Quadruple fluorescent quantitative PCR detection method for PEDV, TGEV, PoRV and PDCoV

Through the quadruple fluorescence quantitative PCR detection method, specific primers and probe sets are used to achieve efficient and accurate detection of PEDV, TGEV, PoRV, and PDCoV, solving the problems of long detection time and low sensitivity in the prior art, and improving detection efficiency and accuracy.

CN120505459APending Publication Date: 2025-08-19SHANXI AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510917496.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-03
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

The existing single RT-PCR technology has been long and labor-intensive in large-scale epidemiological surveys, and the existing detection methods are low in sensitivity, making it difficult to meet the efficient and accurate detection needs of PEDV, TGEV, PoRV, and PDCoV.

Method used

The quadruple fluorescence quantitative PCR detection method of PEDV, TGEV, PoRV and PDCoV is used, and specific primers and probe sets are used, combined with real-time monitoring function, and the virus is detected through quadruple fluorescence quantitative PCR to achieve accurate identification and quantification of the virus.

Benefits of technology

It improves the sensitivity and accuracy of the detection, reduces experimental errors, and can quickly identify extremely low concentrations of viruses, saves detection time, improves detection efficiency, and ensures the reliability and consistency of the detection results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505459A_ABST
    Figure CN120505459A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of pathogenic microorganism detection, and particularly relates to a quadruple fluorescent quantitative PCR detection method for PEDV, TGEV, PoRV and PDCoV. According to the invention, four pairs of specific primers and probes are designed according to the difference of whole genome sequences of PEDV, TGEV, PoRV and PDCoV, and a quadruple fluorescent quantitative PCR detection method is established. The detection method has good specificity, sensitivity and repeatability, can be used for detecting low-micro-content samples such as organs, blood, mouth and nose swabs and environmental samples of animals, and provides a new tool for preventing spreading of PEDV, TGEV, PoRV and PDCoV in swinery.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogenic microorganism detection, and specifically relates to a quadruple fluorescence quantitative PCR detection method for PEDV, TGEV, PoRV and PDCoV. Background Art

[0002] Worldwide, porcine diarrhea viruses severely hamper the health and growth of pig herds, causing immeasurable losses to the pig industry. Currently, the most common porcine diarrhea viruses include porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), and porcine coronavirus (PDCoV). Porcine epidemic diarrhea virus (PEDV) is an animal coronavirus that causes enteric diseases such as porcine epidemic diarrhea. The disease caused by this virus is called porcine epidemic diarrhea, with symptoms including watery diarrhea, vomiting, and dehydration. Pigs of all ages are susceptible to infection. Porcine transmissible gastroenteritis virus (TGEV) is the leading cause of transmissible gastroenteritis in pigs. Infection can cause severe diarrhea and high mortality in piglets, making it a significant threat to the pig industry. Porcine rotavirus (PoRV) is a major pathogen causing digestive system diseases in piglets, causing an acute enteric infection characterized by diarrhea, vomiting, dehydration, and weight loss. Porcine coronavirus (PDCoV) is a newly emerging enteropathogenic porcine coronavirus, with clinical symptoms primarily including acute diarrhea, vomiting, dehydration, and death. To date, the virus has been found in multiple countries, causing significant economic losses to the pig industry. Furthermore, reports have shown that PDCoV can cross species to infect humans, cattle, chickens, mice, and other animals, posing a serious threat to human and other animal health.

[0003] Currently, the identification of the four diarrheal viruses (PEDV, TGEV, PoRV, and PDCoV) is primarily based on single-use RT-PCR. While this technique offers certain specificity and convenience, it is time-consuming and labor-intensive when used in large-scale epidemiological surveys. Furthermore, while the sensitivity of established detection methods has improved compared to previous years, there are still lower limits of detection that need to be explored, necessitating improvements. Summary of the Invention

[0004] In view of this, the object of the present invention is to overcome the shortcomings of the above-mentioned prior art and provide a quadruple fluorescence quantitative PCR detection method for PEDV, TGEV, PoRV and PDCoV.

