MiR-N153 and application thereof in regulating and controlling iron deficiency stress tolerance of woody plants

Abstract

The invention discloses miR-N153 and an application of the miR-N153 in regulating and controlling the iron deficiency stress tolerance of a woody plant. The miR-N153 responding to the iron deficiency response is identified in an iron deficiency stress transcriptome of neolamarckia cadamba for the first time, overexpression of the miR-N153 in the poplar can obviously increase the plant height of the poplar plant and obviously increase the root system, and under iron deficiency stress, the antioxidant activity and photosynthesis of the poplar overexpressed with the miR-N153 are obviously enhanced, the leaf chlorosis symptom is relieved, and the poplar overexpressed with the miR-N153 can be applied to the field of iron deficiency stress. The chlorophyll content and the like are also obviously improved. Therefore, the miR-N153 can be used for improving the iron deficiency stress resistance of fast-growing woody plants (such as poplar and the like) and is used for cultivating and improving stress-resistant materials of the woody plants.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and particularly relates to miR-N153 and application thereof in regulating iron deficiency stress tolerance of woody plants. Background Art

[0002] Iron is an essential trace element for life. As a cofactor for many enzymes, iron plays a crucial role in electron transport and is crucial for a wide range of biological processes. Iron deficiency in plants impairs the normal structure and development of chloroplasts, leading to reduced chlorophyll synthesis and, in turn, the appearance of iron-deficiency chlorosis in leaves (Broadley et al., 2012). Because iron in soil exists primarily as ferric iron, which is poorly utilized by plants, plant growth is often limited by low iron availability, particularly in calcareous soils (Romera et al., 2004). Furthermore, excessive iron accumulation can be toxic to plants due to the production of reactive hydroxyl radicals (Guerinot and Yi, 1994). Consequently, plants have evolved complex mechanisms to maintain Fe homeostasis.

[0003] Iron (Fe) homeostasis is crucial for plant growth, development, and stress responses. Fe levels are tightly controlled by a complex regulatory network, with transcription factors (TFs) playing a central role. However, research on plant Fe homeostasis regulation has largely focused on the bHLH (basic helix-loop-helix) family of transcription factors, while research on regulatory mechanisms beyond bHLHs remains relatively scarce (Zhu et al., 2022). In addition to specific transcription factors, numerous plant hormones and messenger molecules regulate Fe-deficiency-induced morphological and physiological changes in plants in response to Fe deficiency (Rumen et al., 2012). Furthermore, Fe deficiency induces changes in miRNAs, lncRNAs, and circRNAs (Waters et al., 2012). Poplar, an important fast-growing tree species, is often exposed to Fe-deficiency stress in calcareous soils or high pH environments. Summary of the Invention

[0004] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a miR-N153.

[0005] Another object of the present invention is to provide the use of miR-N153 in regulating iron deficiency stress tolerance in woody plants.

[0006] Another object of the present invention is to provide a method for improving the tolerance of woody plants to iron deficiency stress.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A miR-N153, whose nucleotide sequence is any of the following sequences:

[0009] (a) a precursor sequence having a nucleotide sequence as shown in SEQ ID NO. 1;

[0010] (b) The nucleotide sequence is the mature sequence shown in SEQ ID NO. 2 (ATGAAGTGTTTGGGGGAACTC).

[0011] An expression cassette, recombinant expression vector or recombinant bacteria containing the miR-N153.

[0012] The recombinant expression vector is an expression vector containing a 35S promoter; preferably, the expression vector pK2GW7.

[0013] The recombinant bacteria is preferably Agrobacterium; more preferably Agrobacterium GV3101.

[0014] The miR-N153, and the use of an expression cassette, a recombinant expression vector and / or a recombinant bacterium containing the miR-N153 in regulating the iron deficiency stress tolerance of woody plants.

[0015] The regulation causes the leaves of woody plants to lose green more slowly under iron deficiency stress, and enhances antioxidant enzyme activity and photosynthesis by overexpressing miR-N153, thereby improving the iron deficiency stress tolerance of woody plants.

[0016] The woody plants include yellow beam wood and poplar; preferably poplar; more preferably 84K poplar.

