Preparation method of nucleic acid molecule, polypeptide, recombinant plasmid and recombinant protein

Abstract

The invention provides a nucleic acid molecule. The nucleic acid molecule comprises a nucleic acid sequence as shown in SEQ ID NO.2. The invention also provides a polypeptide which is encoded by the nucleic acid molecule. The invention further provides a recombinant plasmid, and the recombinant plasmid comprises the nucleic acid molecule. The invention also provides a preparation method of the recombinant protein. The preparation method comprises the following steps: optimizing an HBc gene into a nucleotide sequence comprising SEQ ID NO.2; constructing a recombinant plasmid based on the nucleic acid sequence; the recombinant plasmid is transfected into an HEK293 cell for expression; the cell supernatant is collected for purification of the recombinant protein. The HBc gene is optimized according to the codon preference of the HEK293 cell, and the codon adaptation index (CAI) value of the HBc gene is increased to 0.930. The expression system established by the invention has the remarkable characteristics of high efficiency and low pollution, not only overcomes the defects of the traditional expression system, but also provides a brand new strategy and technical support for efficient production of vaccines and development of nano-carriers.

Description

Technical Field

[0001] The present disclosure relates to the biological field, and more particularly to methods for preparing nucleic acid molecules, polypeptides, recombinant plasmids and recombinant proteins. Background Art

[0002] Hepatitis B core protein virus-like particles (HBc VLPs) have become one of the key carrier platforms for the development of new-generation vaccines due to their unique self-assembly properties and virus-like particle structure. HBc VLPs possess a high degree of structural stability, and the primary immunogenic region of their capsid protein allows for the embedded expression of exogenous antigenic epitopes (such as HIV gp120 and HPV L1) while retaining complete VLP self-assembly capabilities. Furthermore, HBc VLPs themselves possess strong immunogenicity and can act as adjuvants to enhance immune responses, activating both T lymphocyte-mediated cellular and B lymphocyte-mediated humoral immune responses. The particle size of HBc VLPs is approximately 30 nm, falling within the nanoparticle range of 20-200 nm. Tumor tissue vessels exhibit high permeability and retention effects, with large interstitial spaces between endothelial cells and an imperfect lymphatic drainage system. Therefore, HBc VLP can penetrate the tumor blood vessel wall in the blood circulation and passively accumulate in the tumor tissue due to the high permeability and long retention effect, thereby achieving tumor targeting. This characteristic makes HBc VLP show great potential in the field of tumor vaccine delivery.

[0003] Currently, the preparation of HBc capsid recombinant protein mainly relies on two types of expression systems: prokaryotic and eukaryotic. Both expression systems have bottlenecks. Although the E. coli expression system has cost advantages, its products have the following shortcomings: (1) lack of post-translational modifications conserved in eukaryotes, such as phosphorylation and glycosylation, which can affect the antigen presentation efficiency of VLP; (2) the prokaryotic expression system may be accompanied by the formation of inclusion bodies, which increases the difficulty of protein purification and affects protein yield; (3) endotoxin levels are as high as >100EU per mg of protein, requiring the introduction of complex processes such as Triton X-114 extraction. Although the mammalian cell intracellular expression system can achieve correct folding, the traditional process requires mechanical disruption or detergent lysis to obtain the target protein. This process not only causes up to 40% product loss, but also introduces the risk of host cell DNA and protease contamination. Summary of the Invention

[0004] Based on the above defects, the present disclosure has constructed a triple technical system: (1) Based on the codon preference optimization strategy of HEK293T cells, the codon adaptation index (CAI) of the HBc gene is increased from 0.69 to 0.930, effectively reducing ribosome stalling, thereby increasing protein production; (2) The immunoglobulin kappa light chain secretion signal peptide is introduced to achieve secretion of the expression product into the cell supernatant, thereby improving the purification efficiency of the mammalian expression system; (3) A multi-dimensional VLP evaluation standard is established, with western blot determination of HBc VLP molecular weight, dynamic light scattering (DLS) characterization of particle size uniformity, and transmission electron microscopy (TEM) analysis of VLP structural integrity. By integrating codon optimization and secretion-directed strategies, the present disclosure has achieved the secretory expression of HBc VLP in HEK293 cells for the first time, providing a new path for large-scale production.

[0005] The present disclosure provides a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO.2.

[0006] The present disclosure also provides a polypeptide, which is encoded by the above nucleic acid molecule.

[0007] The present disclosure also provides a recombinant plasmid, which includes the above-mentioned nucleic acid molecule.

[0008] The present disclosure also provides a method for preparing a recombinant protein, comprising: optimizing the HBc gene to include a nucleic acid sequence of SEQ ID NO. 2; constructing a recombinant plasmid based on the nucleic acid sequence; transfecting the recombinant plasmid into HEK293 cells for expression; and collecting the cell supernatant for purification of the recombinant protein.

