Application of Chi3l1 as target spot in preparation of medicine for preventing or treating secondary brain injury after cerebral hemorrhage

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of Chi3l1 as a target spot in preparation of a medicine for preventing or treating secondary brain injury after cerebral hemorrhage. By integrating space transcriptomics and a mononuclear RNA sequencing technology, the spatial heterogeneity and cell type specificity of gene expression in ICH afterbrain tissue are deeply analyzed, a group of astrocyte subgroups AST1 with neuritis existing around hematoma in the acute stage after cerebral hemorrhage is identified, Chi3l1 is determined as a key inflammatory effect factor of the AST1 subgroups, and the AST1 subgroups with neuritis are used as the key inflammatory effect factor of the AST1 subgroups. And the influence of the gene on the phenotypic transformation of astrocytes and microglial cells is verified. The discovery provides an important theoretical basis for developing a treatment strategy of targeting Chi3l1, and is expected to improve neuroinflammatory response and neurological dysfunction after ICH by regulating and controlling expression of the AST1 subgroup and Chi3l1, and opens up a new direction for treatment of ICH.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of Chi3l1 as a target in the preparation of a drug for preventing or treating secondary brain damage after cerebral hemorrhage. Background Art

[0002] Intracerebral hemorrhage (ICH) is the most devastating type of stroke, accounting for approximately 28% of all new strokes, yet it contributes disproportionately to global stroke-related mortality and disability. Despite recent advances in neurocritical care, the one-month mortality rate for ICH remains close to 40%, and less than one-third of survivors achieve functional independence at six months. Unlike ischemic stroke, for which reperfusion therapy significantly improves patient outcomes, there are currently no specific pharmacological treatments for ICH, highlighting a pressing clinical need in this area.

[0003] The pathophysiology of ICH is not limited to the initial mechanical injury caused by hematoma formation. Secondary brain injury develops gradually within hours to days after the hemorrhage, significantly worsening neurological function and representing a potential therapeutic window. Neuroinflammation is a core driver of this secondary injury cascade, manifested by glial activation, cytokine release, blood-brain barrier disruption, and perilesional edema formation. While microglia have long been considered the primary mediators of neuroinflammation after ICH, increasing evidence suggests that this process involves a complex cellular hierarchy involving multiple glial subtypes. Astrocytes, the most abundant glial cell in the central nervous system, have only recently received greater attention for their role in ICH. Accumulating evidence suggests that astrocytes not only undergo changes in response to injury but also release a variety of proinflammatory cytokines and mediators, which further exacerbate neuroinflammation and lead to secondary brain injury.

[0004] The emergence of spatial transcriptomics and single-cell sequencing technologies has provided us with new tools for in-depth analysis of the complex pathophysiological processes in brain tissue following ICH. Spatial transcriptomics can capture gene expression information at different locations while preserving the spatial structure of brain tissue, revealing the spatiotemporal dynamics of gene expression. Single-cell sequencing technology can deeply analyze the gene expression profiles of individual cells, identifying cell subpopulations and their functional states. By combining these two technologies, we can understand the spatial distribution and gene expression characteristics of different cell types after ICH at the single-cell level, thereby gaining a more comprehensive understanding of the pathological mechanisms of ICH.

[0005] Chi3l1, a chitinase-like protein, has been found to be closely associated with inflammatory responses and tissue damage in various neurodegenerative diseases. However, the exact mechanism of Chi3l1 in neuroinflammation after ICH remains unclear. Summary of the Invention

[0006] In response to the deficiencies of the existing technology, the present invention provides the use of Chi3l1 as a target in the preparation of a drug for preventing or treating secondary brain damage after cerebral hemorrhage. By inhibiting the functional activity of Chi3l1 in astrocytes, the activation of neuroinflammatory astrocytes AST1 is inhibited and the phenotypic transformation of microglia is regulated, thereby effectively alleviating secondary brain damage after cerebral hemorrhage and providing a new treatment strategy for acute brain injury.

[0007] The technical solution provided by the present invention is as follows:

[0008] The present invention provides the use of Chi3l1 as a target in the preparation of a drug for preventing or treating secondary brain damage after cerebral hemorrhage.

[0009] Furthermore, the drug reduces the activation of AST1 astrocytes and promotes the polarization of microglia to M2 type, thereby alleviating neuroinflammatory response and neuronal damage.

[0010] Furthermore, the drug is a drug targeting the Chi3l1 gene or its encoded protein in astrocytes.

[0011] Furthermore, the drug includes a knockdown drug for the Chi3l1 gene or a receptor blocking drug for the Chi3l1 protein.

[0012] Furthermore, the knockdown drug for the Chi3l1 gene includes shRNA targeting the Chi3l1 gene, and the receptor blocking drug for the Chi3l1 protein includes small molecule compounds.

[0013] Furthermore, the dosage form of the drug includes an injection, and the main biologically active ingredients of the injection include a knockdown agent for the Chi3l1 gene in the astrocytes or a receptor blocking agent for the Chi3l1 protein in the AST1 type astrocytes.

[0014] Furthermore, in the knockdown reagent for the Chi3l1 gene in the astrocyte type, the knockdown reagent includes shRNA targeting the Chi3l1 gene and a vector.

[0015] Furthermore, the vector includes any one of an adeno-associated virus vector, an adenovirus vector, a lentivirus vector, and a liposome.

[0016] Furthermore, the receptor blocking agent includes a small molecule compound targeting the Chi3l1 protein, and the small molecule compound is K284-6111 or a pharmaceutically acceptable salt thereof.

