Natural nucleic acid aptamer specifically bound with rock sand sea anemone toxin as well as screening method and application of natural nucleic acid aptamer

Abstract

The invention relates to the technical field of biological medicines, and provides a natural nucleic acid aptamer capable of being specifically combined with anacarus delavayi toxin as well as a screening method and application of the natural nucleic acid aptamer. A POB-seq technology is adopted for screening, and three unmodified aptamers C1293, C1732 and C1512 which have high affinity with rock anemone toxin and a methylation modified aptamer mC1512 are obtained. The aptamer disclosed by the invention can be used for preparing a separating and enriching reagent, a purifying reagent, an antagonist or a neutralizing agent of the diagenetic actinotoxin, and also can be used for preparing a detection reagent, a kit or a sensor of the diagenetic actinotoxin, and is applied to detection of the diagenetic actinotoxin in a drinking water body sample; and a foundation can also be laid for preparation of drugs for preventing or treating asteris delavayi toxin poisoning and removal of asteris delavayi toxin in a water body or an aquatic product.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and provides natural nucleic acid aptamers that specifically bind to anemone toxins in sea sand, their screening methods, and related applications in the detection, removal, and mitigation of anemone toxins in sea sand. Background Technology

[0002] Palytoxins (PLTX), a typical example of polyether marine biotoxins, are among the most potent non-protein molecules. PLTX is primarily synthesized in nature by dinoflagellates and trichophyton, and is widely found in corals, sponges, mussels, and crustaceans. Its molecular formula is C0. 129 H 223 N3O 54 Structure and its derivatives, such as Figure 1 As shown, PLTX is one of the most complex and largest natural non-polymer molecules. It contains 129 aliphatic carbon atoms, 40 secondary hydroxyl groups, 2 dienyl motifs, 1 conjugated acrylamide-enamide system, 3 unsaturated bonds, 2 hydrophobic hydrocarbon chains, cyclic ether units, and a bicyclic acetal. This structure contains 64 chiral centers, theoretically allowing for over 1021 isomers. PLTX possesses both lipophilic and hydrophilic regions and has the longest known continuous carbon chain in a natural molecule, earning it the title of a supercarbon chain compound. PLTX is thermally stable, does not deactivate upon boiling, and remains stable in neutral aqueous solutions for extended periods. However, it decomposes rapidly under acidic or alkaline conditions, leading to the loss of its toxicity.

[0003] PLTX exhibits bioaccumulation, accumulating in high concentrations in aquatic products such as fish, crabs, and mussels. Coastal areas and environments rich in algae and corals, such as aquariums, are more prone to PLTX accumulation, even leading to aerosol pollution. Humans and animals are often exposed to PLTX through ingestion, direct skin and conjunctival contact, and inhalation; therefore, PLTX poisoning incidents are frequently reported. Main symptoms include difficulty breathing, convulsions, ataxia, drowsiness, collapse, vomiting, widespread gastrointestinal bleeding, shock, and even death. The LD50 of PLTX in rabbits... 50 With a toxicity level of 25 ng / kg, the time from poisoning to death is only 3-5 minutes. Its toxicity is dozens of times higher than that of tetrodotoxin and salicornin, therefore, PLTX poses a serious safety threat.

[0004] PLTX can bind to and block Na + -K + -ATP pump, which makes Na + The transport of K from cells against the concentration gradient, which previously relied on ATP hydrolysis, has changed to transport into cells down the concentration gradient, independent of ATP. +This changes the process from ATP hydrolysis-dependent transport into cells against the concentration gradient to ATP-independent transport out of cells down the concentration gradient, leading to cell depolarization and subsequently apoptosis. Furthermore, PLTX can increase intracellular H... + and Ca 2+ Horizontal. Studies have shown that PLTX can open H... + The membrane conduction pathway that transports H + Transported into cells and subsequently activating Na + / H + Exchange activity; PLTX can induce activation of voltage-dependent calcium channels or Na+ channels. + / Ca 2+ The exchanger thus improves Ca 2+ Concentration. These findings suggest that PLTX may have multiple sites of action in cells and can function as an agonist of a range of low-conductivity channels.

[0005] In addition to the well-established mechanisms of action of PLTX, recent years have seen increasing attention paid to its non-ion channel effects. Studies have found that PLTX can activate nuclear transcription factor (NF-κB) by reducing the expression of nuclear factor repressor protein (IκBα), accompanied by increased phosphorylation of mitogen-activated protein kinase (MAPK); PLTX can inhibit cell proliferation, reduce cell adhesion, and degrade fibrous actin; PLTX can also promote the release of lactate dehydrogenase (LDH), indicating cell membrane disruption and cell death, and inhibit the transcription of c-Jun N-terminal kinase 3 (JNK3) mRNA. However, current research is limited to simple analyses of cellular phenotypic changes and differences in gene expression levels. Existing literature cannot fully explain the complex and diverse acute and chronic toxic effects of PLTX. Therefore, further in-depth and systematic research into its mechanisms is necessary.

