Engineering bacterium for synthesizing mannitol by catalyzing glucose through multi-enzyme system and application of engineering bacterium

Abstract

The invention provides a gene recombination escherichia coli group for synthesizing D-mannitol by catalyzing glucose through a multi-enzyme system. The gene recombination escherichia coli group comprises escherichia coli a containing insertion or enhanced expression of a glucose isomerase M2E coding gene; the escherichia coli b comprises insertion or enhanced expression of the coding gene of the NAD (H) dependent mannose-1-dehydrogenase MDH1; and Escherichia coli c comprising insertion or enhanced expression of an NAD (H)-dependent formate dehydrogenase FDH encoding gene. According to the strain and the synthesis method, glucose is used as a raw material, through multienzyme catalysis, the system comprises NADH circulation, an efficient synthesis system of D-mannitol is established, no by-product is generated in the fermentation process, high-concentration cofactors do not need to be added, and industrial production of D-mannitol is facilitated.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology, and specifically to an engineered bacterium for catalyzing the synthesis of mannitol from glucose using a multi-enzyme system and its application. Background Art

[0002] D-mannitol is a natural hexavalent alcohol with a sweetness 50-70% that of sucrose. It is an isomer of sorbitol and is low in calories and does not participate in the glycemic response or the Maillard reaction. D-mannitol is widely found in nature. In many organisms, mannitol is used as a carbon source, carbon storage, and as an osmotic pressure regulating compound for abiotic stress responses. Furthermore, D-mannitol exhibits antioxidant properties, is very low in hygroscopicity, and is very stable. These diverse properties have led to its widespread application in the food, medical, and chemical industries. 1) D-mannitol is used as a raw material in the pharmaceutical industry for the preparation of diuretics, dehydrating agents, disaccharide substitutes, and pharmaceutical excipients. 2) In the food industry, it is used in foods for diabetic patients, bodybuilding foods, and as a low-calorie, low-sugar sweetener. 3) In the plastics industry, it is used to make rosin acid esters, artificial glycerol resins, polyvinyl chloride plasticizers, and explosives.

[0003] There are three main industrial synthesis methods for D-mannitol: plant extraction, chemical methods, and microbial methods. A common plant extraction method is water-bath extraction, which is energy-intensive and environmentally unfriendly. Chemical synthesis is a commonly used synthesis method in industry. This method uses a metal catalyst to catalyze the hydrogenation of the substrate under high temperature conditions, reducing glucose to D-sorbitol and fructose to a mixture of D-mannitol and D-sorbitol. Therefore, this method has disadvantages such as low yield, high separation costs, and strict reaction conditions. Microbial methods include microbial fermentation and enzyme catalysis. The production of D-mannitol by microbial fermentation produces byproducts and has a long fermentation cycle. The dual-enzyme catalysis method has the problem of high cofactor concentration (mmol / L level), which limits the scale of industrial production of D-mannitol. Summary of the Invention

[0004] The present invention aims to provide a method for synthesizing mannitol from glucose using a multi-enzyme system. This method uses glucose as a raw material and establishes a D-mannitol synthesis system through dual enzyme catalysis and the addition of an NADH cycle. This method addresses the shortcomings of existing technologies.

[0005] According to an exemplary embodiment of the present invention, the present invention provides a group of genetically recombinant Escherichia coli for catalyzing the synthesis of D-mannitol from glucose by a multi-enzyme system, comprising:

[0006] Escherichia coli a, comprising the insertion or enhanced expression of a gene encoding glucose isomerase M2E;

[0007] Escherichia coli b, comprising an insertion or enhanced expression of a gene encoding NAD(H)-dependent mannose-1-dehydrogenase MDH1; and

[0008] Escherichia coli c, comprising the insertion or enhanced expression of a gene encoding NAD(H)-dependent formate dehydrogenase FDH.

[0009] Optionally or alternatively, E. coli b and E. coli c are the same strain.

[0010] Alternatively or optionally, the nucleotide sequence of the glucose isomerase M2E encoding gene is shown as SEQ ID No. 2.

[0011] Alternatively or optionally, the nucleotide sequence of the gene encoding NAD(H)-dependent mannose-1-dehydrogenase MDH1 is shown in SEQ ID No.4.

[0012] Alternatively or optionally, the gene encoding NAD(H)-dependent formate dehydrogenase FDH is shown as SEQ ID No.6.