[0017] Furthermore, the K284-6111 was administered via stereotactic brain injection at a dose of 0.1 mg / kg.

[0018] Beneficial effects

[0019] By integrating spatial transcriptomics and single-cell nuclear RNA sequencing technologies, this study deeply analyzed the spatial heterogeneity and cell type specificity of gene expression in brain tissue after ICH, and identified a neuroinflammatory astrocyte subpopulation AST1 present around the hematoma in the acute phase after intracerebral hemorrhage. Further studies also identified Chi3l1 as a key inflammatory effector of the AST1 subpopulation and verified its effect on the phenotypic transformation of astrocytes and microglia. These findings provide an important theoretical basis for the development of therapeutic strategies targeting Chi3l1, and are expected to improve neuroinflammatory responses and neurological dysfunction after ICH by regulating the expression of AST1 subpopulations and Chi3l1, opening up new directions for the treatment of ICH.

[0020] The present invention knocks down Chi3l1 expression in astrocytes and demonstrates that it has multiple beneficial effects in significantly improving secondary neurological damage after cerebral hemorrhage. Specifically, it is manifested as: (1) effectively inhibiting the activation of pro-inflammatory AST1 astrocytes and alleviating neuroinflammatory responses; (2) promoting the polarization of microglia to the anti-inflammatory M2 type; and (3) significantly improving spatial cognition and memory dysfunction after cerebral hemorrhage. More importantly, the water maze experiment confirmed that Chi3l1 knockdown can significantly shorten the escape latency and increase the number of platform crossings, indicating that this intervention can effectively promote neurological function recovery. These findings not only reveal the key role of Chi3l1 in the pathological mechanism of cerebral hemorrhage, but also provide important theoretical basis and therapeutic targets for the clinical development of neuroprotective strategies targeting Chi3l1.

[0021] K284-6111, a small molecule inhibitor of Chi3l1, has been used in neurodegenerative diseases, but its potential in acute brain injury has not been fully explored. Perihematoma application of K284-6111 can effectively reduce neuroinflammatory astrocyte activation by inhibiting Chi3l1, regulating the transformation of microglia from M1 to M2, and modulating neuroinflammatory responses, providing a new therapeutic strategy for acute brain injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Spatial transcriptomic analysis identifies expression modules associated with perihematomal inflammation after intracerebral hemorrhage. (A) Schematic diagram: Spatial transcriptome sequencing and non-negative matrix factorization were performed on brain tissue sections from a C57 mouse autologous intracerebral hemorrhage model and a normal control group. (B) Hierarchical clustering heatmap of expression modules within the normal control group. The yellow dashed line represents the dividing line (h = 1.6). All modules within the normal control group were clustered into 14 shared modules. The characters within the color bars above and to the left of the heatmap represent the shared module numbers. (C) Hierarchical clustering heatmap of expression modules within the intracerebral hemorrhage group. The yellow dashed line represents the dividing line (h = 1.3). All modules within the intracerebral hemorrhage group were clustered into 19 shared modules. The color bars above and to the left of the heatmap represent the different shared modules. The characters within the color bars above the heatmap represent the shared module numbers. (D) Pearson correlation coefficient heatmap of shared modules between the intracerebral hemorrhage group and the normal control group. The module colors and numbers correspond to shared modules between the intracerebral hemorrhage group and the normal control group, respectively. Red dots indicate shared expression modules not shared by the other group. (E) Threshold setting plot. Pearson correlation coefficients greater than 0.8 (dashed line) are considered to be shared expression modules between ICH and control groups (yellow). (F) Spatial expression distribution of a representative disease-related shared module in the ICH group and its corresponding HE staining image. The module gene score was calculated by averaging the weighted expression values ​​of the top 20 genes. (G) GSEA functional enrichment of the ICH shared expression module based on weighted genes. Ridge plot of the GO:BP database GSEA enrichment results for shared module 10 in the ICH group.

[0023] Figure 2Integration of spatial transcriptome and single-cell nuclear RNA sequencing analysis revealed that AST1 is a major contributor to the perihematomal neuroinflammatory gene expression module. (A) Schematic diagram of single-cell nuclear RNA sequencing (snRNA-seq). (B) t-SNE dimensionality reduction plots of snRNA-seq in the ICH group and normal control group. (C) Single-cell expression profile heatmap. The horizontal axis color bar represents cell type, consistent with the annotation in Figure B. The horizontal axis is arranged in descending order by cell number, and the vertical axis represents highly variable genes, arranged in the order of cell type on the horizontal axis. (D) t-SNE dimensionality reduction plots of immune cell subsets in the ICH group and control group. (E) t-SNE dimensionality reduction plots of astrocyte subsets in the ICH group and control group. (F) t-SNE dimensionality reduction plots of oligodendrocyte subsets in the ICH group and control group. (G) Single-cell gene scores of the ICH spatial transcriptome expression module. Lighter colors represent higher and lower expression levels, and the size of the circle indicates the expression percentage. Gray vertical lines represent modules of interest. (H) Volcano plot of differentially expressed genes between AST1 subpopulation astrocytes and OL1 subpopulation oligodendrocytes. (I) Pathway enrichment results from GSEA using the GO:BP database using log2FC ranking of genes. Pathways with |NES| > 2 are selected for display. (J) t-SNE plot of astrocyte subpopulations showing the gene scores of the shared expression module in the 10th hemorrhage group. The dotted line indicates the location of the AST1 subpopulation. (K) Calculation of the spatial transcriptome location of AST1 subpopulation cells using the anchor point method.