[0006] Nucleic acid aptamers are single-stranded nucleic acid molecular recognition elements, typically 10-100 nucleotides (nt) in length. They are usually obtained through systematic evolution of ligands by exponential enrichment (SELEX) screening. Aptamers bind to target molecules with a flexible structure, forming a specific spatial conformation and thus exhibiting a specific function. Compared to antibodies, aptamers have significant advantages such as low production cost, rapid chemical synthesis, and good batch-to-batch consistency. Furthermore, aptamers possess similar or even higher specificity than antibodies, capable of distinguishing extremely subtle molecular differences, such as conformational isomers, targets containing different functional groups, amino acid mutants, and even chiral molecules and analogs with only minor structural differences, such as L- and D-amino acids. Therefore, nucleic acid aptamers are widely used in detection, treatment, and laboratory research. Aptamers bind to targets through the folding of single-stranded DNA or RNA into spatial structures such as stem-loops, inner loops, pseudoknots, triple strands, and quadruplexes. Base modifications to aptamers contribute to the stability of both the aptamer and the toxin-aptamer complex, thereby increasing binding affinity and specificity. In fact, aptamer modification and optimization represent the biggest challenge and focus of aptamer research. Current conventional SELEX methods begin with randomly synthesized single-stranded nucleic acid libraries using A, T / U, C, and G as raw materials, followed by repeated PCR amplification and enrichment. This process makes it difficult to introduce modified bases, thus failing to obtain nucleic acid aptamers with base modifications. Using randomly fragmented genomic DNA as the initial library and employing optimized aptamer screening methods, it is possible to obtain naturally occurring nucleic acid aptamers with various epigenetic and stress modifications. These aptamers may exhibit higher affinity and stronger specificity for toxins. Furthermore, screening naturally occurring nucleic acid aptamers helps to elucidate the molecular processes of toxin-aptamer binding and to identify new targets and modes of toxin action. Summary of the Invention

[0007] Based on the above research, this invention addresses the shortcomings of the current lack of natural nucleic acid aptamers that can specifically bind to sea anemone toxin and conventional aptamer screening methods. It provides natural nucleic acid aptamers that specifically bind to sea anemone toxin, and also provides a new aptamer screening method—POB-seq technology, as well as related applications of the aptamers.

[0008] The primary objective of this invention is to provide three unmodified nucleic acid aptamers, C1293, C1732, and C1512, capable of specifically binding to anemone toxins in rock sand with high affinity, and one methylated modified nucleic acid aptamer, mC1512.

[0009] The second objective of this invention is to provide a screening method for the aforementioned natural nucleic acid aptamers. For the first time, Non-SELEX, Genomic-SELEX, and next-generation sequencing technologies are integrated and applied to the screening of PLTX natural nucleic acid aptamers, constructing a POB-seq technology, which can be extended to the acquisition of natural nucleic acid aptamers for other active molecules.

[0010] A third objective of this invention is to provide applications of the aptamer, such as its use in the preparation of PLTX separation and enrichment reagents, purification reagents, neutralizing agents, or antagonists; its use in the preparation of PLTX detection reagents, kits, or sensors; its use in the preparation of drugs for the prevention or treatment of PLTX poisoning; and its use in the rapid detection of PLTX in water or aquatic products. This also lays the foundation for applications in the preparation of drugs for the prevention or treatment of PLTX poisoning, the removal of PLTX from water or aquatic products, and the exploration of the biological functions and mechanisms of action of PLTX.

[0011] The main technical solution of this invention is as follows: Unmodified and methylated natural nucleic acid aptamers with high affinity and specificity for PLTX are screened and obtained using POB-seq technology. Then, aptamers with better affinity and specificity are further screened based on the results of biofilm layer interferometry (BLI) and microthermophoresis (MST) experiments. The natural nucleic acid aptamers screened using this technology can be used to elucidate the mechanism of action of the toxin; by combining them with a biosensor platform, PLTX aptamer sensors can be prepared and used for the rapid detection of PLTX. Furthermore, PLTX aptamers can also lay the foundation for the preparation of drugs for the prevention or treatment of PLTX poisoning and the removal of PLTX from water or aquatic products.

[0012] Based on the above research, the technical solution to be protected by this invention is as follows:

[0013] In a first aspect, the present invention provides unmodified and methylated aptamers that specifically bind to anemone toxins in rock sand, wherein the methylated bases of the aptamer are cytosine.

[0014] The following representative sequences were obtained through POB-seq technology:

[0015] C1293: AGGATTTGAACCTGCGCGGGA;

[0016] C1732:

[0017] TCAGTGCCAGCAGCCTACAGGCAGAGGCCGGGCAATGGTTAGGAGCCAGTTTGCTCTAGCATG;

[0018] C1512: CAGACCCCGCCCTCACAGTCACCATC;

[0019] mC1512: CAGACCC / i5MedC / GCCCTCACAGTCACCATC;

[0020] in, It represents 5-methylcytosine.