[0013] According to an exemplary embodiment of the present invention, the present invention provides a method for catalyzing glucose into D-mannitol using a multi-enzyme system, comprising:

[0014] Cultivate the E. coli group described in any one of the above, collect the crude enzyme solution, use glucose as raw material, add sodium formate and NAD + / NADH, synthesizes D-mannitol.

[0015] According to an exemplary embodiment of the present invention, the present invention provides a method for catalyzing glucose into D-mannitol using a multi-enzyme system, comprising:

[0016] Cultivate the E. coli group described in any one of the above, use E. coli whole cells as catalyst, use glucose as raw material, add sodium formate and NAD + / NADH, whole cell catalyzes the synthesis of D-mannitol.

[0017] According to an exemplary embodiment of the present invention, the present invention provides use of any of the aforementioned Escherichia coli groups in synthesizing D-mannitol.

[0018] In the first aspect, the present invention provides a multi-enzyme catalytic synthesis method for synthesizing D-mannitol. The multi-enzyme catalytic system is composed of glucose isomerase, mannose-1-dehydrogenase, and formate dehydrogenase that provides NADH circulation. Glucose isomerase (M2E) uses glucose as a substrate and catalyzes the isomerization of glucose into D-mannose; NAD(H)-dependent mannose-1-dehydrogenase (MDH1) uses D-mannose as a substrate and catalyzes the synthesis of mannose into D-mannitol; NAD(H)-dependent formate dehydrogenase (FDH) uses formate and NAD as a substrate and catalyzes the synthesis of D-mannitol from mannose. + Synthesize NADH as substrate.

[0019] Furthermore, the glucose isomerase may be derived from Runella slithyformis, the NAD(H)-dependent mannose-1-dehydrogenase may be derived from Apium graveolens, and the NAD(H)-dependent formate dehydrogenase may be derived from Starkeya nomas.

[0020] Furthermore, the glucose isomerase may be any of the following:

[0021] (A1) a protein with the amino acid sequence shown in SEQ ID No. 1;

[0022] (A2) a protein having the same function as SEQ ID No. 1 with one or more amino acid residues substituted and / or deleted and / or added;

[0023] (A3) a protein having 99% or greater, 95% or greater, 90% or greater, 85% or greater, or 80% or greater identity to SEQ ID No. 1 and derived from Runella slithyformis and having the same function;

[0024] (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 1.

[0025] Furthermore, the NAD(H)-dependent mannose-1-dehydrogenase may be any of the following:

[0026] (B1) a protein with the amino acid sequence shown in SEQ ID No. 3;

[0027] (B2) a protein having the same function as SEQ ID No. 3 with one or more amino acid residues substituted and / or deleted and / or added;

[0028] (B3) a protein having 99% or greater, 95% or greater, 90% or greater, 85% or greater, or 80% or greater identity to SEQ ID No. 3 and derived from Apium graveolens having the same function;

[0029] (B4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 3.

[0030] Furthermore, the NAD(H)-dependent formate dehydrogenase may be any of the following:

[0031] (C1) a protein with an amino acid sequence as shown in SEQ ID No. 5;

[0032] (C2) a protein having the same function as SEQ ID No. 5 with one or more amino acid residues substituted and / or deleted and / or added;

[0033] (C3) a protein having 99% or greater, 95% or greater, 90% or greater, 85% or greater, or 80% or greater identity to SEQ ID No. 5 and derived from Starkeya nomas with the same function;

[0034] (C4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 5.

[0035] In the above proteins, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0036] Furthermore, the glucose dehydrogenase, mannose-1-dehydrogenase and formate dehydrogenase can be obtained by conventional methods, such as prokaryotic expression, cell disruption or protein purification.

[0037] Furthermore, the cell disruption can be performed by ultrasonic disruption or high-pressure homogenization.

[0038] Furthermore, the protein purification can be performed by nickel column affinity chromatography.

[0039] Furthermore, the recipient bacteria for prokaryotic expression in the present invention is preferably Escherichia coli; more preferably Escherichia coli BW25113.

[0040] In the method, the genes encoding glucose isomerase, NAD(H)-dependent mannose-1-dehydrogenase, and NAD(H)-dependent formate dehydrogenase can be introduced into the recipient bacteria in the form of a recombinant vector.