[0017] The miR-N153, and the use of an expression cassette, a recombinant expression vector and / or a recombinant bacterium containing the miR-N153 in breeding or improving woody plants resistant to iron deficiency stress (preparing transgenic plants).

[0018] The woody plants include yellow beam wood and poplar; preferably poplar; more preferably 84K poplar.

[0019] A method for improving the iron deficiency stress tolerance of woody plants by overexpressing miR-N153, specifically comprising the following steps:

[0020] The precursor sequence of miR-N153 as shown in SEQ ID NO.1 is cloned into an overexpression vector to obtain a recombinant expression vector; then the recombinant expression vector is transferred into woody plants through the Agrobacterium-mediated leaf disc method to obtain transgenic positive plants, thereby improving the iron deficiency stress tolerance of woody plants.

[0021] The overexpression vector is an overexpression vector containing a 35S promoter; preferably, the overexpression vector pK2GW7.

[0022] The woody plants include yellow beam wood and poplar; preferably poplar; more preferably 84K poplar.

[0023] The miR-N153 described in this study is a newly discovered miRNA that was expressed under early iron deficiency stress in the yellow beam wood. To validate the role of this miRNA in the growth and development of woody plants, and considering the imperfect genetic transformation system for yellow beam wood, the present invention used miR-N153 as the target gene and 84K poplar (Populus alba × Populus glandulosa) as the test material. MiR-N153 was introduced into 84K poplars via the Agrobacterium-mediated leaf disc method to obtain transgenic positive plants. After the transgenic plants were cultured in sand under iron deficiency, chlorophyll content, photosynthetic rate, chlorophyll fluorescence, enzyme activity, and related physiological conditions in the leaves of the transgenic plants were measured. These results showed that under iron deficiency stress, poplar plants overexpressing miR-N153 grew taller, had enhanced antioxidant enzyme activity, and experienced slower leaf chlorosis than wild-type plants. Chlorophyll content and photosynthesis were also significantly improved.

[0024] The present invention improves plant tolerance to iron deficiency stress by overexpressing miR-N153 in plants. The specific experimental method is as follows:

[0025] (1) Discovery of the novel miR-N153. Whole transcriptome sequencing was performed by extracting RNA from roots of Psoralea corylifolia treated hydroponically for 12 hours at two concentrations: 80 μM Fe (normal iron supply) and 0 μM Fe (iron deficiency stress). A statistical analysis of the differentially expressed miRNAs in seedlings treated with iron deficiency for 12 hours revealed one novel miR-153 (named miR-N153).

[0026] (2) Construction of miR-N153 overexpression vector and genetic transformation of poplar. The miR-N153 precursor sequence was cloned into the overexpression vector pK2GW7 containing the 35S promoter to generate 35S::miR-N153. miR-N153 was transformed into 84K poplar by Agrobacterium-mediated leaf disc method to obtain transgenic positive plants.

[0027] (3) Determination of the concentration of iron-stress nutrient solution for transgenic poplars in sand culture. When the nutrient solution concentration was 2 / 5MS, 84K poplars grew well and in normal condition. Therefore, the concentration of iron-stress nutrient solution for 84K poplars in sand culture was determined to be 2 / 5MS, which was set as CK (iron content was 14.68 mg·L -1 ).

[0028] (4) Phenotypic observation of transgenic poplars under different iron concentrations. Transgenic plants overexpressing miR-N153 were significantly taller than wild-type plants. When subjected to iron deficiency stress, transgenic poplars overexpressing miR-N153 were taller than wild-type plants and suffered less iron deficiency stress than wild-type plants.

[0029] (5) Determination of malondialdehyde and key antioxidant enzyme contents in transgenic poplars. Under iron deficiency stress, the MDA content in the overexpressed miR-N153 was lower than that in the wild type, but the SOD and POD activities were higher than those in the wild type.

[0030] (6) Determination of chlorophyll content in transgenic poplars. The chlorophyll a, chlorophyll b, total chlorophyll content, and carotenoid content of transgenic poplars overexpressing miR-N153 were higher than those of the wild type. However, under iron deficiency stress, the leaf albinism of transgenic poplars was weaker than that of the wild type, and the chlorophyll content was still higher than that of the wild type.