[0021] This invention further investigated the affinity of the above-mentioned aptamers using BLI and MST techniques, finding that the methylated aptamer mC1512 exhibited the highest affinity, reaching 1.2 × 10⁻⁶. -8 Compared to the unmodified aptamer C1512, 5mC may enhance the affinity of the aptamer to the toxin by stabilizing the binding site structure and forming more hydrogen bonds with the toxin. The affinity of mC525 is also significantly improved compared to the unmodified methylation.

[0022] In addition to methylation, the above aptamers can also be chemically modified, such as by adding biotin, fluorescent molecules, isotopes, electrochemicals, enzymes, or thiol groups to their 5' or 3' ends, as well as by insertion, truncation, mutation, cyclization, and other modifications.

[0023] In a second aspect, the present invention provides a method for screening the aforementioned aptamers: screening is performed using the POB-seq method. First, the genome of a cell line with moderate sensitivity to sea anemone toxins is extracted. After ultrasonic disruption, thermal denaturation, and quenching, a single-stranded nucleic acid library with a sequence length of approximately 200-300 nt is obtained. This library is then divided into a blank group, a conventional group, and a methylated group, with three replicate libraries in each group. The blank group library is incubated with empty magnetic beads, while the conventional and methylated group libraries are incubated with magnetic beads conjugated with PLTX. The ssDNA bound to the magnetic beads is recovered and subjected to next-generation strand-specific sequencing and methylation sequencing. Candidate aptamer sequences are obtained through bioinformatics analysis, and their affinity is determined using BLI technology.

[0024] The nucleic acid library construction method is briefly described as follows: After extracting genomic DNA from cells, it is placed in an ultrasonic cell disruptor with the power set to 80%, the ultrasonic on time to 1 second, the ultrasonic off time to 3 seconds, the total working time to 150 minutes, and the temperature to 15 ℃ to fragment the genomic DNA; then the size of the DNA fragments is detected, and an equal volume of 2× selection buffer is added to the fragmented genomic DNA. The mixture is then placed in a 95 ℃ metal bath for 10 minutes and then quenched in an ice bath for 5 minutes. At this point, the DNA is in a single-stranded state.

[0025] (1) During aptamer screening, genomic fragmented ssDNA was first used as a screening library, and the renaturation treatment was repeated once. Then, a library containing 10 14PLTX molecules were coupled with magnetic beads, and 1× screening buffer was added to the predetermined total volume. The mixture was then incubated overnight at room temperature by rotation. After removing excess ssDNA, the ssDNA bound to the magnetic beads was recovered, and then second-generation strand-specific sequencing and methylation sequencing were performed. Candidate aptamer sequences were then obtained through bioinformatics analysis.

[0026] The bioinformatics analysis methods are as follows:

[0027] (1) Unmodified aptamers

[0028] ① The fastq files obtained from the blank group and the conventional group sequencing were processed by the software fastp for quality control and filtering to obtain clean reads;

[0029] ② Use bwa 0.7.17 to align clean reads to the corresponding reference genome;

[0030] ③ Use samtools 1.16 to filter for high-quality (MAPQ > 10) unique alignments;

[0031] ④ Use samtools 1.16 to extract the alignment results from the filtered alignment files;

[0032] ⑤ Using the blank group as a control, peak calling was performed on the regular group using the software MACS2 2.2.7.1. The positive and negative chain information was obtained from the alignment file using a self-written Python script.

[0033] ⑥ Use the software Homer to annotate the identified peaks, prioritizing peaks that can be annotated to transcription start sites, transcription termination sites, and exon regions.

[0034] ⑦ Use bedtools 2.30.0 to extract the sequence corresponding to the peak, and at the same time manually remove the influence of repetitive sequences on the genome. Further limit the GC content of the sequence to be greater than 40% and the length to less than 80 nt. The obtained sequence is the candidate unmodified nucleic acid aptamer.

[0035] (2) Methylated aptamers

[0036] ① The fastq files from methylome sequencing were subjected to fastp quality control and filtering to obtain clean reads;

[0037] ② Use Bismark 0.23.0 to perform sequence alignment and identify methylation or other modification sites. Match the identified methylation or other modification sites with all peaks in the conventional group and then screen for peaks containing methylation or other modification sites.

[0038] ③ Use bedtools 2.30.0 to extract the sequence corresponding to the peak, while manually removing the influence of repetitive sequences on the genome, limiting the sequence length to less than 80 nt, and labeling the methylation sites in the sequence. The resulting sequence is the candidate methylation-modified nucleic acid aptamer.

