Use of trimeric 44 as a target in preparation of a drug for treating non-alcoholic fatty liver

Abstract

The present application relates to the technical field of molecular biology, gene therapy and drug development, and provides application of TRIM44 as a target in preparation of a drug for treating non-alcoholic fatty liver. The drug prevents, relieves and / or treats non-alcoholic fatty liver by inhibiting the expression level of TRIM44. The present application takes TRIM44 as a target, prevents, relieves and treats non-alcoholic fatty liver by reducing the expression level of TRIM44. The TRIM44 inhibitor significantly reduces the liver weight and the proportion of the liver in the body weight of a patient under the condition of high-fat high-sugar and other bad diets, reduces lipid accumulation, reduces the degree of fat deposition and vacuolization of liver tissue, and improves the texture of the liver, thereby preventing, relieving and treating non-alcoholic fatty liver and improving the health status of the patient.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, gene therapy and drug development, and particularly relates to application of TRIM44 as a target in preparation of a drug for treating non-alcoholic fatty liver. BACKGROUND

[0002] Non-alcoholic fatty liver disease (NAFLD) is a metabolic liver disease that is not related to alcohol intake and is mainly characterized by excessive accumulation of fat in the liver. Its core performance is intracellular steatosis, and its onset is closely related to factors such as lipid metabolism disorder, oxidative stress and unhealthy lifestyle (such as high-sugar high-fat diet, sedentary) and the like. Most patients have no obvious symptoms in the early stage, and some may have fatigue and right upper abdominal discomfort. Progress to cirrhosis stage may appear jaundice, ascites and other liver function failure performances. At present, the problems existing in the treatment of non-alcoholic fatty liver disease include: the complex pathogenesis leads to the lack of targeted etiological treatment, there is no approved specific drug, and the existing drugs have limited effect on advanced lesions. Although lifestyle intervention is the basis, the patient compliance is low, the individual response is large, and the effect on advanced disease is limited.

[0003] TRIM44 gene is mainly involved in cell proliferation and survival process, and plays an important role in tumor occurrence. For example, the expression of TRIM44 gene is up-regulated in some tumor cells, which may be related to the invasiveness and drug resistance of tumor cells. However, there is no report on the application of TRIM44 gene in the treatment of non-alcoholic fatty liver. SUMMARY

[0004] In view of the deficiencies of the prior art, the application provides application of TRIM44 as a target in preparation of a drug for treating non-alcoholic fatty liver, which aims to solve the problems mentioned in the background.

[0005] In the first aspect, the application provides application of TRIM44 as a target in preparation of a drug for treating non-alcoholic fatty liver, which prevents, relieves and / or treats non-alcoholic fatty liver by inhibiting the expression level of TRIM44.

[0006] In the second aspect, the application provides application of a TRIM44 inhibitor in preparation of a drug for preventing, relieving and / or treating non-alcoholic fatty liver.

[0007] Further, the TRIM44 inhibitor includes an RNA interference molecule or a compound that inhibits the expression level of TRIM44.

[0008] Further, the expression level of TRIM44 is specifically inhibited mRNA level of TRIM44 gene and / or inhibited protein activity or protein level of TRIM44.

[0009] Further, the RNA interference molecule comprises at least one of siRNA, miRNA, shRNA and dsRNA.

[0010] Further, the sequence of the shRNA is shown in SEQ ID NO. 2.

[0011] Further, the compound comprises protein, polypeptide, enzyme, natural compound, synthetic compound, organic matter or inorganic matter.

[0012] In a third aspect, the present application provides a use of a TRIM44 nucleic acid construct in the preparation of a medicament for preventing, alleviating and / or treating non-alcoholic fatty liver, wherein the nucleic acid construct comprises a polynucleotide for completely or partially knocking out TRIM44 gene.

[0013] Further, the polynucleotide is sgRNA, and the sequence is shown in SEQ ID NO. 1.