[0005] To achieve the above object, the technical solution of the present invention is as follows: A quadruple fluorescent quantitative PCR detection primer and probe set for PEDV, TGEV, PoRV, and PDCoV, comprising the following primer and probe sequences: PEDV-F: CACTAACCTGGGTGTCAGAA; PEDV-R: CGTGAAGTAGGAGGTGTGTTA; PEDV-P:ATTTCTCTCAACAGCTTCCCAGCGTAG; TGEV-F:GAAGATGGCGACCAGATAGAA; TGEV-R:GATGGACGAGCATAGGCATT; TGEV-P:CACGTTCACACACAAATACCACTTGCC; PoRV-F: GACAGCGTACTGGATTCGTATT; PoRV-R:ACCCAGCGTTAATCCACATA; PoRV-P: CACAACCGGCGCATGACAACTTAATG; PDCoV-F:ACCACATGGCTCCAATACTC; PDCoV-R: TCCTGTGGCGGATTTCTAAC; PDCoV-P: TAAGCATGGCAAGCTCAAGCTACATG.

[0006] A quadruple fluorescent quantitative PCR detection kit for PEDV, TGEV, PoRV and PDCoV, comprising the primer probe set described above.

[0007] Use of the primer probe set or kit as described above in preparing a product for simultaneously detecting four porcine diarrhea viruses, PEDV, TGEV, PoRV and PDCoV.

[0008] A quadruple fluorescent quantitative PCR detection method for PEDV, TGEV, PoRV, and PDCoV, wherein the detection method is not intended for the diagnosis and treatment of the disease and comprises the following steps: Step 1: Extract viral RNA from the target sample and reverse transcribe it into cDNA; Step 2: Using the obtained cDNA as a template, add the primer probe set described above to perform PCR amplification, and identify and purify the amplified product by gel electrophoresis; Step 3: Take the purified PCR amplification product and clone it into the pMD18-T vector, transform it into competent cells, extract the recombinant plasmid, and sequence it for identification. The recombinant plasmid with the correct sequencing result is used as the positive plasmid standard; Step 4: Perform quadruple fluorescence quantitative PCR detection using the obtained positive plasmid standard as a template.

[0009] Furthermore, in the reaction system of the quadruple fluorescence quantitative PCR detection, the concentration of the primer PEDV-F / R is 0.2 μmol / L, the concentration of the probe PEDV-P is 0.15 μmol / L, the concentration of the primer TGEV-F / R is 0.3 μmol / L, the concentration of the probe TGEV-P is 0.15 μmol / L, the concentration of the primer PoRV-F / R is 0.2 μmol / L, the concentration of the probe PoRV-P is 0.15 μmol / L, the concentration of the primer PDCoV-F / R is 0.2 μmol / L, and the concentration of the probe PDCoV-P is 0.15 μmol / L.

[0010] Furthermore, the annealing temperature of the quadruple fluorescence quantitative PCR detection is 60°C.

[0011] Furthermore, the cycle number of the quadruple fluorescence quantitative PCR detection is 40.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The detection method provided by the present invention successfully established a quadruple fluorescent quantitative PCR for PEDV, TGEV, PoRV, and PDCoV. This method can accurately identify and quantify extremely low concentrations of target viruses, thereby improving the sensitivity of detection and ensuring early detection and timely response to the virus. This method has good specificity. Through specific fluorescent labeling and quantitative PCR technology, it can effectively distinguish different virus types, avoid cross-reactions, and ensure the accuracy of the test results. In addition, the present invention exhibits high stability in multiple repeated experiments, reduces experimental errors, and improves the reliability of detection. The real-time monitoring function allows researchers to instantly understand the amplification status of each PCR reaction cycle, which helps to quickly evaluate the replication dynamics of the virus.

[0013] Compared with traditional detection methods, the present invention can save a lot of time and energy in laboratory testing and improve the efficiency of testing a large number of samples. The established PEDV, TGEV, PoRV, and PDCoV quadruple fluorescence quantitative method was used to test 41 fecal samples from a pig farm suspected of being infected with porcine diarrhea virus in Datong City, Shanxi Province. The test results were consistent with the test results using the national standard and Tianjin landmark method, and the sensitivity was 1000 times higher than that of conventional multiple PCR. There is no need for the traditional PCR detection method to test each virus separately, and only one test is needed to differentiate and diagnose the virus type. The method established by the application of the present invention can quickly and accurately diagnose samples in laboratory testing compared to conventional detection methods. In actual application, it can quickly provide a reliable basis for the formulation of biosafety prevention and control plans for pig farms when porcine diarrhea-related diseases occur. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the standard curve of PEDV quadruple fluorescence quantitative PCR.

[0015] Figure 2 This is the standard curve of PoRV quadruple fluorescence quantitative PCR.