[0039] A third aspect of the invention provides the application of the aptamer, such as in the preparation of reagents for the separation and enrichment of anemone toxins, purification reagents, neutralizing agents or antagonists; in the preparation of reagents, kits or sensors for the rapid detection of anemone toxins in water or aquatic products; and in the preparation of drugs for the treatment of anemone toxin poisoning.

[0040] The present invention further provides its application in the treatment of anemone poisoning, using an aptamer that binds to anemone toxin with high affinity as the active ingredient or using the aptamer as a target carrier for anemone toxin antagonist drug, in the preparation of a drug for treating anemone poisoning, which can alleviate symptoms such as diarrhea, abdominal pain, headache, dyspnea, convulsions, ataxia, drowsiness, collapse, vomiting, and gastrointestinal bleeding caused by anemone poisoning.

[0041] Furthermore, this invention also provides its application in the preparation of a preparation for removing anemone toxins from aquatic products or water bodies, reducing the level of anemone toxins to below the standards stipulated and recommended by the World Health Organization and the Food and Agriculture Organization of the United Nations, thereby preventing anemone toxin poisoning caused by the consumption of toxic aquatic products.

[0042] A fourth aspect of the invention provides a composition of an aptamer that specifically binds to an anemone toxin, wherein the aptamer specifically binding to an anemone toxin is the active ingredient, and further comprises a medically or diagnostically acceptable pharmaceutical carrier. This composition can be used to prepare anti-anemone toxin drugs or diagnostic reagents.

[0043] Specifically, the drug composition can be used to neutralize or antagonize anemone toxins, and can also be used to relieve or cure symptoms such as diarrhea, abdominal pain, headache, difficulty breathing, convulsions, ataxia, drowsiness, collapse, vomiting, and gastrointestinal bleeding caused by anemone toxin poisoning.

[0044] This pharmaceutical composition is an agent for removing anemone toxins from water or aquatic products. This agent can completely remove anemone toxins from water or aquatic products, or reduce the anemone toxin content in water or aquatic products to below the standards set and recommended by the World Health Organization and the Food and Agriculture Organization of the United Nations.

[0045] The compositions of the present invention, together with pharmaceutically or diagnostically acceptable excipients, form pharmaceutical formulations that provide more stable therapeutic effects and ensure conformational integrity of the aptamer core sequence disclosed in the present invention.

[0046] In a fifth aspect, the present invention provides the application of the above-mentioned aptamer in the rapid detection of rock sand anemone toxin in tap water samples, to prevent people from being poisoned by drinking contaminated water and accidentally consuming contaminated aquatic products.

[0047] The role and effect of invention

[0048] This invention addresses the challenges of obtaining base-modified aptamers for anemone toxins and the unclear mechanism of anemone damage caused by anemone toxins. It designs a POB-seq method to screen and obtain unmodified and methylated natural nucleic acid aptamers that bind with high affinity and specificity to anemone toxins. These aptamers, acting as molecular recognition probes that specifically bind to anemone toxins, possess advantages such as high affinity, strong specificity, good stability, low immunogenicity, and ease of synthesis, modification, and labeling. They can be used for the separation and enrichment of trace amounts of anemone toxins in samples, the analysis and detection of anemone toxins, the preparation of drugs to neutralize anemone toxins, the preparation of drugs to antagonize anemone toxins, and the removal of anemone toxins from water bodies.

[0049] Experiments have verified that the aptamers of this invention can rapidly and specifically bind to PLTX, with the aptamer mC1512 exhibiting the highest affinity for PLTX, reaching 1.2 × 10⁻⁶. -8 M. Therefore, the aptamers screened by this invention can be prepared into aptamer sensors or detection reagents and applied to the detection of PLTX in drinking water samples. Furthermore, these aptamers can also lay the foundation for the preparation of drugs to prevent or treat PLTX poisoning and for the removal of PLTX from water or aquatic products.

[0050] Furthermore, based on the characteristics of the PLTX molecule, this invention employs a magnetic bead immobilization method and a POB-seq strategy. Through parallel screening, unmodified and methylated natural nucleic acid aptamers capable of binding specifically to anemone toxin with high affinity were obtained. This approach is characterized by its simplicity, high reproducibility, and significantly simplifies the construction process, resulting in low production costs and short purification cycles. As a novel molecular recognition probe, the aptamer offers advantages such as ease of chemical synthesis, low cost, stable properties, and convenient modification, making it suitable for large-scale application in the industrial production of biopharmaceuticals. Attached Figure Description

[0051] Figure 1 The structural formula of rock sand anemone toxin is shown;

[0052] Figure 2This diagram illustrates the screening process for aptamers that specifically bind to anemone toxins in rock sand.

[0053] Figure 3 The results of affinity analysis between mC1512 and PLTX obtained using BLI technology are shown.

[0054] Figure 4 The results of specificity analysis of aptamer mC1512 obtained using BLI technology are shown.