[0014] The present application has the following technical effects: TRIM44 as a target, by reducing the expression level of TRIM44, preventing, alleviating and treating non-alcoholic fatty liver. TRIM44 inhibitor makes the patient's liver weight and the proportion of liver in body weight significantly reduced under the condition of high-fat high-cholesterol and other adverse diet, reduces lipid accumulation, reduces the degree of fatty deposition and vacuolization of liver tissue, and improves the texture of liver, thereby preventing, alleviating and treating non-alcoholic fatty liver, and improving the health status of the patient. BRIEF DESCRIPTION OF DRAWINGS

[0015] The exemplary embodiments of the present application can be more completely understood by reference to the following drawings:

[0016] Figure 1 is a detection result map of Western blotting method of Example 1 of the present application, and β-Actin is an internal reference protein, wherein:

[0017] Figure 1 A in is a typical picture of the expression amount of TRIM44 protein;

[0018] Figure 1 B in is the quantitative analysis result of the expression amount of TRIM44 protein, and * represents p<0.05.

[0019] Figure 2 is the oil red O staining result map of Example 1 of the present application.

[0020] Figure 3is a detection result chart of the body weight of each group of mice in the embodiment 2 of the present application.

[0021] Figure 4 is a detection result chart of the liver weight of each group of mice in the embodiment 2 of the present application, # represents p<0.05.

[0022] Figure 5 is a detection result chart of the liver / body weight of each group of mice in the embodiment 2 of the present application, # represents p<0.05, and ns represents no significant difference.

[0023] Figure 6 is a detection result chart of the triglyceride and total cholesterol in the serum of each group of mice in the embodiment 2 of the present application, # represents p<0.05, ## represents p<0.01, and ns represents no significant difference.

[0024] Figure 7 is a result chart of observing the pathological changes of the liver tissue of each group of mice under a microscope after hematoxylin-eosin staining and oil red O staining in the embodiment 2 of the present application.

[0025] Figure 8 is a detection result chart of Western blotting in the embodiment 3 of the present application, and β-Actin is an internal reference protein, wherein:

[0026] Figure 8 A in is a typical picture of the expression amount of TRIM44 protein;

[0027] Figure 8 B in is a quantitative analysis result of the expression amount of TRIM44 protein, and * represents p<0.05.

[0028] Figure 9 is an oil red O staining result chart in the embodiment 3 of the present application. DETAILED DESCRIPTION

[0029] In order to make the technical problems to be solved by the present application, the technical solutions and the beneficial effects more clearly understood, the present application will be further described in detail below in combination with the drawings and the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs; the terms used herein are only for the purpose of describing specific embodiments, and are not used to limit the present application.

[0031] The embodiment of the present application provides an application of TRIM44 as a target in the preparation of a drug for treating non-alcoholic fatty liver; the drug prevents, relieves and / or treats non-alcoholic fatty liver by inhibiting the expression level of TRIM44.

[0032] In some embodiments, the present application provides use of a TRIM44 inhibitor in the preparation of a drug for preventing, alleviating and / or treating non-alcoholic fatty liver.

[0033] In some embodiments, the TRIM44 inhibitor comprises an RNA interference molecule or a compound that inhibits the expression level of TRIM44.

[0034] In some embodiments, the inhibition of the expression level of TRIM44 specifically refers to inhibition of the mRNA level of the TRIM44 gene and / or inhibition of the protein activity or protein level of TRIM44.

[0035] In some embodiments, the RNA interference molecule comprises at least one of siRNA, miRNA, shRNA, and dsRNA.

[0036] In some embodiments, the sequence of the shRNA is shown in SEQ ID NO. 2.

[0037] In some embodiments, the compound comprises a protein, a polypeptide, an enzyme, a natural compound, a synthetic compound, an organic substance, or an inorganic substance.

[0038] In some embodiments, the present application provides use of a TRIM44 nucleic acid construct in the preparation of a drug for preventing, alleviating and / or treating non-alcoholic fatty liver, wherein the nucleic acid construct contains a polynucleotide for completely or partially knocking out the TRIM44 gene.

[0039] In some embodiments, the polynucleotide is sgRNA, and the sequence is shown in SEQ ID NO. 1.