[0041] In one embodiment of the present invention, the recombinant vector is a recombinant plasmid obtained by cloning the gene encoding the glucose isomerase into the pBAD / HisB vector; and the recombinant plasmid obtained by cloning the NAD(H)-dependent mannose-1-dehydrogenase and the NAD(H)-dependent formate dehydrogenase into the pBAD / HisB vector. Specifically, the gene encoding the glucose isomerase is cloned between the restriction sites XhoI and SpeI of the pBAD / HisB vector; the NAD(H)-dependent mannose-1-dehydrogenase is cloned between the restriction sites XhoI and SpeI of the pBAD / HisB vector; and the NAD(H)-dependent formate dehydrogenase is cloned between the restriction sites SpeI and PstI of the pBAD / HisB vector.

[0042] In a second aspect, the present invention provides a multi-enzyme catalytic system for the synthesis of D-mannitol.

[0043] Furthermore, the reaction system is a phosphate buffer solution with a pH of 7.0-8.0.

[0044] Furthermore, the reaction system is: 100g / L glucose, 300-500mM sodium formate (preferably 500mM), 1mM NAD + and / or NADH (preferably NAD + ), 30 OD / mL glucose isomerase, 30 OD / mL NAD(H)-dependent mannose-1-dehydrogenase, and 30 OD / mL NAD(H)-dependent formate dehydrogenase.

[0045] Furthermore, the reaction temperature is 30-40°C, preferably 37°C.

[0046] Furthermore, the reaction speed is 600 rpm.

[0047] Furthermore, the reaction time is 24 hours.

[0048] In a third aspect, the present invention claims protection for the synthesis of D-mannitol using the method described in the first aspect above.

[0049] According to the above aspects of the present invention, the strain and synthesis method of the present invention use glucose as a raw material, through multi-enzyme catalysis, and the system includes an NADH cycle to establish an efficient synthesis system for D-mannitol. There are no by-products during the fermentation process, and no high-concentration cofactors need to be added, which is conducive to the industrial production of D-mannitol. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The liquid chromatography spectra of glucose, D-mannose and D-mannitol standards are shown in Figure 2. DETAILED DESCRIPTION

[0051] definition

[0052] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0053] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.

[0054] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.

[0055] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.

[0056] The term "carbon source" refers to a source of carbon, preferably a compound or molecule containing carbon. Preferably, the carbon source is a carbohydrate, an amino acid and its derivatives, etc. In this article, a carbon source is understood to be an organic compound composed of the elements carbon, oxygen and hydrogen.

[0057] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.

[0058] As used herein, the term "recombination" / "engineered" (e.g., mentioning "recombinant E. coli," "recombinant cell," "recombinant microorganism," and / or "recombinant strain") can refer to cells, microorganisms, or strains containing nucleic acids as a result of one or more genetic modifications. Briefly, cells, microorganisms, or strains contain different combinations of nucleic acids from one or more parents (any of which). In order to construct recombinant cells, microorganisms, or strains, one or more recombinant DNA techniques and / or other one or more mutagenesis techniques can be used. For example, recombinant E. coli and / or recombinant E. coli cells can comprise nucleic acids that are not present in corresponding wild-type E. coli and / or cells, recombinant DNA techniques have been used to introduce this nucleic acid into this E. coli or E. coli cells, or this nucleic acid that is not present in the wild-type E. coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in the nucleic acid sequence (such as a gene encoding a wild-type polypeptide) present in the wild-type E. coli and / or E. coli cells. In addition, the term "recombination" can suitably relate to cells, microorganisms, or strains that have, for example, used recombinant DNA techniques to remove nucleic acid sequences therefrom.

[0059] In this article, the recombinant E. coli comprising or having a certain activity is understood to mean that the recombinant E. coli may comprise one or more nucleic acid sequences encoding a protein having such activity, thereby allowing the recombinant E. coli to functionally express such a protein or enzyme.

[0060] The term "functionally expressed" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example resulting in the synthesis of a protein.

[0061] As used herein with respect to a protein or polypeptide, the term "mutation" means that at least one amino acid has been replaced, inserted into, or deleted from an amino acid sequence compared to a wild-type or naturally occurring protein or polypeptide sequence. Amino acid substitution, insertion, or deletion can be achieved, for example, via mutagenesis of nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in Sambrook et al., Molecular Cloning-A Laboratory Manual, 2nd edition, Vols. 1-3 (1989), published by Cold Spring Harbor Publishing.