[0031] (7) Determination of photosynthetic rate of transgenic poplars. The net photosynthetic rate and light energy utilization efficiency of plants overexpressing miR-N153 were significantly increased. Under iron deficiency stress, the net photosynthetic rate, stomatal conductance, transpiration rate, water use efficiency, and light energy utilization efficiency of transgenic plants were significantly higher than those of the wild type.

[0032] (8) Determination of chlorophyll fluorescence parameters of transgenic poplars. After the transgenic plants and wild-type plants were treated with nutrient solutions with different iron contents for one month, the leaf color of the stressed plants began to differ significantly from that of the control group, and this difference became more significant as the treatment time increased. Similar to the results of the photosynthetic index determination, overexpression of miR-N153 enhanced the photosynthesis of 84K poplars. Under iron deficiency stress, the photosynthetic absorption efficiency of overexpressed miR-N153 increased.

[0033] The present invention has the following advantages and effects compared to the prior art:

[0034] 1. The present invention identified for the first time a new miR-N153 that responds to iron deficiency in the transcriptome of yellowwood under iron deficiency stress. Overexpressing this miRNA in poplars using biotechnology can significantly increase the height of poplar plants and significantly grow the root system. Under iron deficiency stress, the antioxidant activity and photosynthesis of poplars overexpressing miR-N153 were significantly enhanced, the symptoms of leaf chlorosis were alleviated (the leaves lost green more slowly than the wild type), and the chlorophyll content was also significantly increased. This miR-N153 can improve the tolerance of fast-growing woody plants to iron deficiency stress, providing clues to the impact on the growth and development of fast-growing woody plants. The transgenic plants obtained can be used in forest genetic improvement.

[0035] 2. miR-N153 in the present invention provides a new regulatory gene resource for improving poplar tolerance to iron deficiency stress, which can be used for the cultivation and improvement of woody plant stress-resistant materials and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The transcriptome analysis diagram of Psoralea corylifolia treated with iron deficiency; A is the DEGs (differentially expressed genes) bar graph; B: PCA principal component analysis.

[0037] Figure 2 This is a diagram showing the DNA molecular level identification results of poplars overexpressing miR-N153 (in the figure, lanes 1-15: 15 transgenic lines overexpressing miR-N153; WT: wild-type poplar; P: vector positive control; ddH2O: negative control; M: DNA Marker).

[0038] Figure 3 The figure shows the real-time fluorescence quantitative PCR results of poplar overexpressing miR-N153.

[0039] Figure 4 This is the growth phenotype of 84K poplar under different nutrient solution concentrations.

[0040] Figure 5 Figure 2 is the growth status of poplars overexpressing miR-N153 under iron deficiency stress; A is the growth status of OE-N153 and WT under CK (iron content of 14.68 mg·L -1 ) treatment; B is the phenotype of OE-N153 and WT under iron deficiency (-Fe) treatment; C is the plant height of OE-N153 and WT under CK and iron deficiency (-Fe) treatment.

[0041] Figure 6 The results of malondialdehyde and key antioxidant enzyme content determination in poplars overexpressing miR-N153 under iron deficiency stress; A is the MDA content; B is the SOD content; C is the POD content.

[0042] Figure 7 The figure shows the chlorophyll content measurement results of poplars overexpressing miR-N153 under iron deficiency stress; among them, A is the chlorophyll a content; B is the chlorophyll b content; C is the carotenoid content; and D is the total chlorophyll content.

[0043] Figure 8 The figure shows the results of photosynthetic rate measurement of poplars overexpressing miR-N153 under iron deficiency stress; where A is the net photosynthetic rate; B is the stomatal conductance; C is the intercellular carbon dioxide concentration; and D is the transpiration rate.

[0044] Figure 9This is the chlorophyll fluorescence imaging of poplar trees overexpressing miR-N153 under iron deficiency stress. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below with reference to the following examples, but the embodiments of the present invention are not limited thereto. Experimental methods in the following examples, where specific experimental conditions are not specified, generally followed conventional experimental conditions or those recommended by the manufacturer. Materials and reagents used were commercially available unless otherwise specified.

[0046] The yellow beam wood involved in the embodiment of the present invention is big-leaf yellow beam wood (scientific name: Anthocephalus macrophyllus), and 84K poplar (Populus alba×Populus glandulosa) is a poplar of the poplar school, both of which are conventional tree species in this field.