[0016] Figure 3 This is the standard curve of TGEV quadruple fluorescence quantitative PCR.

[0017] Figure 4 This is the standard curve of PDCoV quadruple fluorescence quantitative PCR.

[0018] Figure 5 Figure 5. Specificity test results of quadruple fluorescence quantitative PCR (1-4 are the specific amplification curves of PDCoV, PEDV, PoRV, and TGEV, respectively; 5-8 are the amplification signals of cDNA and DNA of PRRSV, CSFV, PPV, and PCV, respectively; NC is the negative control).

[0019] Figure 6 These are the results of a PEDV quadruple fluorescence quantitative PCR sensitivity experiment.

[0020] Figure 7 These are the results of the TGEV quadruple fluorescence quantitative PCR sensitivity experiment.

[0021] Figure 8 These are the results of the PoRV quadruple fluorescence quantitative PCR sensitivity experiment.

[0022] Figure 9 These are the results of the PDCoV quadruple fluorescence quantitative PCR sensitivity experiment. DETAILED DESCRIPTION

[0023] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0024] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0025] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods. Example 1

[0026] In this example, published literature was searched and the gene sequences of four viruses, PEDV, TGEV, PoRV, and PDCoV, were downloaded from NCBI. The sequences were aligned using MEGA 7.0 and conserved sequences were selected. Four sets of specific primers and probes were designed using Oligo 7. All of them were synthesized by Sangon Biotech Co., Ltd. The sequences are shown in Table 1. They were diluted to 10 μmol / L with ddH2O and stored at -20°C for future use.

[0027] Table 1 Gene primer sequences

[0028] Example 2

[0029] This example uses the primer probe set provided in Example 1 to establish a quadruple fluorescent quantitative PCR detection method for PEDV, TGEV, PoRV, and PDCoV, which specifically includes the following steps: Step 1: Sample preparation. Add enough saline to submerge the fecal swab into the centrifuge tube containing the sample and vortex thoroughly to mix. Add five times the volume of saline to the fecal sample, vortex, and centrifuge at 13,400 rpm. Remove the supernatant and set aside. Add 1 mL of RNase-free ddH2O to the lyophilized vaccine and repeatedly pipette until thoroughly mixed.

[0030] Step 2: Extract viral genomic DNA / RNA. Use a viral genomic DNA / RNA extraction kit and a centrifugal column method to extract genes from vaccine strains and clinical samples. The specific steps are as follows: Add 20 μL of Proteinase K, 200 μL of vaccine supernatant / feces sample (prepared in step 1), and 200 μL of Carrier RNA working solution to a 1.5 mL centrifuge tube.

[0031] After incubation at 56°C for 15 min, the tube was briefly centrifuged, 250 μL of anhydrous ethanol was added, vortexed for 15 s, and then allowed to stand for 5 min.

[0032] After centrifugation, transfer all the liquid in the centrifuge tube to the RNase-Free adsorption column CR2 and centrifuge at 8000 rpm for 1 min, and discard the filtrate in the tube.

[0033] Add 500 μL of buffer GD to the adsorption column, centrifuge at 8000 rpm for 1 min, and discard the filtrate.

[0034] Add 600 μL of rinse solution PW to the adsorption column and let it stand for 2 minutes. Centrifuge at 8000 rpm for 1 minute and discard the filtrate.

[0035] Repeat step (5) once.

[0036] After adding 500 μL of anhydrous ethanol to the adsorption column, centrifuge at 8000 rpm for 1 min, discard the filtrate in the tube and centrifuge at 12000 rpm for 3 min until the adsorption film is completely dry.

[0037] Place an RNase-Free centrifuge tube in the adsorption column, open the lid and leave it at room temperature for 3 minutes until the adsorption film is completely dry.

[0038] Add 20 μL of RNase-Free ddH2O to the center of the adsorption column, cover the lid and let it stand for 5 minutes, then centrifuge at 12,000 rpm for 2 minutes.

[0039] Step 3: Product gel recovery. The PEDV, TGEV, PoRV, and PDCoV viral nucleic acids extracted above are used to recover the product on agarose gel. The specific steps are as follows: (1) The extracted RNA of PEDV, TGEV, and PoRV was reverse transcribed into cDNA. The four nucleic acids were then amplified by PCR using the following procedure: denaturation at 98°C for 10 s, 55°C for 30 s, and final extension at 72°C for 1 min for 30 cycles. The PCR amplification system is shown in Table 2.