[0062] As used herein with respect to a gene, the term "mutation" means that at least one nucleotide in the nucleic acid sequence of a gene or its regulatory sequence has been replaced, inserted into, or deleted from a nucleic acid sequence by a different nucleotide compared to a wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of an amino acid can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence having a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0063] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.

[0064] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of the polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0065] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0066] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, such as those exhibited by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. An essential property of such analogues of naturally occurring amino acids is that, when incorporated into a protein, the protein is specifically reactive with antibodies elicited against a protein composed entirely of the same naturally occurring amino acids. The terms "polypeptide," "peptide," and "protein" also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0067] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet (yet) been classified in a given category but can be so classified.

[0068] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0069] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes, it describes every possible silent variation of nucleic acid. The term "conservatively modified variant" is applicable to both amino acid and nucleic acid sequences. With regard to a specific nucleic acid sequence, conservatively modified variants refer to those nucleic acids encoding identical amino acid sequences or conservatively modified amino acid sequence variants due to the degeneracy of the genetic code. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Therefore, at each position where a codon specifies alanine, the codon can be changed to any described corresponding codon without changing the encoded polypeptide. This type of nucleic acid variation is a "silent variation" and represents a conservatively modified variation.

[0070] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0071] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.

[0072] Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the compared sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

[0073] When an amino acid or nucleotide sequence exhibits a certain level of similarity, it is said to be homologous. Two sequences being homologous indicate a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by a "percent identity" or "percent similarity," which is high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate "percent identity" or "percent similarity." Comparison of sequences and determination of the percent identity between two sequences can be accomplished using mathematical algorithms. The skilled artisan will be aware of the fact that several different computer programs are available for aligning two sequences and determining homology between them (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", (1983), Society for Industrial and Applied Mathematics (SIAM), Vol. 25, No. 2, pp. 201-237, and in the handbook edited by D. Sankoff and J.B. Kruskal (eds.), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA).

[0074] The percent identity between two amino acid sequences can be determined by aligning two sequences using the Needleman and Wunsch algorithm (Needleman et al. "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. 48, 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics, Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices may be specified. Optional parameters for amino acid sequence alignments are a gap opening penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all of these different parameters will produce slightly different results, but the overall percent identity of the two sequences does not change significantly when different algorithms are used.

[0075] Homology or identity is the percentage of identical matches between two complete sequences over the total aligned area including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing identical amino acids in the two sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the program's output.

[0076] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment showing the identical amino acid in the two sequences divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the program's output.

[0077] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0078] Optionally, when determining the degree of amino acid similarity, the skilled person may also consider so-called "conservative" amino acid substitutions, which will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, a conservative amino acid substitution group is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0079] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.

[0080] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into protein.

[0081] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.

[0082] The term "upregulation" and its variants refer to a process by which a cell increases the amount of a cellular component (such as RNA or protein). Such upregulation can be in response to or caused by a genetic modification.

[0083] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.

[0084] The nucleic acid sequence (ie, polynucleotide) or protein (ie, polypeptide) may be native or heterologous to the genome of the host cell.

[0085] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0086] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.

[0087] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.

[0088] As used herein, the term "vector" includes reference to autosomal expression vectors and integration vectors for integration into a chromosome.

[0089] The term "expression vector" refers to a linear or circular DNA molecule comprising a segment encoding a polypeptide of interest, which segment is under the control of (i.e., operably linked to) another nucleic acid segment that provides for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like. Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both.

[0090] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.

[0091] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.

[0092] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.

[0093] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0094] In the following examples, Escherichia coli BW25113 (Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000; 97(12):6640-6645.) is a non-pathogenic bacterium with a clear genetic background, a short generation time, easy cultivation, and low-cost culture medium raw materials.

[0095] It will be understood by those skilled in the art that the genes disclosed herein or their functional homologs comprise nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the exemplified sequences, or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions when compared to the amino acid sequences encoded thereby.

[0096] Preferably, the amino acid sequence encoded by any functional homolog of a gene has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 amino acid mutations, substitutions, insertions and / or deletions compared to the amino acid sequence encoded by a gene.

[0097] By way of example and not limitation, the functional homolog of the BmMedh2 gene shown in SEQ ID NO.6 comprises a nucleic acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with any of those nucleic acid sequences, or a functional homolog thereof comprises a nucleic acid sequence having one or more mutations, substitutions, insertions and / or deletions when compared to any of those nucleic acid sequences; preferably, the nucleic acid sequence of any such functional homolog has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10 or no more than 5 nucleic acid mutations, substitutions, insertions and / or deletions compared to such nucleic acid sequences. More preferably, the functional homolog of the BmMedh2 gene comprises an amino acid sequence having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with the polypeptide represented by SEQ ID NO.1.