[0009] The present invention optimizes the HBc gene based on the codon preference of HEK293 cells, and increases its codon adaptation index (CAI) value to 0.930. Subsequently, a recombinant vector pSecTag2A-HBc-VLP-His containing a κ light chain secretion signal peptide was constructed and transfected into HEK293 cells. After transfection, the secretory protein was purified by nickel column chromatography, and the expression of the purified protein was detected by Western blot. At the same time, dynamic light scattering (DLS) and transmission electron microscopy (TEM) were used to verify the characteristics of VLP. The results of the Western Blot experiment showed that the 23kDa target protein achieved efficient secretory expression. The particle size analyzer test showed that the average particle size of the HBc VLPs nanoparticles was 28.2nm. Transmission electron microscopy observed that it formed spherical microparticles with a particle size of about 30nm, which were morphologically similar to natural hepatitis B virus (HBV) microparticles and had good VLP characteristics. The expression system established in the present disclosure has the remarkable characteristics of high efficiency and low pollution. It not only overcomes the shortcomings of traditional expression systems, but also provides new strategies and technical support for the efficient production of vaccines and the development of nanocarriers. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The map of the pSecTag2A-HBc-VLP-His expression vector is shown, wherein Igκleader: immunoglobulin κ light chain secretion signal peptide base sequence; HBc VLP: hepatitis B core protein virus-like particle base sequence; N: N-terminal base sequence; C: C-terminal base sequence; MIR: major immunogenic region base sequence; Myc: Myc tag protein sequence; 6×His: 6×His tag sequence.

[0011] Figure 2 Figure 2 shows the pSecTag2A-HBc-VLP-His expression vector digested with restriction enzymes AvrII and NheI, followed by agarose gel electrophoresis. M: DNA marker; 1: vector digested with restriction enzymes AvrII and NheI; 2: vector not digested with restriction enzymes.

[0012] Figure 3 The figure shows Western blot analysis of purified HBc VLPs. Following SDS-PAGE electrophoresis and PVDF transfer, HBc VLP expression was detected using an anti-6×His antibody. The results show a band located below 25 kD. Figures 1 and 2: Protein purified from the supernatant of HEK293 cells transfected with pSecTag2A-HBc-VLP-His and then purified using a nickel column. Figure 3: Protein purified from the supernatant of HEK293 cells transfected with pSecTag2A and then purified using a nickel column.

[0013] Figure 4 The self-assembly effect of HBc VLPs was detected by transmission electron microscopy. DETAILED DESCRIPTION

[0014] The following embodiments may enable those skilled in the art to more fully understand the present disclosure, but are not intended to limit the present disclosure in any way.

[0015] Unless otherwise noted, all materials and reagents used in the following examples were commercially available. Vectors and cells: pSecTag2A vector (containing hygromycin resistance, Thermo Fisher); HEK293 cells (Gibco); TurboFect transfection reagent (Thermo Scientific); and Ni-NTA resin (Sigma).

[0016] HBc gene optimization and vector construction

[0017] Based on the codon preference of human cells, the HBc gene (GenBank: EU306684.1) was optimized. The base sequence before optimization is SEQ ID NO.1:

[0018] ATGGACATTGACCCGTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTCTTTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCTTCTCGACACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCATACGGCTCTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTAGCCACCTGGGTGGGAAGTAA TTTGGAAGATCCAGCATCCAGGGAATTAGTAGTCAGCTATGTCAACGTTAATATGGGCCTAAAAATCAGACAACTATTGTGGTTTCACATTTCCTGTCTTACTTTTGGGAGAGAAACTGTTCTTGAATATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCACCTGCATATAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTT.

[0019] The optimized base sequence is SEQ ID NO.2:

[0020] ATGGACATCGACCCCTACAAGGAGTTCGGCGCCAGCGTGGAGCTGCTGAGCTTCCTTCCCAGCGACTTCTTCCCTAGCATCAGGGACCTGCTGGACACCGCCTCTGCCCTGTATAGGGAGGCCCTTGAGTCTCCTGAGCACTGCAGCCCTCACCACACCGCCTTAAGGCAGGCCATCCTGTGTTGGGGAGAGCTGATGAACCTGGCCACCTGGGTGGGCAGCAA CCTGGAGGACCCGGCCAGCCGCGAGCTGGTAGTGAGCTACGTGAACGTGAACATGGGCCTGAAGATCAGGCAGCTGCTGTGGTTCCACATCAGCTGCCTGACCTTCGGCAGGGAGACCTGGTGAGCTTCGGAGTGTGGATCAGGACCCCTCCCGCCTATAGGCCTCCCAACGCTCCTATCCTGAGCACCTTGCCTGAGACCACCGTGGTG.