[0040] (2) Add the PCR product to 1.5% agarose gel for electrophoresis.

[0041] (3) Under ultraviolet light, cut the target fragments separately and place them in centrifuge tubes. Record the weight of the gel in advance and perform the recovery operation according to the Gel Extraction Kit.

[0042] (4) Add Buffer PG to the gel block at a ratio of 1:1 and place the plate in a 50°C water bath until the gel block is completely dissolved. Add 1 / 2 gel volume of isopropanol to the tube and mix thoroughly (recovery fragment < 300 bp).

[0043] (5) Add 200 μL of Buffrt PS to the adsorption column, centrifuge at 12500 rpm for 1 min, and discard the filtrate.

[0044] (6) Add the liquid from step 1 to the adsorption column, let it sit for 2 minutes, centrifuge at 12500 rpm for 1 minute, and discard the filtrate.

[0045] (7) Add 450 μL of Buffer PW and centrifuge at 12500 rpm for 1 min. Discard the filtrate and repeat this step.

[0046] (8) Centrifuge at 12500 rpm for 1 min to remove as much ethanol as possible from the adsorption column.

[0047] (9) Add 60 μL of Buffer EB to the center of the adsorption membrane and let it stand for 2 minutes. After centrifugation again, the solution in the tube is the purified DNA.

[0048] Table 2 PCR amplification program

[0049] Step 4: Construction of virus-positive plasmid.

[0050] The pM18-T vector was ligated to the purified DNA at 16°C overnight. 100 μL of competent cells dissolved in ice were aliquoted and added to the ligated product. The tube was placed on ice for 30 min, placed in a water bath at 42°C for 45 s, and then transferred to ice for 1 min. LB medium was added to the tube to a final volume of 1 mL. The tube was incubated on a shaker at 37°C, 160 rpm for 1 h, and then evenly spread on LB medium containing resistance (Amp) and incubated at 37°C overnight.

[0051] After scaling up the identified bacterial culture, extract the positive plasmid using the TIANprep Midi Plasmid Kit. First, transfer 5 mL of overnight culture to a 15 mL centrifuge tube and centrifuge at 13,400 rpm for 1 minute, then discard the supernatant.

[0052] Add 500 μL of reagent P1 to the remaining bacterial pellet and shake until the bacterial pellet and solution are thoroughly mixed.

[0053] Add 500 μL of reagent P2 to the 15 mL centrifuge tube, invert it 7 times to mix it, then add reagent P3 and mix it again. After centrifugation at 13400 rpm for 10 min, a white precipitate will appear at the bottom of the 15 mL centrifuge tube.

[0054] Add the supernatant obtained in step 3 to the treated adsorption column CP4, centrifuge at 13400 rpm for 1 min, and discard the filtrate.

[0055] Add 600 μL of washing solution PW to the adsorption column CP4, centrifuge at 13400 rpm for 1 min, and discard the filtrate.

[0056] Repeat step 5 once.

[0057] In order to completely remove the rinsing liquid in the adsorption column, centrifugation at 13400 rpm for 2 min is required.

[0058] Place the adsorption column CP4 in a clean centrifuge tube, add 100 μL of EB, let it stand for 3 minutes, and centrifuge at 13400 rpm for 2 minutes to obtain the plasmid.

[0059] After measuring the concentration, calculate the copy numbers of the four positive plasmids according to the formula below.

[0060]

[0061] Step 5: Optimize the quadruple fluorescent quantitative PCR reaction conditions. The four extracted positive plasmids were used as templates for establishing a quadruple porcine diarrhea virus PCR assay. A 20 μL quadruple fluorescent quantitative PCR reaction system for PEDV, TGEV, PoRV, and PDCoV was established using the Premix Ex Taq™ (Probe qPCR) kit. Optimization of primer concentration, probe concentration, annealing temperature, and cycle number was required. The reaction system was as follows: Premix Ex Taq (Probe qPCR) 12.5 μL, the upstream and downstream primer concentrations were optimized at 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L, 0.35 μmol / L, and 0.4 μmol / L, respectively; the probe concentrations were optimized at 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, 0.25 μmol / L, and 0.3 μmol / L, respectively; the annealing temperatures were optimized at 56°C, 58°C, and 60°C, respectively; the number of cycles was optimized at 35, 40, and 45, respectively; 1 μL of each positive plasmid was added, and clease-free water was added to 20 μL.