[0055] Figure 5 The results of affinity analysis between mC1512 and PLTX obtained using MST technology are shown. Detailed Implementation

[0056] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. All technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art unless otherwise defined. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0057] Example 1. Construction of a genome-derived ssDNA library

[0058] (1) Extraction of genomic DNA from HaCaT and CHO-K1 cells

[0059] After culturing cells according to standard procedures and reaching a confluence of approximately 70%-80%, genomic DNA was extracted using a kit and quantified using NanoDrop™ One.

[0060] (2) Fragmented genome

[0061] The extracted genomic DNA was placed in an ultrasonic cell disruptor, with the power set to 80%, the ultrasonic on time to 1 second, the ultrasonic off time to 3 seconds, the total working time to 150 minutes, and the temperature to 15℃, to fragment the genomic DNA.

[0062] (3) Nucleic acid gel electrophoresis

[0063] The size of DNA fragments can be detected using nucleic acid gel electrophoresis.

[0064] (4) Genome fragments fold into single-stranded DNA

[0065] Add an equal volume of 2× selection buffer (Binding buffer, BB; 40 mM Tris-HCl, 200 mM NaCl, 4 mM MgCl2, 10 mM KCl, pH 7.5) to the fragmented genomic DNA, place it in a 95 ℃ metal bath for 10 min, and then quench it in an ice bath for 5 min. At this point, the DNA folds into a single-stranded state (ssDNA).

[0066] Example 2. Screening of nucleic acid aptamers for sea anemone toxins

[0067] To obtain base-modified nucleic acid aptamers that bind with high affinity and high specificity to pluripotent anemone toxin (PLTX), a parallel screening process using POB-seq technology was designed and implemented. The screening process is detailed below. Figure 2 After obtaining cellular genomic DNA, the ultrasound parameters were adjusted to obtain nucleic acid sequences of appropriate genomic fragmentation length. These sequences were then used as screening libraries, subjected to heat denaturation and quenching treatments to obtain ssDNA libraries. These libraries were divided into blank, conventional, and methylated groups, with three parallel screenings per group. Empty magnetic beads and PLTX-conjugated magnetic beads were incubated with these libraries, and the bead-bound nucleic acids were isolated and recovered for next-generation strand-specific sequencing and methylation sequencing. Subsequently, bioinformatics analysis was used to screen for candidate PLTX natural nucleic acid aptamers. The affinity between these aptamers and PLTX was further determined using biomembrane interferometry (BLI) (Table 1), with the affinity constant K... D The smaller the value, the stronger the affinity between the aptamer and the toxin. Ultimately, we selected K. D Values ​​approximately equal to or less than 10 -7 The nM aptamer serves as a high-affinity aptamer for PLTX. Due to the optimized analytical strategy, the resulting aptamers are already truncated or chemically modified molecules, eliminating the need for complex and tedious subsequent optimization steps.

[0068] The specific steps of the screening process are as follows:

[0069] (1) PLTX coupled to ferrite bead

[0070] Activation of magnetic beads: Wash the carboxylated magnetic beads with 0.01 M NaOH, mix thoroughly by blowing, and incubate for 10 min; place on a magnetic rack for 5 min, and remove the supernatant; wash the magnetic beads with double-distilled water instead of 0.01 M NaOH; add a 50 mg / mL solution of carbodiimide (EDC) dry powder to the magnetic beads, and vortex to mix; incubate at room temperature for 30 min, then place on a magnetic rack for 5 min, and remove the supernatant; wash the magnetic beads once with pre-cooled double-distilled water; add a 50 mM (pH 5) solution of fatty acid methyl ester sulfonate (MES) dry powder to the magnetic beads for washing.

[0071] PLTX Coupling: Dissolve 10 μg PLTX in 500 μL MES solution (50 mM, pH 5), vortex to mix, and then add to the activated magnetic beads. Mix thoroughly and incubate at room temperature for 60 min. Separately, dissolve PLTX in MES solution (50 mM, pH 5) to prepare concentrations of 0.1, 0.2, 0.4, 0.8, 1.6, and 3.2 μg / mL. Measure the OD value at 264 nm and plot a PLTX concentration standard curve. Place on a magnetic rack for 5 min, aspirate the supernatant, and measure the OD value at 264 nm to calculate the fixation efficiency. Add 400 μL of Tris (50 mM, pH 7.4) solution to the PLTX-coated magnetic beads. Add 400 μL of Tris to 100 μL of empty magnetic beads and incubate both by rotation for 30 min. After aspirating the supernatant, use 1 mL of 1× screening buffer (20... Wash PLTX-coupled magnetic beads and empty magnetic beads four times each with 100 mM Tris-HCl, 100 mM NaCl, 2 mM MgCl2, 5 mM KCl, pH 7.5. Add 200 μL of 1× screening buffer to each, and store at 4 ℃ for later use.