[0021] The codon adaptation index (CAI) before and after optimization was calculated to evaluate the codon optimization effect. Based on the optimization results, Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to complete the full gene synthesis of HBc-VLP and then embedded into the plasmid to produce the HBc-VLP recombinant plasmid (pSecTag2A-HBc-VLP-His) (structure see Figure 1 ).

[0022] The recombinant plasmid was identified by restriction endonucleases (AvrII and NheI), and its accuracy was verified by DNA sequencing.

[0023] Different species have different amino acid codon biases. The present invention optimizes the hepatitis B virus core antigen (HBc) gene based on human codon usage bias. After optimization, the codon adaptation index (CAI) of the HBc gene significantly increased from 0.690 to 0.930, and the GC content was also adjusted from 48.2% to 65.4%. The optimized sequence ( Figure 1 ) was synthesized directly by the company on the secretion vector pSecTag2A, inserted after the secretion signal sequence Igκleader, and retained the expression ability of Myc and 6×His sequences to facilitate subsequent purification and identification. It was identified by restriction endonuclease AvrII and NheI ( Figure 2). Agarose gel electrophoresis results were consistent with expectations, showing two enzyme-digested products (lane 1), sized 4441 bp and 1670 bp, respectively, while no corresponding bands were observed from the undigested plasmid (lane 2). Plasmid sequencing results confirmed that the inserted sequence was identical to the optimized sequence. The successfully constructed expression vector was named pSecTag2A-HBc-VLP-His.

[0024] Cell transfection and protein expression

[0025] HEK293 cells were seeded into 10 cm cell culture dishes and cultured overnight in 10 ml of complete DMEM medium (DMEM medium with 10% fetal bovine serum (FBS); FBS (EallBio, Cat. No. 03.U16001DC), DMEM (ThermoFisher, Cat. No. 10569044). Transfection was performed after the cell density reached 80%, following the TurboFect transfection reagent instructions. To 1 ml of serum-free DMEM medium, 15 μg of plasmid (pSecTag2A-HBc-VLP-His) was added and mixed. Then, 15 μl of transfection reagent (TurboFect) was added, mixed, and allowed to stand at room temperature for 15 minutes before addition to the cell culture dish. The dish was incubated overnight in a 37°C, 5% CO2 incubator, followed by supplementation with 10 ml of complete DMEM medium. Cell supernatants were collected 48 hours after transfection for detection of secreted proteins.

[0026] After nickel column purification, the protein was verified by Western blot, and a specific band was detected using a His tag antibody ( Figure 3 ), confirming the successful expression of the target protein.

[0027] Protein purification and self-assembly ability identification

[0028] The collected cell supernatant was filtered through a 0.22 μm filter membrane and purified using the constructed VLP protein containing a His tag using the AKTA protein purification system and a nickel column. After loading, the UV280 signal of the instrument increased and gradually remained stable during the loading process; after the protein was loaded onto the column, the column was rinsed with PBS buffer containing 4 M urea (ThermoFisher, catalog number: 10010001); after the UV280 signal dropped to a stable state, it was switched to PBS buffer containing 300 mM imidazole and 4 M urea for elution and the eluted protein was collected; further gradient dialysis was performed for 3 days using PBS buffer containing 4 M, 2 M, and 0 M urea. SDS-PAGE electrophoresis was performed using a 10% separating gel, and the primary antibody used was a mouse anti-His monoclonal antibody (Abcam, 1:2000). The target protein was detected by western blot. The particle size and molecular size were measured using a Malvern Zetasizer Nano ZS nanoparticle size analyzer using dynamic light scattering, and the particle size distribution was analyzed. The samples were negatively stained with 2% phosphotungstic acid and the morphology of the VLPs was observed using a Hitachi HT7800 transmission electron microscope (120 kV).

[0029] In the PBS buffer system, the particle size analyzer measurement results are shown in Table 1. The purified protein is negatively charged, with an average particle size of 28.2 nm and a polymer dispersion index (PDI) of 0.233, indicating that the purified protein self-assembles to form HBc VLPs nanoparticles.

[0030] Table 1

[0031]

[0032] Transmission electron microscopy showed that HBc VLPs formed spherical particles with a diameter of about 30 nm and a complete surface structure ( Figure 4 ), whose morphology is similar to that of natural HBV particles. The above results confirm the successful preparation of HBcVLPs with self-assembly ability.