[0047] Example 1 Discovery of miR-N153

[0048] Whole transcriptome sequencing was performed by extracting RNA from roots of Psoralea corylifolia (seedling roots) treated with 80 μM Fe (normal iron supply) and 0 μM Fe (iron deficiency stress) for 12 hours (nutrient solution formula see Table 1). Statistical analysis of differentially expressed miRNAs in seedlings treated with iron deficiency for 12 hours revealed that only three were differentially expressed, and all were upregulated, one of which was a novel miR-153 (named miR-N153) ( Figure 1 ), whose precursor sequence is shown in SEQ ID NO.1 (the underlined mark is the miR-153 mature sequence):

[0049] TGTACAAAAAAGCAGGCTGTTCCCTTGAACACTTCATTGGGGGTCATTACTCTTTACCTCAAGGGCTAAAGAATGCGGCCTACTGAAGTGTTTGGGGGAACTCCGGGGTCCATTTGATACATGCCGGAATCTTGATG TATGCAGTTGTCTGCCTAACAACAGGCAACAGTACAGAGGATCAATTATAACGAGCCATCAGATGTCCCCCAGAGTTCCCTTGAACACTTCAATGGGGGCCATTGTCCTTTGCCTCCAGGGCTACAGAATGCTGCCTA ATGAAGTGTTTGGGGGAACTC ACCCAGCTTTCTTGTACA.

[0050] Table 1 Nutrient solution formula

[0051]

[0052] Example 2 Construction of miR-N153 overexpression vector

[0053] Full-length gene primers were designed based on the sequences in Example 1. The amplification primer sequences and TOPO backbone amplification primer sequences are shown in Table 2. The miR-N153 precursor sequence (SEQ ID NO. 1) was then used as a template and PCR amplified simultaneously with the TOPO vector of the gateway system using PrimeSTAR Max enzyme (Takara). The miR-N153 precursor sequence in Example 1 was cloned into the TOPO vector of the gateway system. The sequence was then cloned into the overexpression vector pK2GW7 containing the 35S promoter via LR reaction (Table 3) to obtain the overexpression vector 35S::miR-N153. The TOPO vector and the plant expression vector pK2GW7 were purchased from Thermo Fisher Scientific.

[0054] Table 2 PCR primer sequences

[0055]

[0056] Table 3LR reaction system

[0057]

[0058] Example 3 Obtaining transgenic plants overexpressing miR-N153

[0059] The overexpression vector 35S::miR-N153 obtained in Example 2 was transformed into the Agrobacterium strain (GV3101), cultured at 28°C to obtain single colonies, and positive clones were identified by colony PCR. Positive clones were picked and cultured in 100 mL of liquid LB medium containing spectinomycin (50 mg / ml) and rifampicin (50 mg / ml) resistance. The culture was shaken at 28°C and 200 rpm for 20 h until OD600 = 0.4. 100 mL of bacterial solution was centrifuged at 3500 rpm for 15 min, the supernatant was discarded, and the suspension (WPM449 2.41 g·L -1 + sucrose 20g·L -1 + acetosyringone AS 100 μM, pH 5.2) to fully suspend the bacteria to obtain a resuspension solution. Select the third to fifth expanded leaves of 84K poplar trees, approximately 30 days old. Score the back of the leaves several times and place them in the resuspension solution for 8-12 minutes, shaking them during the process. After infection, remove excess water with filter paper and transfer the leaves to co-cultivation medium (WPM449 2.4 g·L -1 + sucrose 20g·L -1 +Plant gel 3.5g·L -1+AS 100 μM, pH 5.9), and then cultured in the dark for 2 days before switching to differentiation screening medium (WPM449 2.41 g·L -1 + sucrose 20g·L -1 +Plant gel 3.5g·L -1 +Naphthaleneacetic acid NAA 0.05mg·L -1 +6-BA (6-benzylaminopurine) 0.5 mg·L -1 + pH 5.9 + Timentin 1ml (300mg ml -1 )+Kan 50mg·L -1 , pH 5.9) under light. Buds will appear after 15 to 20 days of cultivation. The buds that have been extracted from the stems will be transferred to differentiation screening medium to promote their growth. Finally, the large seedlings will be directly transferred to rooting screening medium (WPM MS519 2.2g·L -1 + sucrose 20g·L -1 + agar 7.5 g·L -1 +NAA0.05mg·L -1 +3-Indolebutyric acid IBA 0.02mg·L -1 +Timentin 1ml (300mg / ml) + Kan 50mg·L -1 The WPM449 and MS519 are WPM woody plant-specific culture media L449 and MS519, respectively, and are branded Phytotech. The plant gel is branded Sigma and can be obtained commercially.