[0072] (2) Incubation

[0073] 2 nmol of fragmented genomic ssDNA was used as a screening library, and the renaturation process was repeated once to ensure that the ssDNA folded into independent structures. 10 μL of PLTX-conjugated magnetic beads (containing approximately 10 μL of ssDNA) were then added. 14 Add PLTX molecules, then add 1× screening buffer to a total volume of 500 μL and incubate overnight at room temperature by rotation.

[0074] (3) Washing

[0075] Place the EP tube on a magnetic rack for 5 min, remove the supernatant, add 500 μL of 1× screening buffer, and wash at low speed for 5 min. Repeat 3-4 times until ssDNA is no longer detected in the washing solution. Add 100 μL of enzyme-free DEPC water, vortex at 95 °C for 15 min, and then use a magnetic rack for 5 min to adsorb the beads. Discard the magnetic beads, recover the supernatant, and detect the nucleic acid concentration. Calculate the recovery rate and store at -20 °C.

[0076] (4) Parallel reverse screening

[0077] Add 2 nmol of renatured ssDNA to 10 μL of empty magnetic beads, and add 1× selection buffer to a total volume of 500 μL. Incubate overnight at room temperature by rotation. Following the elution method described above, recover the eluent to obtain the ssDNA bound to the empty magnetic beads, and store at -20 ℃. Genomic libraries derived from target cell lines were prepared into blank, standard, and methylated groups, with three replicates for each group. Next-generation sequencing and methylation sequencing were performed on the eluted libraries from each group.

[0078] (5) Bioinformatics analysis

[0079] Unmodified aptamers: FastQ files obtained from next-generation sequencing were quality controlled and filtered using FastP software to obtain clean reads; bwa 0.7.17 was used to align the clean reads to the corresponding reference genome; high-quality (MAPQ > 10) unique alignments were screened using Samtools 1.16; alignment results were extracted from the screened alignment files using Samtools 1.16; peak calling was performed using MACS2 2.2.7.1 software, and positive and negative strand information was obtained from the alignment files using a self-written Python script; the identified peaks were annotated using Homer software, prioritizing peaks that could be annotated to transcription start sites, transcription termination sites, and exon regions; the sequences corresponding to the peaks were extracted using Bedtools 2.30.0, while manually removing the influence of repetitive sequences on the genome, further limiting the GC content of the sequences to greater than 40% and the length to less than 80 nt. The resulting sequences are the candidate nucleic acid aptamers.

[0080] Methylation-modified aptamers: The fastq files from methylation sequencing were quality controlled and filtered by fastp to obtain clean reads; Bismark 0.23.0 was used for sequence alignment and identification of methylation or other modification sites. The identified methylation or other modification sites were compared with all peaks in the conventional group, and peaks containing methylation or other modification sites were selected; the sequences corresponding to the peaks were extracted using bedtools 2.30.0, while manually removing the influence of repetitive sequences on the genome, limiting the sequence length to less than 80 nt, and labeling the methylation sites in the sequences. The resulting sequences are the candidate methylation-modified nucleic acid aptamers.

[0081] Table 1. Aptamer sequences and their affinity constants K D value

[0082]

[0083] Example 4. Determining the interaction between aptamers and targets using biomembrane interferometry.

[0084] Biofilm interferometry (BLI) is a label-free technique based on the principle of optical interference. It detects surface reactions of a sensor by monitoring shifts in the interference spectrum. When a beam of visible light is emitted from a spectrometer, two reflected spectra are formed at the two interfaces of the optical film at the sensor's end, creating an interference spectrum. Any changes in film thickness and density due to molecular bonding or dissociation can be reflected by the shift value of the interference spectrum, allowing for real-time monitoring of the response.

[0085] The affinity and specificity of mC1512 with PLTX were detected using this method. The specific detection steps are as follows:

[0086] (1) Preparation of aptamers: Biotin-tagged aptamers mC1512 were synthesized, prepared into 2 μM solutions with screening buffer, and subjected to renaturation treatment (95℃ for 10 min, ice bath for 5 min, room temperature for 5 min) for later use. At the same time, a random sequence with a biotin tag was prepared as a negative control.

[0087] (2) Preparation of target toxins: Different concentrations (500 nM, 250 nM, 80 nM, 40 nM, 20 nM and 10 nM) of PLTX were used to test the interaction between PLTX and aptamers, and the affinity between PLTX and aptamers was determined. The results are as follows: Figure 3 As shown. In addition, to verify the specificity of the aptamer, 250 nM concentrations of PLTX-like toxins OA and non-specific toxins (GTX, STX, TTX, NOD-R, PLTX, DTX, DA), as well as a mixture of the above toxins (final concentration 250 nM), were prepared. The interactions between the aptamer and these toxins were detected, and the results are shown below. Figure 4 As shown, mC1512 can only specifically bind to PLTX, and is a typical fast-binding and slow-dissociating ligand of PLTX, which has great practical application value.