[0062] The final reaction system was selected based on low primer and probe addition amounts, low CT values, good fluorescence intensity, and a low number of cycles. The optimized primer and probe concentrations for the quadruple fluorescence quantitative PCR reaction system are shown in Table 3 (PEDV), Table 4 (TGEV), Table 5 (PoRV), and Table 6 (PDCoV). As shown in the tables, the final concentrations of the PEDV primer and probe in the quadruple fluorescence quantitative PCR reaction system were 0.2 μmol / L and 0.15 μmol / L, respectively; the TGEV primer and probe concentrations were 0.3 μmol / L and 0.15 μmol / L, respectively; the PoRV primer and probe concentrations were 0.2 μmol / L and 0.15 μmol / L, respectively; and the PDCoV primer and probe concentrations were 0.2 μmol / L and 0.15 μmol / L, respectively. Based on experimental comparisons, the final annealing temperature was selected as 60°C, and the number of cycles was selected as 40. Based on these results, the final reaction system for the quadruple fluorescence quantitative PCR assay is shown in Table 7, and the reaction procedure is shown in Table 8.

[0063] Table 3 Optimization of PEDV quadruple fluorescence quantitative PCR reaction system

[0064] Table 4 Optimization of TGEV quadruple fluorescence quantitative PCR reaction system

[0065] Table 5 Optimization of PoRV quadruple fluorescence quantitative PCR reaction system

[0066] Table 6 Optimization of PDCoV quadruple fluorescence quantitative PCR reaction system

[0067] Table 7 Final reaction system of quadruple fluorescence quantitative PCR

[0068] Table 8 Final reaction procedure of quadruple fluorescence quantitative PCR

[0069] After the four positive plasmid standards were diluted 10-fold, 10 6 copies / μL-10 3 Copies / μL was used as a template to establish a quadruple fluorescence quantitative standard curve. After quadruple fluorescence quantitative PCR amplification according to the above optimized reaction conditions, the vertical axis was the CT value, the horizontal axis was the logarithm of the copy number concentration, and the standard curve of the quadruple fluorescence quantitative PCR was drawn. The linear equations were (PEDV) Y = -3.595 + 44.649, R2 = 0.997; (PoRV) Y = -3.673 + 45.619, R2 = 0.999; (TGEV) Y = -3.374 + 45.09, R2 = 0.994; (PDCoV) Y = -3.482 + 42.953, R2 = 0.997. Figure 1-4 As shown, the results show that the method has a good linear relationship. Example 3

[0070] This example further evaluates the specificity, sensitivity and repeatability of the detection method established in Example 2.

[0071] Quadruple fluorescent quantitative PCR specificity experiment. Using the cDNA of PEDV, TGEV, PoRV, PDCoV, PRRSV, CSFV, and the DNA of PPV and PCV as templates, and using Nclease-free water instead of cDNA as a negative control, the specificity experiment of PEDV, TGEV, PoRV, and PDCoV was carried out. The results are shown in the figure. Figure 5As shown, PEDV, TGEV, PoRV and PDCoV have amplification curves, while PRRSV, CSFV, PPV and PCV have no amplification curves, indicating that the established method has good specificity.

[0072] Quadruple fluorescence quantitative PCR sensitivity test. The concentrations of the four positive plasmids were measured and converted into copy numbers using the formula. The four positive plasmids were selected and diluted according to a 10-fold dilution ratio. 10 3 copies / μL-10 -2 Copies / μL were used as templates for the sensitivity test of quadruple fluorescence quantitative PCR, and Nclease-free water was used as a negative control to determine the minimum detection limit of the method. Figure 6-9 As shown, the minimum detection limit of PEDV is 10 -1 copies / μL, and the minimum detection limit of TGEV is 10 -2 copies / μL, the minimum detection limit of PoRV is 10 -1 copies / μL, and the minimum detection limit of PDCoV is 10 -1 copies / μL.

[0073] Quadruple fluorescence quantitative PCR reproducibility experiment. Select three concentrations of 10 for each of four positive plasmid standards. 6 copies / μL, 10 5 copies / μL, 10 4 Using the optimized conditions described above as a template for reproducibility experiments, the four plasmids were mixed at the same volume and subjected to both intra-group and inter-group reproducibility experiments. The results are shown in Table 9. The coefficient of variation for the reproducibility experiments of the established quadruple fluorescence quantitative PCR assay for PEDV, TGEV, PoRV, and PDCoV was below 1.5%, demonstrating good reproducibility.