[0024] Figure 3To confirm the existence of AST1 subpopulations after ICH in mouse models and clinical samples, (A) a heat map shows the highly expressed genes specific to each astrocyte subpopulation (AST1-AST5). (B) a heat map shows the expression levels of known pan-reactive, A1-specific, and A2-specific marker genes in each astrocyte subpopulation. (C) Mapping of Gbp2, a marker gene for the AST1 subpopulation, on astrocyte t-SNE plot. (D) a violin plot shows the expression levels of Gbp2 in each astrocyte subpopulation. (E) Spatial transcriptome mapping of Gbp2 gene expression levels and expression regions. (F) Immunofluorescence image of Gbp2 and S100b co-stained perianal tissue from an acute phase (12 hours) of intracerebral hemorrhage in a mouse. (G) Confocal immunofluorescence image of Gbp2 and S100b co-stained perianal tissue from a human ICH patient and a control patient. (H) Schematic diagram showing the transduction of the taCasp3 gene sequence linked to an astrocyte-specific promoter into the striatum of mice using AAV, achieving specific ablation of striatal astrocytes. (I) Astrocyte density (S100b-positive cells) was counted in the ipsilateral striatum of control and taCasp3 mice 21 days after viral transfection. n = 6, ****P < 0.0001, unpaired t-test. (JL) ELISA results quantifying the levels of inflammatory cytokines TNF-α, IL-1β, and IL-6 in brain tissue of control and taCasp3 mice 3 days after ICH. n = 6, *P < 0.05, **P < 0.01, ***P < 0.001, unpaired t-test. (M) Immunofluorescence images of Iba1 and Cd16 co-staining around the hematoma of control and taCasp3 mice 3 days after ICH. (N) Relative quantitative analysis of the proportion of Cd16-positive microglia around the hematoma in mice in the control and taCasp3 groups on day 3 after ICH. n = 6, ****P < 0.0001, unpaired t-test.

[0025] Figure 4Chi3l1 is a key effector of neuroinflammation in the astrocyte subset AST1 after intracerebral hemorrhage. (A) Volcano plot shows differentially expressed genes between AST1 and other astrocyte subsets. Red dots indicate upregulated genes, blue dots indicate downregulated genes, with darker colors indicating greater fold difference. (B) t-SNE plot of Chi3l1 gene expression mapped across all cell types. (C) Violin plot shows changes in Chi3l1 gene expression in astrocytes from the ICH group and normal control group. (D) Violin plot shows Chi3l1 gene expression levels in various astrocyte subsets. (E) Spatial transcriptome mapping of Chi3l1 gene expression levels and expression regions. (F) Representative Western blots show Chi3l1 protein levels in perihematomal brain tissue at different time points after ICH. (G) Relative quantification of Chi3l1 protein levels in perihematomal brain tissue at different time points after ICH, n = 6, ****P < 0.0001, all ICH groups compared with the sham group, one-way ANOVA. (H) Representative immunofluorescence images of Chi3l1, GFAP, and Gbp2 co-staining in perihematomal brain tissue of mice at different time points after ICH. (I) Immunofluorescence images of Chi3l1 and GFAP co-staining in perihematomal brain tissue of human ICH patients and control patients. (J) Schematic diagram illustrating the experimental workflow for centrifugation and PCR of mouse primary astrocytes 3 days after treatment with PBS or Chi3l1 recombinant protein. The lower fluorescence image shows GFAP staining in primary astrocytes. (K) Statistical results of Gbp2 mRNA levels in primary astrocytes after treatment with PBS or Chi3l1 recombinant protein. n = 3, **P < 0.01, unpaired t-test. (L) Schematic diagram showing the experimental workflow for extracting supernatants from primary mouse microglia 3 days after treatment with PBS or Chi3l1 recombinant protein and performing ELISA analysis. The fluorescent image below shows Iba1 staining of primary microglia. (M) Statistical analysis of changes in inflammatory cytokines TNF-α, IL-1α, C1q, and IL-6 levels in supernatants of primary microglia treated with PBS or Chi3l1 recombinant protein. n = 3, *P < 0.05, **P < 0.01, ****P < 0.0001, unpaired t-test.

[0026] Figure 5Knockdown of Chi3l1 expression in astrocytes inhibits AST1 formation, promotes M2 microglial polarization, and improves neurological dysfunction after intracerebral hemorrhage. (A) Schematic diagram showing the specific knockdown of Chi3l1 expression in striatal astrocytes using AAV. Representative fluorescence images show that after viral transfection, the majority of EGFP-positive cells co-stained with S100b. (B-C) Western blot analysis and quantitative analysis of Chi3l1 protein levels in brain tissue surrounding hematomas of mice in the viral control and Chi3l1 knockdown groups on day 3 after ICH. n = 6, *P < 0.05, ***P < 0.001, unpaired t-test. (D) Immunofluorescence images showing changes in Chi3l1 fluorescence intensity in astrocytes surrounding hematomas in mice in the viral control and Chi3l1 knockdown groups on day 3 after ICH. (EF) Immunofluorescence images and statistical analysis of changes in the number of Gbp2-positive astrocytes around the hematoma in the viral control group and Chi3l1 knockdown group 3 days after ICH in mice. n = 6, ***P < 0.001, unpaired t-test. (GH) Immunofluorescence images and quantitative analysis of changes in the number of Cd206-positive microglia around the hematoma in the viral control group and Chi3l1 knockdown group 3 days after ICH in mice. n = 6, **P < 0.01, ****P < 0.0001, unpaired t-test. (I) Representative locomotion trajectories of viral control and Chi3l1 knockdown mice recorded after ICH, reflecting learning and memory function. (J) Swimming speed of viral control and Chi3l1 knockdown mice analyzed after ICH, n = 12, unpaired t-test. (K) Time to reach the hidden platform in the water maze test was assessed in viral control and Chi3l1 knockdown mice before and on days 16-20 after ICH. n = 12, ****P < 0.0001, Two-Way ANOVA. (L) Quantification of the number of platform quadrant crossings per animal in the water maze memory test for mice in the viral control group and Chi3l1 knockdown group. n = 12, **P < 0.01, ****P < 0.0001, unpaired t-test.