[0098] Those skilled in the art will appreciate that other sequences include the above situations.

[0099] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.

[0100] Escherichia coli BW25113: NBRPE. colistrain, catalog number: ME9062 (https: / / shigen.nig.ac.jp / ecoli / strain / resource / strainGeneMutant / list).

[0101] The Trans1-T1 competent cells in the following examples are products of Beijing Quanshijin Biotechnology Co., Ltd., with the product catalog number CD501.

[0102] Vector pBAD / HisB: Invitrogen, product catalog number V430-01.

[0103] D-glucose: Sangon Biotech, product catalog number A600218.

[0104] D-Mannose: Macklin, catalog number D813082.

[0105] D-Mannitol: Macklin, catalog number M813423.

[0106] Sodium formate: Macklin, catalog number S817616.

[0107] The primer sequences in the following examples are as follows:

[0108] Table 1 shows the primer sequences

[0109] Primer name Sequence (5'-3') P1 caggaggaattaaccATGACTTCCGAGAAGATCGCGAG P2 accgagctcaccgaattcTTAAACACCTTTAGCGATCTTA P3 gctaacaggaggaattaaccATGGCAAAGAGTTCCGAAATCGAAC P4 agctcaccgaattcTTAAGCGCCCAGAGATTCTTCGGTA P5 taacaggaggaattaaccatggcgaaggtgctgtgcgttctgt P6 agctcaccgaattcttaaaccgctttcttgaatttcgccg

[0110] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of glucose isomerase (M2E) is WP_013930124.1 (22-JUL-2024), its amino acid sequence is shown in SEQ ID No. 1, the NCBI Reference Sequence Number of its encoding gene is Gene ID: 3094987 (30-APR-1998), and its nucleotide sequence is shown in SEQ ID No. 2.

[0111] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of NAD(H)-dependent mannose-1-dehydrogenase is Q38707.1, and its amino acid sequence is shown in SEQ ID No. 3. The NCBI Reference Sequence Number of its encoding gene is 3094987 (05-FEB-2025), and its nucleotide sequence is shown in SEQ ID No. 4.

[0112] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the NAD(H)-dependent formate dehydrogenase is WP_159599443.1, and its amino acid sequence is shown in SEQ ID No. 5. The NCBI Reference Sequence Number of its encoding gene is NZ_CACSAS010000001 (07-APR-2024), and its nucleotide sequence is shown in SEQ ID No. 6.

[0113] Example 1, expression of glucose isomerase, NAD (H) dependent mannose-1-dehydrogenase, NAD (H) dependent methyl Construction of recombinant bacteria producing acid dehydrogenase

[0114] The glucose isomerase involved in this example is derived from Runella slithyformis, and its amino acid sequence is shown in SEQ ID No. 1, and the corresponding encoding nucleotide sequence is shown in SEQ ID No. 2. The NAD(H)-dependent mannose-1-dehydrogenase involved in this example is derived from Apium graveolens, and its amino acid sequence is shown in SEQ ID No. 3, and the corresponding encoding nucleotide sequence is shown in SEQ ID No. 4. The NAD(H)-dependent formate dehydrogenase involved in this example is derived from Starkeyanomas, and its amino acid sequence is shown in SEQ ID No. 5, and the corresponding encoding nucleotide sequence is shown in SEQ ID No. 6.

[0115] 1. Acquisition of RSM2E gene fragment

[0116] Using the artificially synthesized sequence containing SEQ ID No. 2 (synthesized by Nanjing GenScript Biotech Co., Ltd.) as a template, PCR amplification was performed using primers P1 and P2 to obtain a PCR product, namely the gene sequence encoding glucose isomerase. The primer sequences are shown in Table 1.

[0117] The PCR product was examined by 1% agarose gel electrophoresis. The product was approximately 1000 bp in size, consistent with the target fragment, and was designated the RSM2E gene fragment (RS stands for Runella slithyformis, and RSM2E stands for M2E derived from RS). The RSM2E gene fragment was recovered from the gel.