[0033] This publication successfully constructed a eukaryotic expression system for HBc VLPs based on codon optimization and secretion signal peptide guidance, opening up new avenues for the research and application of HBc VLPs. This system overcomes many drawbacks of traditional expression systems, offers significant advantages, and holds broad promise in multiple fields.

[0034] Compared with the prokaryotic expression system, the eukaryotic expression system has the following core advantages: at the post-translational modification level, the eukaryotic system can ensure that the protein is post-translationally modified and processed, promote the natural folding of the protein, form the correct disulfide bond, and thus ensure that the protein has complete biological activity and function; the prokaryotic expression system lacks the protein post-translational modification mechanism, and the expression product is easy to form inclusion bodies, which requires subsequent complex renaturation operations, which not only increases costs but also affects protein yield. From the perspective of product uniformity, the secretory protein eukaryotic expression system used in this disclosure presents a single band after western blot detection, which indicates that the product is of high purity and good consistency; however, the prokaryotic expression system often produces degradation fragments, and even if a protease-deficient strain is used, it is difficult to completely solve this problem, thereby interfering with subsequent experiments and applications. In terms of endotoxin control, there is no endotoxin contamination problem in the eukaryotic cell culture process; while the endotoxin level in the prokaryotic expression system is high, it must be removed with the help of additional and complex processes such as extraction, which increases the complexity and potential risks of the operation. In terms of large-scale production potential, suspended CHO cells can achieve large-scale production in 2000L bioreactors. In contrast, the fermentation scale of E. coli is usually less than 500L, which is difficult to meet the growing demand for large-scale industrialization.

[0035] The secretory expression design disclosed herein avoids cell lysis, greatly simplifies the purification process, effectively reduces host protein contamination, and complies with GMP-grade production requirements. The codon optimization strategy significantly improves translation efficiency in eukaryotic systems and significantly increases protein yield by reducing ribosome stalling, providing strong support for the large-scale production of HBc VLPs.

[0036] Looking ahead to the application prospects of the HBc VLP eukaryotic expression system, it has enormous potential in the biomedical field. In the prevention and treatment of infectious diseases, in addition to developing vaccines for diseases such as influenza and cervical cancer, key antigenic epitopes of highly pathogenic viruses such as Ebola virus can also be embedded in HBc VLP. Leveraging the powerful immunogenicity and adjuvant properties of HBc VLP, it can stimulate the body to produce a strong immune response, providing new ideas and new methods for the development of new and highly effective vaccines. In the field of tumor treatment, HBc VLP can not only serve as a tumor vaccine delivery vehicle, but can also be fused with therapeutic antigen fragments, immunomodulatory factors, etc., to enable specific activation of the immune system at the tumor site and enhance the body's ability to kill tumor cells. Furthermore, combined with gene therapy technology, nucleic acids encoding tumor suppressor genes or interfering with the expression of tumor-related genes can be loaded onto HBc VLP to achieve precise tumor gene therapy.

[0037] In the field of biosensors, HBc VLPs, given their regular structure and excellent stability, can be used as recognition elements in biosensors. By modifying the HBc VLP surface with specific ligands or antibodies, they can be specifically recognized by target biomolecules such as pathogens and tumor markers. Combined with modern detection technologies such as electrochemical and optical detection, highly sensitive and specific biosensors can be constructed for early disease diagnosis and rapid detection of biomolecules.

[0038] In drug development, HBc VLPs can be used as a drug screening tool. By leveraging their ability to self-assemble into stable particles, drug target proteins or receptors can be expressed on the surface of HBc VLPs to construct in vitro drug screening models. Using high-throughput screening techniques, compounds that specifically bind to their targets can be rapidly identified, providing lead compounds for new drug development and accelerating the drug development process.

[0039] In summary, the HBc VLP eukaryotic expression system constructed in this study demonstrates broad application prospects in multiple fields. With continued optimization and improvement of the technology, it is expected to bring new innovations and development opportunities to fields such as biomedicine and bioassays, making significant contributions to human health.

[0040] Those skilled in the art should understand that the above embodiments are merely exemplary embodiments and that various changes, substitutions, and alterations may be made without departing from the spirit and scope of the present disclosure.

Claims

1. A nucleic acid molecule, characterized in that The nucleic acid molecule includes the nucleic acid sequence of SEQ ID NO.

2.

2. A polypeptide, characterized in that The polypeptide is encoded by the nucleic acid molecule of claim 1.

3. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the nucleic acid molecule according to claim 1.

4. A method for preparing a recombinant protein, characterized in that: include: Optimizing the HBc gene to include the nucleic acid sequence of SEQ ID NO. 2; constructing a recombinant plasmid based on the nucleic acid sequence; The recombinant plasmid was transfected into HEK293 cells for expression; The cell supernatant was collected for purification of the recombinant protein.

Images