture and expansion using the above method to the third generation.

[0093] like Figure 8 A and Figure 8 As shown in B, palatal suture stem cells highly express BMP pathway-related genes (BMP2, Runx2), which are related to palate development. Figure 8 C and Figure 8 As shown in D, cranial suture stem cells highly express Wnt pathway-related genes (Wnt3a, Axin2), which are related to skull growth.

[0094] Comparative Example 1 Effects of Epidermal Growth Factor (EGF), Fibroblast Growth Factor (FGF) and Transforming Growth Factor-β (TGF-β) on the Expression Level of CD44 in Cranial Suture Stem Cells

[0095] In Example 4, different concentrations (0, 5, 10 and 20 ng / mL) of EGF, FGF and TGF-β were added to the culture medium for culturing cranial suture stem cells to explore the effects of different concentrations of EGF, FGF and TGF-β on the expression level of CD44 in cranial suture stem cells.

[0096] Flow cytometry was performed according to the method of Example 2 to obtain the expression levels of CD44 in craniosynostosis stem cells under different conditions.

[0097] like Figure 9 As shown, there was no significant difference in the CD44 positive rate of cranial suture stem cells at different concentrations of EGF, FGF, and TGF-β. EGF has a specific effect in optimizing the activity of palatal suture stem cells, but has no significant promoting effect on cranial suture stem cells, suggesting that palatal suture tissue and palatal suture stem cells have tissue specificity.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for isolating and culturing mouse palatal suture stem cells, characterized in that: The following steps are involved: S1: Isolate the maxillary tissue of 3-5 day old mice, keep the palatal suture and the tissues on both sides, tear the tissues on both sides along the palatal suture to obtain the unilateral palatal suture tissue; S2: culturing the unilateral palatal suture tissue obtained in step S1 for less than 7 days using a culture medium containing serum, antibiotics, and growth factors to obtain primary mouse palatal suture stem cells; the growth factors include at least one of epidermal growth factor, fibroblast growth factor, and transforming growth factor; S3: Subculture the primary mouse palatal raphe stem cells from step S2 to obtain subcultured mouse palatal raphe stem cells.

2. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S1, the midpalatal suture and 1 to 2 mm of tissue on both sides are retained.

3. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S2, the concentration of the growth factor is 5-20 ng / mL.

4. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S2, during culture, the palatal suture is placed downward on the bottom of the culture dish.

5. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S2, the serum includes fetal bovine serum.

6. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S2, the antibiotic includes at least one of penicillin, streptomycin and amphotericin B.

7. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S3, the primary mouse palatal suture stem cells are digested with a digestive solution containing trypsin and ethylenediaminetetraacetic acid and then subcultured.

8. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S3, during subculture, the seeding density of mouse palatal suture stem cells should be no less than 1×10 4 pieces / cm 2 .

9. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S3, the culture time for each subculture is 2 to 3 days.

10. The method for isolating and culturing mouse palatal suture stem cells according to claim 1, wherein: In step S3, the number of subculture generations is within 5 generations.

Images