[0027] Figure 6Stereotaxic injection of the Chi3l1 small molecule inhibitor K284-6111 significantly reduces neuroinflammatory responses after intracerebral hemorrhage. (A) Molecular docking and binding site interaction diagram of Chi3l1 and K284-6111. (B, C) Immunofluorescence images of Iba1 co-stained with Cd16 and Cd206, respectively, in the perihematomal area of ​​mice 3 days after injection of K284-6111 or saline into the hematoma area. (D, E) Relative quantitative statistics of the proportion of Cd16-positive and Cd206-positive microglia in the perihematomal area of ​​mice in the K284-6111 and saline groups. n = 6, ****P < 0.0001, unpaired t-test. (F, G) Immunofluorescence images and statistical analysis of changes in the number of Gbp2-positive astrocytes in the perihematomal area of ​​mice in the K284-6111 and saline groups. n = 6, ****P < 0.0001, unpaired t-test. (HI) Representative Nissl-stained images of the perihematoma area and statistical analysis of neuronal loss in mice in the K284-6111 and saline groups. n = 6, ****P < 0.0001, unpaired t-test. (J) Mechanism diagram of the study. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0029] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0030] experimental animals

[0031] All experiments were approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Soochow University and conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All experiments used healthy male C57BL / 6J mice, aged 10–12 weeks and weighing 23–25 g. All mice were housed in a specific pathogen-free facility, maintained at a constant temperature (22–26°C) and humidity (40–70%), with a 12-hour day / night cycle and an ample supply of clean food and drinking water.

[0032] Clinical brain tissue sample collection and processing

[0033] Immunostaining of brain tissue was performed using samples from seven control and eight human brain surgeries with ICH, previously retained at the hospital. This study was approved by the Ethics Review Committee of the First Affiliated Hospital of Soochow University (Suzhou, China), with a waiver of informed consent (Approval No. 2025-313). Sample collection and storage followed standardized protocols in compliance with the 2024 revised Declaration of Helsinki (WMA). All samples were deidentified before analysis to ensure donor privacy. Perihematoma brain tissue was collected from patients undergoing ICH evacuation within 48 hours of onset. Control samples were obtained from patients undergoing brain tumor surgery, with adjacent tissue collected.

[0034] Animal experiments involving different interventions were performed randomly, and experimental operators and observers were unaware of the specific group assignments during the experiments. Sample size was determined using G*Power software (version 3.1.9.6). Detailed statistical methods are described in the corresponding figure legends. Data are presented as mean ± standard deviation (SD). P < 0.05 was considered statistically significant. All statistical analyses were performed using Prism 10.1.2 software.

[0035] Example 1 Screening and analysis of genes significantly associated with secondary brain damage after cerebral hemorrhage

[0036] In this example, an ICH model was established by injecting autologous blood into the striatum of mice. Specifically, after mice were anesthetized with isoflurane gas, 30 μL of blood was drawn from the heart using a microinjection needle. The mice were placed on a thermostatic blanket to maintain a body temperature of 37.0°±0.5°C. The heads were then fixed to a stereotaxic apparatus, with the skull kept horizontal. A 1 mm diameter hole was drilled into the right skull surface (2.5 mm lateral to the midline and 0.5 mm anterior to the bregma) using a dental drill. After securing the syringe and needle, the needle was inserted perpendicularly through the drill hole into the striatum to a depth of 3-3.5 mm. An infusion pump was used to initially inject 5 μL at a rate of 1 μL / min. The injection was then paused for 5 minutes, during which the mouse's vital signs and bleeding were observed. The remaining 25 μL was then injected at the same rate. After the injection was completed, the needle was left in place for 10 minutes to prevent blood reflux before being gently removed. The sham-operated group underwent the same surgical procedure, with an equal volume of sterile saline injected. Finally, bone wax was used to seal the small hole in the skull, and the scalp was sutured after disinfection.

[0037] This example uses the Longa score to evaluate the neurological prognosis of the mouse ICH model. The Longa score is a 5-point neurological deficit scoring system, where 0 points indicate no neurological deficit and normal motor function; 1 point indicates a mild deficit, with the contralateral forelimb unable to fully extend; 2 points indicate a moderate deficit, with the mouse turning in circles to the contralateral side when walking; 3 points indicate a severe deficit, with the mouse falling to the contralateral side when walking; and 4 points indicate an extremely severe deficit, with the mouse unable to walk spontaneously and losing consciousness. The evaluation was performed after the mouse recovered from surgical anesthesia, and mice with a score of 2 or 3 24 hours after cerebral hemorrhage (or before treatment) were included in the study. All evaluations were blinded to reduce observer bias.