[0060] The results of the early PCR showed that the transgenic poplars could amplify a single DNA target band, while the wild-type poplars did not amplify the specific target band. After testing, 15 transgenic lines overexpressing miR-N153 were obtained ( Figure 2 ), and named them OE-N153#1 to OE-N153#15. RNA was extracted from wild-type and transgenic positive plants, and reverse transcribed into cDNA using designed stem-loop primers (Table 4). Real-time fluorescence quantitative PCR was further used to identify the cDNA. The results showed that the expression levels of overexpressing OE-N153 lines #8 and #10 in 84K poplar were significantly increased ( Figure 3 Therefore, OE-N153#8 and OE-N153#10 were used as materials for subsequent research.

[0061] Table 4 Stem-loop primers for miRNAs

[0062]

[0063] Note: RT in the table stands for reverse transcription primers.

[0064] Example 4 Determination of the concentration of nutrient solution for iron stress in sand culture of transgenic poplars

[0065] Tissue culture flask seedlings of the miR-N153 transgenic lines OE-N153#8 and OE-N153#10 obtained in Example 3 with consistent growth and plant height of 5-6 cm were selected. The wild type was used as a control. The culture medium at the roots was rinsed with tap water and then rinsed with deionized water. After three weeks of sand culture, they were treated with nutrient solutions with different iron content. The culture medium was pure white quartz sand with iron ions removed, sterilized at 121°C for 70 minutes, and potted after cooling, with 1 kg per pot. The sand-cultured seedlings were cultured in an artificial greenhouse plant culture room with a light intensity of 3500 lx and a light duration of 16 h / d. The culture room temperature was maintained at 25°C, the humidity was maintained in the range of 45%-55%, and a cycle culture mode of 16 hours of light and 8 hours of darkness was adopted.

[0066] On the basis of iron-deficient MS medium (Table 5), EDTA-Fe (C 10 H 12 FeN2NaO8), and prepared different concentrations of treatment nutrient solution (Table 6). Deionized water and nutrient solution were alternately watered once a week. Different MS medium concentrations were set: 1 / 5MS; 2 / 5MS, with 16 replicates per group, and the growth of wild-type 84K poplars under different MS concentrations was observed. When the nutrient solution concentration was 2 / 5MS, the 84K poplars grew robustly ( Figure 4 ), so the concentration of the iron stress nutrient solution for 84K poplar sand culture was determined to be 2 / 5MS, set as CK (iron content of 14.68 mg·L -1 ).

[0067] Table 5 Nutrient element contents of iron-deficient MS medium (mg·L -1 )

[0068] element content element content <![CDATA[NH4NO3]]> 1650 <![CDATA[Na2MoO4·2H2O]]> 0.25 <![CDATA[CaCl2]]> 332.2 KI 0.83 <![CDATA[MgSO4]]> 180.7 <![CDATA[ZnSO4·7H2O]]> 8.6 <![CDATA[KNO3]]> 1900 Glycine 2 <![CDATA[KH2PO4]]> 170 Inositol 100 <![CDATA[H3BO3]]> 6.2 Nicotinic acid 0.5 <![CDATA[CoCl2·6H2O]]> 0.025 Pyridoxine HCl 0.5 <![CDATA[CuSO4·5H2O]]> 0.025 Thiamine HCl 0.1 <![CDATA[MnSO4·H2O]]> 16.9 - -

[0069] Table 6 Iron content in the iron deficiency treatment of overexpressed miR-N153

[0070] CK -Fe <![CDATA[14.68mg·L -1 ]]> <![CDATA[0mg·L -1 ]]>

[0071] Example 5 Phenotypic observation of transgenic poplars at different iron levels

[0072] The OE-N153 transgenic poplars (OE-N153#8 and OE-N153#10) from Example 3 and wild-type 84K poplars were grown for two months under normal and iron-deficient conditions, respectively, according to the method of Example 4. Phenotypic differences between the OE-N153 and WT plants were observed. Plant height was regularly observed and recorded under both normal and iron-deficient conditions. The experiment was replicated three times.