[0074] Table 9 Repeatability of quadruple fluorescence quantitative PCR experiment Example 4

[0075] This example further validates the reliability of the quadruple fluorescence quantitative PCR detection method established in Example 2 using clinical samples. Specifically, the established quadruple fluorescence quantitative PCR method for PEDV, TGEV, PoRV, and PDCoV was tested on 41 fecal samples from a pig farm suspected of being infected with porcine diarrhea virus in Datong City, Shanxi Province. RNA was extracted from the samples using a viral RNA extraction kit and then reverse transcribed into cDNA. The samples were then tested using the currently commonly used clinical national standard quadruple RT-PCR method for TGEV, PEDV, and PoRV, as well as the Tianjin standard porcine delta coronavirus RT-PCR method. The results are shown in Table 10. The established quadruple fluorescence quantitative PCR method was consistent with the national standard and Tianjin standard methods. Nine samples were positive for PEDV, and the rest were negative.

[0076] Table 10 Repeatability of quadruple fluorescence quantitative PCR experiment

[0077] The above description is only for better explanation of the embodiments of the present invention and is not intended to limit the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention are intended to be within the scope of the present invention.

Claims

1. A quadruple fluorescent quantitative PCR detection primer probe set for PEDV, TGEV, PoRV and PDCoV, characterized in that: The primer and probe sequences are as follows: PEDV-F: CACTAACCTGGGTGTCAGAA; PEDV-R: CGTGAAGTAGGAGGTGTGTTA; PEDV-P:ATTTCTCTCAACAGCTTCCCAGCGTAG; TGEV-F:GAAGATGGCGACCAGATAGAA; TGEV-R:GATGGACGAGCATAGGCATT; TGEV-P:CACGTTCACACACAAATACCACTTGCC; PoRV-F: GACAGCGTACTGGATTCGTATT; PoRV-R:ACCCAGCGTTAATCCACATA; PoRV-P: CACAACCGGCGCATGACAACTTAATG; PDCoV-F:ACCACATGGCTCCAATACTC; PDCoV-R: TCCTGTGGCGGATTTCTAAC; PDCoV-P: TAAGCATGGCAAGCTCAAGCTACATG.

2. A quadruple fluorescent quantitative PCR detection kit for PEDV, TGEV, PoRV and PDCoV, characterized in that: Comprising the primer probe set according to claim 1.

3. Use of the primer probe set according to claim 1 or the kit according to claim 2 in the preparation of a product for simultaneously detecting four porcine diarrhea viruses: PEDV, TGEV, PoRV and PDCoV.

4. A quadruple fluorescence quantitative PCR detection method for PEDV, TGEV, PoRV and PDCoV, characterized in that: The detection method is not intended for the diagnosis and treatment of a disease and comprises the following steps: Step 1: Extract viral RNA from the target sample and reverse transcribe it into cDNA; Step 2: using the obtained cDNA as a template and adding the primer probe set of claim 1 to perform PCR amplification, and identifying and purifying the amplified product by gel electrophoresis; Step 3: Take the purified PCR amplification product and clone it into the pMD18-T vector, transform it into competent cells, extract the recombinant plasmid, and sequence it for identification. The recombinant plasmid with the correct sequencing result is used as the positive plasmid standard; Step 4: Perform quadruple fluorescence quantitative PCR detection using the obtained positive plasmid standard as a template.

5. The quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: In the reaction system of the quadruple fluorescence quantitative PCR detection, the concentration of the primers PEDV-F / R is 0.2 μmol / L, the concentration of the probe PEDV-P is 0.15 μmol / L, the concentration of the primers TGEV-F / R is 0.3 μmol / L, the concentration of the probe TGEV-P is 0.15 μmol / L, the concentration of the primers PoRV-F / R is 0.2 μmol / L, the concentration of the probe PoRV-P is 0.15 μmol / L, the concentration of the primers PDCoV-F / R is 0.2 μmol / L, and the concentration of the probe PDCoV-P is 0.15 μmol / L.

6. The quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: The annealing temperature of the quadruple fluorescence quantitative PCR assay was 60°C.

7. The quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: The cycle number of the quadruple fluorescence quantitative PCR detection was 40.