[0038] 1. Spatial transcriptomic analysis identifies expression modules related to perihematomal inflammation after intracerebral hemorrhage

[0039] Spatial transcriptome sequencing (sequencing technology provided by Shanghai Ouyi Biomedical Technology Co., Ltd.) was performed on brain tissue 12 hours after ICH (n=2) and normal controls (n=2). Non-negative matrix factorization (NMF) was performed on the expression matrix of each sample (Figure 1A). The results of NMF have excellent biological interpretability. The H matrix corresponds to the spatial location of expression modules, while the W matrix obtains the gene weight order within each expression module, which is suitable for subsequent GSEA enrichment analysis for functional annotation. Pearson correlation coefficients were calculated for modules within different groups to generate a correlation coefficient matrix between ICH and normal groups (Figures 1B,C). Hierarchical clustering was then used to identify shared modules within the groups. Ultimately, this study identified 19 shared modules in the ICH group and 14 shared modules in the normal control group. The correlation coefficient matrix of shared modules between the ICH and normal groups revealed that most shared modules corresponded between the two groups (Figure 1D). A threshold of 0.8 was selected to define module pairs exceeding this threshold as corresponding modules (Figure 1E). By comparing the ICH group and the normal control group using the above method, we can exclude the common modules derived from normal anatomical factors from the common modules of the ICH group, leaving the common expression modules caused by the hematoma event of interest. The spatial location of these common modules shows that the phenotype of common module 10 of ICH is a circumferential hematoma pattern, common module 14 is distributed closer to the periventricular tissue, common module 2 is distributed entirely within the ventricular system, and module 13 is distributed in and around the ventricles, especially the third ventricle (Figure 1F).

[0040] The gene weights represented by expression modules determine the biological events they describe. GSEA enrichment analysis of the four modules of interest revealed that shared module 10 in the ICH group involves inflammation and immune response, shared module 14 in the ICH group involves damage repair and cell migration, and shared modules 2 and 13 in the ICH group both describe activation of the monocyte / macrophage system (Figure 1G). These findings emphasize the key role of neuroinflammatory responses in the acute phase of ICH, with distinct spatial expression modules reflecting the complex interplay of inflammatory and immune processes.

[0041] 2. Integrated spatial transcriptome and single-cell nuclear RNA sequencing analysis revealed that AST1 is the main contributor to the perihematoma neuroinflammatory gene expression module

[0042] To identify the cell types corresponding to the disease modules related to ICH in the spatial transcriptome, this study performed single-cell RNA sequencing (SNS) on unilateral brain tissue (n=3) with a total thickness of approximately 3 mm before and after the stereotactic injection point of ICH and on brain tissue at the corresponding position of the normal control group (n=3). Figure 2 A). After dimensionality reduction, clustering, and annotation using the Seurat package, this study identified major cell types including neurons (Rbfox3+), oligodendrocytes (Mbp+), astrocytes (Aldh1l1+), microglia (Cx3cr1+), and oligodendrocyte precursor cells (Pdgfra+). Figure 2 B, C). Because cerebral hemorrhage is a complex biological process involving inflammatory response and secondary injury, the participation of glial cells deserves more in-depth attention than that of neurons. In order to better match the spatial transcriptome modules with a large amount of anatomical information, this study also divided all glial cells into subpopulations. Among them, microglia can be subdivided into three cell subpopulations: MG1, MG2, and MG3. The MG1 and MG2 subpopulations mainly appear in the cerebral hemorrhage group, while MG3 almost only appears in the normal control group (Figure 2D). Astrocytes are divided into 5 subpopulations, AST1-5, of which AST1-3 mainly appear in the cerebral hemorrhage group (Figure 2E). Oligodendrocytes are divided into 6 subpopulations, OL1-OL6, of which OL1, OL2, and OL3 are mainly reactive oligodendrocytes after cerebral hemorrhage (Figure 2F).

[0043] Next, this study mapped the spatial transcriptome expression module of cerebral hemorrhage to single cells by calculating gene scores, looking for its responsible cell type, and finally obtained a bubble map of gene scores for all common modules of cerebral hemorrhage on all cell types. Among them, module 2 of interest was mainly mapped to monocytes, module 13 was mapped to infiltrating macrophages, and module 14 was mainly mapped to the AST2 subtype of astrocytes. Module 10, which was the focus of this study, was mapped to the AST1 subtype of astrocytes and the OL1 subtype of oligodendrocytes ( Figure 2 G).

[0044] To further distinguish the AST1 and OL1 subpopulations, this study compared differentially expressed genes between the AST1 and OL1 subpopulations (Figure 2H). GSEA enrichment analysis revealed that the AST1 subpopulation was closely related to acute inflammatory activity and amino acid uptake, while OL1 was mainly enriched in oligodendrocytes' own functions such as myelination ( Figure 2I). These results suggest that the primary cells promoting inflammation around the hematoma are the AST1 subpopulation. Next, we mapped the signature gene set of module 10 to astrocytes using gene set scoring and found that it was specifically enriched in the AST1 subpopulation, indicating that AST1 contributes most significantly to the shared module 10 surrounding the hematoma in the ICH spatial transcriptome (Figure 2J). Similarly, in the ICH group spatial transcriptome slice, the AST1 subpopulation was also observed surrounding the hematoma, consistent with the spatial localization of module 10 (Figure 2K).