[0073] The results are as follows Figure 5 As shown: When the iron content in the nutrient solution is 14.68 mg·L -1 (CK), overexpression of miR-N153 increased plant height ( Figure 5 A), among which OE-N153#8 and OE-N153#10 significantly increased their plant heights by 15.01% and 38.34% respectively compared with WT. When the plants were subjected to iron deficiency stress, the plant heights of OE-N153 were still higher than those of WT, among which OE-N153#8 was 16.77% higher than that of WT, and OE-N153#10 was 20.06% higher than that of WT ( Figure 5 C). At the same time, iron deficiency causes the plant to lose its green color from the top downwards, with the leaves turning white and the veins yellow. More seriously, scorched brown spots and necrotic tissue will appear in the middle or tip of the leaves on both sides. However, the degree of stress on the OE-N153 strain is less than that on the WT ( Figure 5 B).

[0074] Example 6 Determination of malondialdehyde and key antioxidant enzyme contents in transgenic poplars

[0075] The enzyme activities in leaves and roots of OE-N153 transgenic poplars and wild-type 84K poplars grown for 2 months under iron deficiency stress in Example 5 were determined using MDA, SOD, and POD assay kits from Suzhou Keming Biotechnology Co., Ltd. The experiment was repeated three times.

[0076] The results are as follows Figure 6 As shown in the figure: When the iron content in the nutrient solution was 14.68 mg·L-1 (CK), the MDA content in the leaves of OE-N153 was slightly higher than that of WT. Under iron deficiency stress, the MDA content in OE-N153 was lower than that of WT. The MDA content in OE-N153#8 and OE-N153#10 lines decreased by 25.55% and 51% respectively compared with the treatment with 14.68 mg·L-1 iron content in the nutrient solution. Figure 6 A). In addition, the SOD activity in transgenic poplars was lower than that in WT ( Figure 6 B), but POD was higher than WT ( Figure 6 C) When plants were subjected to iron deficiency stress, the SOD and POD activities of OE-N153 were higher than those of WT. The SOD and POD activities of OE-N153#10 were significantly higher than those of WT by 51.55% and 83.78%, respectively, indicating that OE-N153 is more resistant to iron deficiency stress than WT.

[0077] Example 7 Determination of chlorophyll content in transgenic poplars

[0078] Chlorophyll content in leaves was determined using the 95% ethanol extraction method. The second pair of leaves from the OE-N153 transgenic poplar and wild-type 84K poplar plants grown for two months under iron deficiency stress (Example 5) were removed from the veins, minced, and weighed. A 0.1g sample was placed in a 10mL centrifuge tube. The leaves were then immersed in 5mL of 95% ethanol in the dark for one week until they turned white (Thambavani et al., 2012). Chlorophyll content was determined by adding 2.7mL of 95% ethanol to a quartz cuvette. The extract (i.e., the green liquid after immersion) was diluted 10-fold and 300μL was added to the cuvette, thoroughly mixed, and using 3mL of 95% ethanol as a blank. The absorbance at wavelengths of 470nm, 649nm, and 665nm was measured using a UV-Vis spectrophotometer (UV-1200 SPECTROPHOTOMETER). Three replicates were used.

[0079] The results are as follows Figure 7 As shown in the results, when miR-N153 was overexpressed in poplar, the chlorophyll a, chlorophyll b, total chlorophyll content and carotenoids of the transgenic seedlings were higher than those of the WT. Among them, the total chlorophyll content of OE-N153#8 was increased by 37.54%, 25.48%, 33.44% and 50.26% compared with the WT, respectively, and the differences were significant (p < 0.05). Under iron deficiency stress, the total chlorophyll content in the plants was significantly decreased compared with the iron content of 14.67 mg·L-1 in the nutrient solution, but the whitening phenomenon of the leaves of the transgenic poplar was weaker than that of the WT, and the chlorophyll content was still higher than that of the WT.