[0088] (3) Using a streptavidin (SA) probe, add the appropriate concentrations of aptamer, PLTX solution, and buffer to two 96-well plates, 100-200 μL / well. The program settings are as follows: ① Sensor equilibration (1 min); ② Aptamer coupling (3 min); ③ Sensor reequilibration (1 min); ④ Binding (1.5 min); ⑤ Dissociation (1.5 min). Import the collected real-time binding and dissociation data into Octet data analysis software, and use a 1:1 binding mode for fitting analysis to obtain the fitting curve and affinity constant K. D Dynamic parameters such as values.

[0089] Example 5. Determination of aptamer-to-standard interaction using micro-thermal surge technique.

[0090] Micro-thermophoresis (MST) combines quantitative fluorescence analysis with molecular thermophoresis principles. It's a technique for analyzing biomolecular interactions, capable of measuring these interactions in various buffers and even complex plasmas. These interactions include protein-protein interactions, protein-DNA interactions, oligonucleotide interactions, and oligonucleotide-small molecule interactions. When applied to the detection of interacting molecules, MST typically involves fluorescently labeling large biomolecules (proteins or nucleic acids). The fluorescently labeled biomolecule is called the target, while the non-fluorescent molecule is called the ligand. Invented by Nano Temper, the MST detection device works by observing the thermophoretic movement of biomolecules in a capillary. This alteration changes in the hydration layer, molecular size, and charge of interacting molecules, leading to changes in the fluorescence distribution within the reaction system, thus detecting the affinity between interacting biomolecules.

[0091] The affinity of the aptamer for the toxin of the rock sand anemone was determined using the MST technique. The specific steps are as follows:

[0092] (1) The aptamer sequence was 6-FAM-labeled at the 5' end, diluted to 100 nM with 1× buffer, placed in a 95℃ metal bath for 10 min, quenched in an ice bath for 5 min, and stored in a 4℃ refrigerator in the dark for later use.

[0093] (2) Prepare a PLTX solution with a concentration of 8000 nM using 1× buffer containing 0.04% Tween-20;

[0094] (3) Prepare 16 0.2 mL PCR tubes, numbered 1-16. Add 20 μL of 8000 nm PLTX solution to tube 1, and add 10 μL of 1× buffer containing 0.04% Tween-20 to tubes 2-16 respectively.

[0095] (4) Transfer 10 μL of PLTX solution from tube 1 to tube 2, mix thoroughly by pipetting, then transfer 10 μL of PLTX solution from tube 2 to tube 3, mix thoroughly by pipetting, repeat the above gradient dilution operation to tube 16, and aspirate 10 μL of liquid from tube 16.

[0096] (5) Add 10 μL of 100 nM aptamer solution to each tube sequentially and mix thoroughly by pipetting. The final concentration of aptamer in each tube is 50 nM, and the concentration of PLTX is 4000 - 0.122 nM (2-fold serial dilution).

[0097] (6) Configure Monolith TMNT.115 system parameters: fluorescence channel is Blue, temperature is 25℃, excitation power is 40%, MST power is 40%;

[0098] (7) Use 16 capillary tubes to draw liquid from 16 PCR tubes and then test them on the instrument.

[0099] Each sample group was tested three times. The data were analyzed using MO. Affinity 2.3 software to calculate the K-value of the aptamer binding to PLTX. D Value, result as Figure 5 As shown, different aptamers were selected for testing at the optimal toxin concentration.

[0100] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above specific embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. A natural nucleic acid aptamer that specifically binds to the toxin of the rock anemone Sea Anemone, characterized in that: The aptamer is selected from any one of the following: C1293: AGGATTTGAACCTGCGCGGGA; C1732:TCAGTGCCAGCAGCCTACAGGCAGAGCCGGGCAATGGTTAGGAG CCAGTTTGCTCTAGCATG; C1512: CAGACCCCGCCCTCACAGTCACCATC; mC1512: CAGACCC / i5MedC / GCCCTCACAGTCACCATC; in, stands for 5-methylcytosine.

2. The natural nucleic acid aptamer that specifically binds to the toxin of the rock anemone according to claim 1, characterized in that: in, The 5' end or 3' end of the aptamer is modified with biotin, fluorescent molecules, isotopes, electrochemistry, enzymes or sulfhydryl chemistry; and the aptamer is modified with insertion, truncation, mutation or cyclization.

3. The method for screening natural nucleic acid aptamers that specifically bind to the toxin of the rock anemone according to claim 1 or 2, characterized in that: The method includes the following steps: using the POB-seq method for screening, first extracting the genomic DNA of the target cell line, and obtaining a single-stranded nucleic acid library after ultrasonic fragmentation, thermal denaturation and quenching; setting the library into a blank group, a conventional group and a methylation group, incubating the blank group library with empty magnetic beads, and incubating the conventional group and the methylation group with magnetic beads coupled with the toxin of the rock sand anemone, respectively recovering the ssDNA bound to the magnetic beads, and then using the second-generation chain-specific sequencing technology, methylation sequencing technology and bioinformatics analysis to preliminarily obtain candidate unmodified and methylated modified aptamer sequences, and finally further verifying the affinity of the aptamer sequence.