[0118] 2. Construction of pBAD / HisB-RSM2E recombinant vector

[0119] After double digestion of the pBAD / HisB vector with XhoI and SpeI, the vector fragment (approximately 3500 bp) was recovered. The RSM2E gene fragment recovered in step 1 was ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345) to obtain a ligation product. The ligation product was transformed into Trans1-T1 competent cells and plated on LB plates containing streptomycin. Incubate at 37°C overnight. Single clones were selected, plasmids were extracted, and sequencing was performed to verify the identity of the vector. The vector containing the correct plasmid was designated pBAD / HisB-RSM2E. pBAD / HisB-RSM2E structure description: The recombinant plasmid was obtained by replacing the small fragment between the restriction sites XhoI and SpeI of the pBAD / HisB vector with the DNA fragment shown in SEQ ID No. 2.

[0120] 3. Acquisition of AGMDH1 gene fragment

[0121] Using the synthetic sequence containing SEQ ID No. 4 (synthesized by Nanjing GenScript Biotech Co., Ltd.) as a template, PCR amplification was performed using primers P3 and P4 to obtain the PCR product, which is the gene sequence encoding NAD(H)-dependent mannose-1-dehydrogenase. Primer sequences are shown in Table 1.

[0122] The PCR product was detected by 1% agarose gel electrophoresis. The PCR product was approximately 1000 bp in size, consistent with the target fragment, and was named AGMDH1 (AG stands for Apium graveolens, and AGMDH1 stands for MDH1 derived from AG). The AGMDH1 gene fragment was recovered from the gel.

[0123] 4. Construction of pBAD / HisB-AGMDH1 recombinant vector

[0124] After double digestion of the pBAD / HisB vector with XhoI and SpeI, the vector fragment (approximately 3500 bp) was recovered. The AGMDH1 gene fragment recovered in step 1 was ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345) to obtain a ligation product. The ligation product was transformed into Trans1-T1 competent cells and plated on LB plates containing streptomycin. Incubate overnight at 37°C. Single clones were selected, plasmids were extracted, and sequencing was performed to verify the identity of the vector. The vector containing the correct sequence was designated pBAD / HisB-AGMDH1. pBAD / HisB-AGMDH1 structure description: The recombinant plasmid was obtained by replacing the small fragment between the restriction sites XhoI and SpeI of the pBAD / HisB vector with the DNA fragment shown in SEQ ID No. 4.

[0125] 5. Obtaining SFDH gene fragments

[0126] Using the artificially synthesized sequence containing SEQ ID No. 6 (synthesized by Nanjing GenScript Biotech Co., Ltd.) as a template, PCR amplification was performed using primers P5 and P6 to obtain a PCR product, namely the gene sequence encoding NAD(H)-dependent formate dehydrogenase.

[0127] The PCR product was examined by 1% agarose gel electrophoresis. The product was approximately 1000 bp in size, consistent with the target fragment, and was named the SFDH gene fragment (S stands for Starkeya nomas, and SFDH stands for FDH derived from S). The SFDH gene fragment was recovered from the gel.

[0128] 6. Construction of pBAD / HisB-SFDH recombinant vector

[0129] After double digesting the pBAD / HisB vector with SpeI and PstI, the vector fragment (approximately 3500 bp) was recovered. The SFDH gene fragment recovered in step 1 was ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345) to produce a ligation product. The ligation product was transformed into Trans1-T1 competent cells and plated on LB plates containing streptomycin. Incubate overnight at 37°C. Single clones were selected, plasmids were extracted, and sequencing was performed to verify the identity of the vector. The vector containing the correct sequence was designated pBAD / HisB-SFDH. pBAD / HisB-SFDH structure description: The recombinant plasmid is obtained by replacing the small fragment between the restriction sites SpeI and PstI of the pBAD / HisB vector with the DNA fragment shown in SEQ ID No.6.

[0130] 7. Construction of pMDH1FDH recombinant vector

[0131] The pBAD / HisB-AGMDH1 vector obtained in step 4 was double-digested with SpeI and PstI, and the vector fragment (approximately 4500 bp) was recovered. The SFDH gene fragment recovered in step 5 was ligated with the recovered vector fragment using the Gibson method to produce a ligation product. The ligation product was transformed into Trans1-T1 competent cells and plated on a streptomycin-containing LB plate. The culture was incubated overnight at 37°C. A single colony was selected, and the plasmid was extracted and verified by sequencing. The vector with the correct sequence was designated pMDH1FDH. pMDH1FDH structure description: The recombinant plasmid is obtained by replacing the small fragment between the restriction sites XhoI and SpeI of the pBAD / HisB vector with the DNA fragment shown in SEQ ID No. 4. Furthermore, the small fragment between SpeI and PstI was replaced with the DNA fragment shown in SEQ ID No. 6.