[0080] Example 8 Determination of photosynthetic rate of transgenic poplars

[0081] In this experiment, the photosynthetic performance of the OE-N153 transgenic poplar and the 84K wild-type poplar plants grown for 2 months under iron deficiency stress in Example 5 was measured using the LI-6400XT portable photosynthesis measurement system (Li-cor, USA). At the same time, the temperature of the plant culture room was kept constant at 25°C, and the photosynthetically active radiation was controlled at 2000 μmol / m 2 s. Healthy, mature leaves facing the sun with consistent growth conditions were randomly selected as test materials. Three leaves from the same node on each plant were selected as measurement objects. Each leaf position was measured four times, and the average of 12 repeated measurements was taken. Different strains of wild-type and transgenic plants were measured.

[0082] The results are as follows Figure 8As shown in the figure: when the iron content in the nutrient solution was 14.68 mg·L-1 (CK) and 0 mg·L-1 (-Fe), the photosynthetic rate of the plants overexpressing miR-N153 was higher than that of WT. Among them, when the iron content in the nutrient solution was 14.68 mg·L-1 (CK), the net photosynthetic rate of the plants overexpressing miR-N153 was significantly increased; under iron deficiency stress, the net photosynthetic rate, stomatal conductance and transpiration rate of OE-N153#10 were significantly higher than those of WT.

[0083] Example 9 Determination of chlorophyll fluorescence parameters of transgenic poplars

[0084] Two months after the different iron treatments described in Example 5, the first pair of older leaves below the newer leaves were dark-adapted for 30 minutes. Three randomly selected plants were then subjected to in vivo leaf chlorophyll fluorescence measurement using the IMAGING-PAM Chlorophyll Fluorescence Imaging System (WALZ, Germany). Measurements were made while avoiding leaf veins, and the measurements were repeated three times. Fluorescence parameters were then analyzed using imaging.

[0085] The results are as follows Figure 9 As shown, leaf color in transgenic and wild-type plants under iron deficiency stress began to differ significantly from that in the control group, and this difference became more pronounced with increasing treatment duration. Consistent with the photosynthetic index measurements, overexpression of miR-N153 enhanced photosynthesis in 84K poplar plants. Under iron deficiency, overexpression of miR-N153 increased photosynthetic absorption efficiency.

[0086] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A miR-N153, characterized in that The nucleotide sequence is any of the following: (a) a precursor sequence having a nucleotide sequence as shown in SEQ ID NO. 1; (b) The nucleotide sequence is the mature sequence shown in SEQ ID NO.

2.

2. An expression cassette, recombinant expression vector or recombinant bacterium containing the miR-N153 according to claim 1.

3. The miR-N153 according to claim 1, and use of an expression cassette, a recombinant expression vector and / or a recombinant bacterium containing the miR-N153 according to claim 1 in regulating iron deficiency stress tolerance in woody plants.

4. The use according to claim 3, characterized in that: The regulation improves the tolerance of woody plants to iron deficiency stress by overexpressing miR-N153; The woody plants include yellow beam wood and poplar.

5. The miR-N153 according to claim 1, and use of an expression cassette, a recombinant expression vector and / or a recombinant bacterium containing the miR-N153 according to claim 1 in breeding or improving woody plants resistant to iron deficiency stress.

6. The use according to claim 5, characterized in that: The woody plants include yellow beam wood and poplar.

7. A method for improving tolerance to iron deficiency stress in woody plants, characterized in that: By overexpressing the miR-N153 described in claim 1, the iron deficiency stress tolerance of woody plants is improved.

8. The method according to claim 7, characterized in that The specific steps include: The precursor sequence of miR-N153 as shown in SEQ ID NO.1 is cloned into an overexpression vector to obtain a recombinant expression vector; then the recombinant expression vector is transferred into woody plants through the Agrobacterium-mediated leaf disc method to obtain transgenic positive plants, thereby improving the iron deficiency stress tolerance of woody plants.

9. The method according to claim 8, characterized in that: The woody plants include yellow beam wood and poplar.

10. The method according to claim 9, characterized in that: The woody plant is 84K poplar.

Images