4. The method for screening natural nucleic acid aptamers that specifically bind to the toxin of the rock anemone according to claim 3, characterized in that: The steps include: A. Nucleic acid library construction After extracting genomic DNA from cells, the cells were placed in an ultrasonic cell disruptor with the power set to 80%, the ultrasonic on time to 1 s, the ultrasonic off time to 3 s, the total operating time to 150 min, and the temperature to 15°C to fragment the genomic DNA. The DNA fragment sizes were then determined, and an equal volume of 2× screening buffer was added to the fragmented genomic DNA. The DNA was then placed in a 95°C metal bath for 10 min and quenched in an ice bath for 5 min, at which point the DNA folded into a single-stranded state, forming ssDNA. B. Aptamer Screening (1) Take genomic fragmented ssDNA as the screening library and repeat the denaturation and renaturation treatment once. Add empty magnetic beads to the blank group, and add 10 14 PLTX-coupled magnetic beads containing PLTX molecules were supplemented with 1× screening buffer to the predetermined total volume and incubated with rotation at room temperature overnight. After removing excess ssDNA, the ssDNA bound to the magnetic beads was recovered and then subjected to second-generation strand-specific sequencing and methylation sequencing. (2) Bioinformatics analysis to obtain candidate aptamer sequences: (2-1) Unmodified aptamers ① The fastq files obtained by strand-specific sequencing of the blank group and the conventional group were quality controlled and filtered using the fastp software to obtain clean reads; ② Use bwa 0.7.17 to align clean reads to the corresponding reference genome; ③ Screening for high-quality (MAPQ > 10) unique alignments using samtools 1.16; ④Use samtools 1.16 to extract the alignment results from the filtered alignment files; ⑤ Using the blank group as a control, the peaks of the conventional group were identified using the software MACS2 2.2.7.

1. The positive and negative chain information was obtained from the alignment file using a self-written Python script; ⑥ Use the software HOMER to annotate the identified peaks, giving priority to peaks that can be annotated to regions such as transcription start sites, transcription end sites, and exons; ⑦Bedtools 2.30.0 was used to extract the sequences corresponding to the peaks. The influence of repetitive sequences on the genome was manually eliminated. The sequences were further limited to have a GC content greater than 40% and a length less than 80 nt. The obtained sequences were the candidate unmodified nucleic acid aptamers. (2-2) Methylation-modified aptamers ① The fastq file of methylome sequencing was quality controlled and filtered by fastp to obtain clean reads; ② Use Bismark 0.23.0 to perform sequence alignment and identify methylation modification sites. The identified methylation modification sites are matched with all peaks in the conventional group, and peaks containing methylation modification sites are screened. ③ Use bedtools 2.30.0 to extract the sequences corresponding to the peaks, and manually remove the influence of repeated sequences on the genome. Limit the sequence length to less than 80 nt, annotate the methylation sites in the sequence, and the obtained sequence is the candidate methylation-modified nucleic acid aptamer. (2-3) BLI determination of candidate nucleic acid aptamer affinity Artificially synthesize candidate nucleic acid aptamers and use BLI to measure the affinity constant K between the candidate aptamers and PLTX D value, and further screen the nucleic acid aptamers.

5. Use of the natural nucleic acid aptamer that specifically binds to the toxin of the rock sand anemone according to any one of claims 1 to 2 in the preparation of a separation and enrichment reagent, a purification reagent, an antagonist or a neutralizer for the toxin of the rock sand anemone.

6. Use of the natural nucleic acid aptamer that specifically binds to the toxin of the rock sand anemone according to any one of claims 1 to 2 in the rapid detection of the toxin of the rock sand anemone in water, or in the preparation of a detection reagent, a detection kit or a detection sensor for the toxin of the rock sand anemone.

7. Use of the natural nucleic acid aptamer that specifically binds to the toxin of the anemone of any one of claims 1 to 2 in the preparation of a drug for treating poisoning by the anemone toxin of the anemone, characterized in that: The drug uses an aptamer that specifically binds to the toxin of the rock sand anemone as the sole active ingredient or is a drug composition containing an aptamer that specifically binds to the toxin of the rock sand anemone.

8. Use of the natural nucleic acid aptamer that specifically binds to the toxin of the anemone of any one of claims 1 to 2 in the preparation of an agent for removing the toxin of the anemone from aquatic products or water bodies.

9. A composition, characterized in that: The natural nucleic acid aptamer according to any one of claims 1 to 3 is used as an active ingredient, and further comprises a pharmaceutically or diagnostically acceptable carrier.

10. A detector or remover for sea anemone toxin, characterized in that: Containing the composition according to claim 9.

Images