[0045] 3. Combining mouse models and clinical samples to confirm the existence of AST1 subpopulations after ICH

[0046] To further explore the changes in AST1 gene expression, we analyzed the characteristic genes of each subgroup in detail ( Figure 3 A). The AST1 subpopulation exhibits transcriptional signatures close to those of traditional A1-type astrocytes, with expression of genes such as Igp1 and Gbp2, while AST2 is more similar to A2-type astrocytes, with expression of genes such as Ptx3 and Tgm1. AST3, a subpopulation primarily found in ICH, does not exhibit elevated expression of key pan-reactive marker genes such as Lcn2, but does show relatively upregulated Gfap, suggesting a possible early activation state. AST4 and AST5, present in both ICH and normal controls, can be considered to represent two states inherent to astrocytes under normal conditions. Based on previous literature reports, we mapped the expression of known pan-reactive, A1-specific, and A2-specific marker genes across astrocyte subpopulations. The study found that, overall, AST1 and AST2 share marker genes consistent with A1 and A2 astrocytes (Figure 3B), such as Gbp2 in A1 astrocytes and S100a10 in A2 astrocytes. However, some genes differed significantly. For example, A1 marker genes such as Ggta1 and Fkbp5 were not highly expressed in the AST1 subpopulation in this study. A similar situation was observed for AST2, such as Slc10a6 and Cd14, which were not highly expressed in AST2. This suggests that the AST1 and AST2 subpopulations in ICH may have similar but not identical functions compared to traditional A1 and A2 astrocytes, highlighting the complexity of specific disease models. Nevertheless, it can be assumed that the activating factors required by the AST1 and AST2 subpopulations are consistent with those of the traditionally classified A1 and A2 astrocytes.

[0047] We selected Gbp2, a highly specific gene, as a marker gene for the AST1 subgroup from the subgroup characteristic genes ( Figure 3 C, D). Spatial transcriptome mapping results also showed that Gbp2 expression was significantly increased after intracerebral hemorrhage, and its spatial localization was mainly around the hematoma.

[0048] Frozen section staining of perihematomal brain tissue samples from a mouse ICH model and clinical ICH patients demonstrated the presence of AST1 subpopulations adjacent to the hematoma (Figure 3F,G).

[0049] In traditional research, it is generally believed that neuroinflammation after cerebral hemorrhage is mainly initiated by activated microglia and peripheral infiltrating neutrophils, macrophages and other myeloid cells through the release of various proinflammatory cytokines, but there are few reports on the study of astrocytes in this process.

[0050] To determine the functional role of astrocytes in ICH-induced neuroinflammation, we injected 1.5-2 μL of rAAV-GFaABC1D-taCasp3-TEVp-WPREs (PT-6194, Wuhan Shumi Company) virus or rAAV-GFaABC1D-EGFP-WPREs (PT-1179, Wuhan Shumi Company) control virus into the striatum of mice at a rate of 0.2 μL / min by stereotaxic surgery to achieve specific ablation of astrocytes in this region. Figure 3 H).

[0051] Twenty-one days after viral transfection, brain tissue samples were collected from mice and frozen sections were stained. Immunofluorescence results showed that the density of astrocytes in the ipsilateral striatum of mice in the taCasp3 group was significantly reduced compared with the control group (Figure 3I). Next, we established an ICH model in the virus-infected mice and used ELISA to measure the levels of inflammatory factors TNF-α, IL-1β, and IL-6 in brain tissue on day 3 of ICH. We found that the levels of inflammatory factors in the brains of mice in the taCasp3 group were significantly lower than those in the control group ( Figure 3 J-3L), indicating that astrocyte ablation can reduce the neuroinflammatory response after intracerebral hemorrhage in mice.

[0052] Similarly, immunofluorescence staining of Cd16 (a marker of M1 microglia) and Iba1 (a marker of microglia) around the hematoma on day 3 of ICH showed that the number of M1 microglia in the taCasp3 group of mice was significantly reduced compared with that in the control group (Figure 3M,N).

[0053] These results suggest that astrocytes play a key role in neuroinflammatory damage in the acute phase of ICH and their ablation may provide a potential therapeutic strategy to alleviate this damage. In addition, early ablation of astrocytes can affect the phenotype of microglia.

[0054] 4. Chi3l1 is a key effector of neuroinflammation in the astrocyte subset AST1 after intracerebral hemorrhage

[0055] To identify key effectors of AST1, we performed differential gene expression analysis between the AST1 subpopulation and other astrocyte subpopulations. Among the top 30 most significantly upregulated genes, we identified Chi3l1, a classic inflammatory secretory protein (Figure 4A). Furthermore, mapping Chi3l1 across all cell types revealed its specific expression in astrocytes (Figure 4B). Furthermore, Chi3l1 expression was significantly elevated in astrocytes after ICH, primarily in the AST1 subpopulation (Figures 4C,D). Spatial transcriptome analysis of gene expression revealed that Chi3l1 was significantly enriched in the perihematomal region of ICH (Figure 4E). These findings suggest that Chi3l1 may be an inflammatory effector of AST1.

[0056] To verify changes in Chi3l1 protein levels around the hematoma after ICH, we induced an ICH model in mice and subsequently extracted brain tissue from the hematoma at 1, 3, 7, and 14 days for Western blot analysis of Chi3l1. The results showed that Chi3l1 protein expression in the hematoma increased and then decreased at different time points after ICH. Statistical analysis confirmed that the expression level in the ICH group was significantly higher than that in the sham group, with protein levels reaching a peak on day 7 (Figure 4F,G). Similarly, frozen sections of mice were stained for Chi3l1, Gbp2, and GFAP at 1, 3, and 7 days after ICH. Representative immunofluorescence images showed a progressive increase in the number of Chi3l1-positive astrocytes around the hematoma at 1, 3, and 7 days after ICH, and Chi3l1 was primarily localized in AST1 cells (Figure 4H). Further immunofluorescence analysis of brain tissue samples from clinical ICH patients and control patients also demonstrated the presence of Chi3l1-positive astrocytes around the hematoma after ICH (Figure 4I).