[0132] 8. Construction of recombinant strains M01, M02, M03, and M04

[0133] The expression vector pBAD / HisB-RSM2E constructed in step 2 was transformed into Escherichia coli BW25113 by chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) to obtain the corresponding recombinant engineered strain, which was named M01.

[0134] The expression vector pBAD / HisB-AGMDH1 constructed in step 4 was transformed into Escherichia coli BW25113 by chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) to obtain the corresponding recombinant engineered strain, which was named M02.

[0135] The expression vector pBAD / HisB-SFDH constructed in step 6 was transformed into Escherichia coli BW25113 by chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) to obtain the corresponding recombinant engineered strain, which was named M03.

[0136] The expression vector pMDH1FDH constructed in step 7 was transformed into Escherichia coli BW25113 by chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) to obtain the corresponding recombinant engineered strain, which was named M04.

[0137] Example 2: Obtaining glucose isomerase, NAD(H)-dependent mannose-1-dehydrogenase, and NAD(H)-dependent methyl acid dehydrogenase

[0138] 1. Inoculate the recombinant strains M01 / M02 / M03 / M04 into liquid LB medium containing 50 μg / mL streptomycin and culture overnight at 37°C and 220 rpm.

[0139] 2. After completing step 1, transfer the recombinant strain culture liquid to liquid LB medium containing 50 μg / mL streptomycin at a 1% inoculum volume, and culture at 37°C, 220 rpm, and shake until the OD 600nm =0.6-0.8, add L-arabinose to the culture system to a concentration of 2 g / L, and culture with shaking at 30°C and 200 rpm for 16-18 hours.

[0140] 3. After completing step 2, take an appropriate amount of bacteria, centrifuge at 4°C and 6000 rpm for 15 minutes, and collect the bacterial precipitate.

[0141] 4. Complete step 3, resuspend the bacteria with pH = 7 buffer (50mM phosphate buffer), and ultrasonically disrupt them at 300W (working 3s, rest 5s, 20min), centrifuge at 4°C, 12000rpm for 20min, collect the soluble supernatant expression components, and obtain the crude enzyme solution.

[0142] 5. The soluble supernatant expression components after the above-mentioned disruption were separated and purified by nickel column affinity chromatography to obtain glucose isomerase, NAD(H)-dependent mannose-1-dehydrogenase, and NAD(H)-dependent formate dehydrogenase. The specific operation is as follows: equilibrate the medium with 5 column volumes of equilibration buffer (pH 7.5 20mM Tris-HCl, 40mM imidazole, 500mM NaCl); filter the crude enzyme solution obtained after crushing with a 0.45μm filter; load the sample at a flow rate of 1mL / min; after loading, wash the impurities with 10-20 column volumes of buffer (pH 7.5 20mM Tris-HCl, 100mM imidazole, 500mM NaCl); then elute with 5-10 column volumes of elution buffer (pH 7.5 20mM Tris-HCl, 250mM imidazole, 500mM NaCl) and collect the eluate; dilute the eluate with 50mM pH 87.0 phosphate buffer, concentrate by ultrafiltration (10KDa), repeat 5-10 times to remove imidazole; and determine the concentration of each target protein obtained after ultrafiltration by BCA method.

[0143] Example 3: Using recombinant bacteria M01, M02, and M03 to catalyze the synthesis of D-mannitol from glucose using a multi-enzyme system

[0144] 1. Preparation of crude enzyme solution: According to steps 1-4 of Example 2, crude enzyme solution of relevant enzyme was obtained. 120OD 600nm / mL of crude enzyme solution of recombinant bacteria M01, M02, and M03.

[0145] 2. In the reaction system, the initial concentrations of each component are as follows: glucose 100g / L, sodium formate 500mol / L, NAD + 1mM, pH=7 buffer (50mM phosphate buffer or borate buffer), add 1 / 4 (V 粗酶液 / V 合成体系 ) crude enzyme solutions of recombinant bacteria M01, M02, and M03 (each concentration represents the final concentration of the corresponding component in the system).

[0146] 3. Adjust the pH of the reaction system to 7.0 and control the temperature of the reaction system to 37°C. After 24 hours of reaction, the reaction is completed and the supernatant is collected by centrifugation for testing.

[0147] Example 4: Multi-enzyme catalysis of glucose to D-mannitol using recombinant bacteria M01 and M04

[0148] 1. Preparation of crude enzyme solution: According to steps 1-4 of Example 2, crude enzyme solution of the relevant enzyme was obtained: 120OD 600nm / mL of crude enzyme solution of recombinant bacteria M01 and M04.

[0149] 2. In the reaction system, the initial concentrations of each component are as follows: glucose 100g / L, sodium formate 500mol / L, NAD + 1mM, pH 7 buffer (50mM phosphate buffer or borate buffer), 1 / 4 (V 粗酶液 / V 合成体系 ) Crude enzyme solution of recombinant bacteria M01, 1 / 2 (V 粗酶液 / V 合成体系 ) Crude enzyme solution of recombinant bacteria M04 (each concentration is the final concentration of the corresponding component in the system).

[0150] 3. Adjust the pH of the reaction system to 7.0 and control the temperature of the reaction system to 37°C. After 24 hours of reaction, the reaction is completed and the supernatant is collected by centrifugation for testing.

[0151] Example 5: Determination of related substances in the reaction system using HPLC

[0152] 1. The supernatants obtained in Examples 3 and 4 were subjected to HPLC analysis to determine the D-mannitol concentration in the system and calculate the conversion rate. .

[0153] HPLC system: Agilent 1260; chromatographic column: Aminex HPX-87C (300 mm × 7.8 mm);

[0154] Mobile phase: double-distilled water.

[0155] Flow rate: 0.5 mL / min;

[0156] Temperature: 80℃;

[0157] Detector: RID.

[0158] Figure 1 The liquid chromatography spectra of glucose, D-mannose and D-mannitol standards are shown.

[0159] The results are shown in Table 2. Under the conditions of Example 3, when the initial raw material concentration was 100 g / L, the conversion rate was 93% and the D-mannitol concentration was 93.48 g / L; under the conditions of Example 4, when the initial raw material concentration was 100 g / L, the conversion rate was 95% and the D-mannitol concentration was 95.61 g / L, indicating that this scheme can achieve highly efficient multi-enzyme catalytic synthesis of D-mannitol using D-glucose as raw material.

[0160] Table 2. Multi-enzyme system catalyzing glucose synthesis into D-mannitol

[0161] Enzyme system D-mannitol yield (g / L) D-mannitol conversion rate (%) Example 3 93.48 93 Example 4 95.61 95

[0162] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A group of genetically recombinant Escherichia coli for catalyzing the synthesis of D-mannitol from glucose by a multi-enzyme system, comprising: Escherichia coli a, comprising the insertion or enhanced expression of a gene encoding glucose isomerase M2E; Escherichia coli b, comprising an insertion or enhanced expression of a gene encoding NAD(H)-dependent mannose-1-dehydrogenase MDH1; and Escherichia coli c, comprising the insertion or enhanced expression of a gene encoding NAD(H)-dependent formate dehydrogenase FDH.

2. The Escherichia coli group according to claim 1, wherein Escherichia coli b and Escherichia coli c are the same strain.

3. The Escherichia coli group according to claim 1 or 2, wherein The nucleotide sequence of the gene encoding glucose isomerase M2E is shown in SEQ ID No.

2.

4. The Escherichia coli group according to claim 1 or 2, wherein The nucleotide sequence of the gene encoding NAD(H)-dependent mannose-1-dehydrogenase MDH1 is shown in SEQ ID No.

4.

5. The Escherichia coli group according to claim 1 or 2, wherein The gene encoding NAD(H)-dependent formate dehydrogenase FDH is shown in SEQ ID No.

6.

6. A method for synthesizing D-mannitol from glucose using a multi-enzyme system, comprising: Cultivate the E. coli group according to any one of claims 1 to 5, collect the crude enzyme solution, use glucose as raw material, add sodium formate and NAD + / NADH, synthesizes D-mannitol.

7. A method for synthesizing D-mannitol from glucose using a multi-enzyme system, comprising: Cultivating the Escherichia coli group according to any one of claims 1 to 5, using Escherichia coli whole cells as a catalyst, glucose as a raw material, adding sodium formate and NAD + / NADH, whole cell catalyzes the synthesis of D-mannitol.

8. Use of the Escherichia coli group according to any one of claims 1 to 5 in synthesizing D-mannitol.

Images