[0057] Immunofluorescence images also showed that the number of Chi3l1-positive astrocytes increased progressively at 1, 3, and 7 days after ICH, and Chi3l1 was mainly located in AST1 cells (Figure 4H). Further immunofluorescence co-localization analysis of perihematomal brain tissue samples from patients with clinical ICH also demonstrated the presence of Chi3l1-positive astrocytes around the hematoma after ICH (Figure 4I).

[0058] Example 2 In vitro experiment

[0059] Primary microglia and astrocytes were derived from the cerebral cortex of newborn C57BL / 6 pups. Purified microglia and astrocytes were seeded into 24-well plates (1 × 10 cells per well). 5 Cells were expressed in 100 cells. The purity of cultured astrocytes and microglia was greater than 95%, as verified by immunostaining for GFAP and Iba1. Astrocytes and microglia were treated with recombinant Chi3l1 protein (100 ng / mL, MCE, HY-P70030) for 24 hours, while the same volume of PBS was added to the control group. For microglia, the supernatant was collected and concentrated by centrifugation. ELISA kits were used to measure the protein levels of TNF-α, IL-1α, C1q, and IL-6. (Serum and plasma were separated, and perihematoma brain tissue homogenates or cell lysates were prepared according to the manufacturer's instructions. Samples of different types were diluted according to the recommended dilution ratios. ELISA kits were used to measure the protein levels of C1q, TNF-α, IL-1α, IL-1β, and IL-6 in the different grouped samples.) Astrocytes were digested with 2.5% trypsin at 37°C for 5 minutes, and the cell pellet was collected by centrifugation to detect the mRNA level of Gbp2 (total RNA was extracted from perihematoma brain tissue or primary astrocytes using TRIzol reagent (15596026CN, Invitrogen, USA), and triple reverse transcription PCR was performed using the SYBR Green method. The transcription level of mouse Actin was used as an internal reference, and the mRNA expression level of the candidate gene was measured using 2 -ΔΔCT The primers for Gbp2 were as follows: the forward primer sequence was GGGGTCACTGTCTGACCACT, and the negative primer sequence was GGGAAACCTGGGATGAGATT; the forward primer sequence for Actin was AAC AGT CCG CCT AGA AGC AC, and the negative primer sequence was CGT TGA CAT CCG TAA AGA CC.

[0060] We found that after 3 days of stimulation of primary astrocytes with Chi3l1 recombinant protein, the mRNA level of Gbp2 in astrocytes was significantly increased compared with the control group (Figure 4J,K).

[0061] In addition, after 3 days of stimulation of primary microglia with Chi3l1 recombinant protein, the levels of inflammatory factors TNF-α, IL-α, C1q, and IL-6 in the cell supernatant were significantly increased compared with the control group (Figure 4L,M).

[0062] These results strongly indicate that Chi3l1 is a key effector of the neuroinflammatory astrocyte subpopulation AST1. The secretion of Chi3l1 can further enhance the activation of AST1 and promote the secretion of proinflammatory factors by microglia, among which TNF-α, IL-α and C1q can further promote the formation of neurotoxic astrocytes.

[0063] Example 3 In vivo experiment

[0064] 1. Knockdown of Chi3l1 expression in astrocytes inhibits the formation of AST1, promotes M2 microglial polarization, and improves neurological dysfunction after intracerebral hemorrhage

[0065] To validate the function of Chi3l1 in astrocytes, we performed targeted transcript knockdown of Chi3l1 by RNA interference (RNAi) in astrocytes in the mouse striatum. Specifically, we injected 1.5-2 μL of rAAA5-GfaABC1D-shRNA (Chi3l1)-EGFP-WPRE (PT-10201, Wuhan Shumi) virus or a control virus expressing random RNA fragments, rAAA5-GfaABC1D-shRNA (Scramble)-EGFP-WPRE (PT-6659, Wuhan Shumi) into the mouse striatum at a rate of 0.2 μL / min via stereotaxic surgery.

[0066] Twenty-one days after viral transfection, we immunostained the striatum of mice in the Chi3l1 knockdown (shCon) and control (shCon) groups. Representative immunofluorescence images showed that the majority of EGFP-positive cells co-stained with S100b, confirming successful viral targeting of astrocytes (Figure 5A). To further validate the Chi3l1 viral knockdown effect, we established an ICH model in mice and performed immunostaining and Western blot analysis of Chi3l1 protein in perihematoma tissue 3 days after ICH. The results showed that Chi3l1 protein levels in perihematoma brain tissue were significantly reduced in the Chi3l1 knockdown group compared with the control group (Figures 5B-5D).

[0067] Next, we further analyzed the effects of Chi3l1 knockdown on the AST1 type. Immunostaining for Gbp2 and GFAP around the hematoma on day 3 of ICH revealed that Chi3l1 knockdown effectively inhibited the formation of AST1 type astrocytes after ICH compared with the control group (Figure 5E,F). Furthermore, immunostaining also observed an increase in Cd206-positive microglia around the hematoma of Chi3l1 knockdown mice on day 3 of ICH, indicating that Chi3l1 knockdown enhanced the anti-inflammatory polarization of microglia (Figure 5G,H).

[0068] The prognosis and quality of life of hemorrhagic stroke survivors are correlated with post-stroke motor recovery. To further investigate the effects of Chi3l1 on long-term neurological recovery after ICH, we used the Morris water maze test to assess spatial cognition and memory in mice from all groups (Figures 5I-5L). Testing was conducted 16 to 21 days after ICH. Spatial learning was assessed by measuring the time required for the mice to find the hidden platform (i.e., escape latency). Before ICH, mice underwent three days of pretraining (three times per day), with the final day of pretraining serving as baseline. From days 16 to 20 after ICH, testing was conducted four times per day for five days. On day 21, the memory phase was performed, with the platform removed and a 60-second exploration test performed. The time the mice spent swimming in the target quadrant (i.e., the area where the platform had been placed) was recorded as an indicator of spatial memory.

[0069] The results showed no significant differences in swimming speed between the groups (Figure 5J). However, in cognitive experiments, we found that the escape latency of mice in the ICH group was significantly prolonged compared with that in the sham group, and knockdown of Chi3l1 partially reversed this change (Figure 5I,K). Furthermore, in a spatial memory test, the number of times each animal crossed the platform's original position was significantly reduced in the ICH group compared with the sham group, indicating that spatial memory function in mice with ICH was severely impaired, while knockdown of Chi3l1 showed a significant improvement in memory function (Figure 5I,L).

[0070] These results indicate that Chi3l1 plays a key role in neuroinflammation after ICH, and its knockdown can inhibit the activation of AST1-type astrocytes on the one hand, and enhance the polarization of anti-inflammatory microglia on the other hand, ultimately improving neurological dysfunction after ICH.

[0071] 2. Stereotactic injection of the Chi3l1 small molecule inhibitor K284-6111 can significantly reduce the neuroinflammatory response after intracerebral hemorrhage

[0072] After confirming the effect of Chi3l1 on the phenotypic transformation of astrocytes and microglia through viral intervention, we further explored the effect of intervention using the small molecule inhibitor of Chi3l1, K284-6111 (HY-12320, MCE). We first used Autodock software to perform molecular docking studies on K284-6111 (CAS No. 702668-62-0) and CHI3L1 (PDB ID: 5XEP). The molecular docking conformation results of the two confirmed the binding of K284-6111 to Chi3l1 ( Figure 6 A).

[0073] Based on this, we administered K284-6111 to mice stereotaxically one day after ICH, using a working concentration of 0.2 mg / ml. Twenty-four hours after ICH, K284-6111 (0.1 mg / kg) was injected into the striatum at a rate of 1 μl / min (the injection site coincided with the spatial coordinates of the ICH autologous blood injection). 0.1 mg / kg was determined to be the optimal dose after testing multiple intracranial doses. This dose did not affect mouse mortality, but a significant therapeutic effect was observed. Mice in all treatment groups were sacrificed three days after ICH, and the injured hemisphere was harvested for liquid chromatography-mass spectrometry analysis, which was then analyzed by the Suzhou Institute of Pharmaceutical Research, Chinese Academy of Sciences.

[0074] Three days after ICH, we found that compared with the saline control group, the number of Cd16-positive microglia around the hematoma in the K284-6111 group was significantly reduced, while the number of Cd206-positive microglia was significantly increased (Figures 6B-6E). Furthermore, statistical analysis of the changes in the number of AST1-type astrocytes around the hematoma showed that K284-6111 significantly inhibited the formation of AST1-type astrocytes around the hematoma (Figures 6F,G).

[0075] Nissl staining was used to assess perihematomal neuronal loss after intracerebral hemorrhage.

[0076] Nissl staining results showed that the neuronal loss in the K284-6111 group was significantly reduced compared with the control group ( Figure 6 In conclusion, we found that K284-6111 application after ICH could significantly alleviate neuroinflammatory responses by regulating the phenotypic transformation of astrocytes and microglia. The reduction in neuronal loss highlights the potential of the Chi3l1 inhibitor K284-6111 as a therapeutic strategy to alleviate secondary brain injury after ICH (Figure 6J).

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Application of Chi3l1 as a target in the preparation of drugs for preventing or treating secondary brain injury after cerebral hemorrhage.

2. The use according to claim 1, characterized in that The drug reduces the activation of AST1 astrocytes and promotes the polarization of microglia to M2 type, thereby alleviating neuroinflammatory response and neuronal damage.

3. The use according to claim 2, characterized in that The drug is a drug targeting the Chi3l1 gene or its encoded protein in astrocytes.

4. The use according to claim 3, characterized in that The drugs include knockdown drugs targeting the Chi3l1 gene or receptor blocking drugs targeting the Chi3l1 protein.

5. The use according to claim 4, characterized in that The knockdown drug for the Chi3l1 gene includes shRNA targeting the Chi3l1 gene, and the receptor blocking drug for the Chi3l1 protein includes small molecule compounds.

6. The use according to claim 5, characterized in that The dosage form of the drug includes an injection, and the main biologically active component of the injection includes a knockdown agent for the Chi3l1 gene in the astrocytes or a receptor blocking agent for the Chi3l1 protein in the AST1 type astrocytes.

7. The use according to claim 6, characterized in that In the knockdown reagent for the Chi3l1 gene in the astrocyte type, the knockdown reagent comprises shRNA targeting the Chi3l1 gene and a vector.

8. The use according to claim 7, characterized in that The vector includes any one of an adeno-associated virus vector, an adenovirus vector, a lentivirus vector, and a liposome.

9. The use according to claim 6, characterized in that The receptor blocking agent includes a small molecule compound targeting the Chi3l1 protein, and the small molecule compound is K284-6111 or a pharmaceutically acceptable salt thereof.

10. The use according to claim 9, characterized in that The K284-6111 was administered via brain stereotactic injection at a dose of 0.1 mg / kg.

Images