[0040] Experimental materials:

[0041] 1. Cells: The mouse liver parenchymal cell line AML-12 and the human embryonic kidney 293T cell line HEK-293T used are common cell lines in the art. The AML-12 cells were cultured in DMEM / F-12 medium containing 10% FBS, 1% penicillin-streptomycin + 40 ng / mL dexamethasone; the HEK-293T cells were cultured in DMEM high-sugar medium containing 10% FBS, 1% penicillin-streptomycin; both cells were cultured in a 5% CO2 37°C constant-temperature cell special incubator, and the experimental cells were cultured for no more than three months, and mycoplasma detection was performed once every three months, and the cells were frozen using serum-free cell freezing solution.

[0042] 2. Animals and feeding:

[0043] (1) Experimental animal species, gender, age, and source: wild-type C57BL / 6 mice and systemic TRIM44 gene knockout mice, male, 6-8 weeks old, purchased from Jisui Yekang Biotechnology Co., Ltd., the sgRNA sequence of TRIM44 gene is: TCGTCACACGTGCCGTCGGGAGG (SEQ ID NO. 1).

[0044] (2) Experimental animal feed formula: high-fat high-cholesterol feed (purchased from Boaopai, item number D09100310), energy composition ratio: 40 kcal% fat (palm oil), 20 kcal% fructose, and 2% cholesterol; low-fat feed (purchased from Jiangsu Province Synergy Pharmaceutical Biotechnology Co., Ltd., item number XTI01FZ), energy composition ratio: protein 24.2%, fat 12.4%, and carbohydrate 63.4%.

[0045] (3) Animal feeding and environmental conditions: all mice were raised in the SPF level animal room of the Transgenic Animal Center of the Translational Medicine Research Institute of Nanchang University (license number: SYXK (Jiangxi) 2021-0001). The light was turned on for 12 hours alternately, the temperature was 24±2℃, the humidity was 40-70%, and the mice were free to drink water and eat food.

[0046] Example 1: Effect of TRIM44 overexpression on hepatocyte fat accumulation

[0047] (1) A lentiviral expression vector overexpressing TRIM44 was constructed, HEK-293T cells were transfected, lentivirus was packaged, AML-12 cells were infected to construct a stable cell strain overexpressing TRIM44, and the overexpression group was set up. The empty vector was overexpressed as a control group, and Western blotting was used to detect whether the stable cell strain overexpressing TRIM44 was successfully constructed.

[0048] The results of Western blotting detection are shown in Figure 1 The results show that the protein expression level of TRIM44 in the overexpression group is significantly higher than that in the control group, indicating that the AML-12 stable cell strain overexpressing TRIM44 is successfully constructed.

[0049] (2) The AML-12 cells of the control group and the overexpression group were plated, and after the cells adhered, palmitic acid (final concentration 0.4 mM) and oleic acid (0.8 mM) were added for stimulation, respectively, to set up the experimental group and the overexpression experimental group, and a control (the same amount of bovine serum albumin was added) was set up as the control group and the overexpression control group. After 24 hours, each group was subjected to oil red O staining.

[0050] The results of oil red O staining are shown in Figure 2As shown in the results, it is shown that when the AML-12 cells are treated with bovine serum albumin, the AML-12 cells in the control group and the overexpression control group are not obviously colored; and when the mixed palmitic acid and oleic acid is added for stimulation, compared with the control group, the number of AML-12 cells dyed by oil red O and the coloring degree of the AML-12 cells in the experimental group are significantly increased, and compared with the experimental group, the number of AML-12 cells dyed by oil red O and the coloring degree of the AML-12 cells in the overexpression experimental group are increased. This shows that the overexpression of TRIM44 can promote the lipid deposition of hepatocytes caused by the stimulation of palmitic acid and oleic acid.

[0051] Example 2: Effect of TRIM44 gene knockout on obesity and fatty liver

[0052] (1) Select 8-week-old male wild-type C57BL / 6 mice and systemic TRIM44 gene knockout mice, and feed them with two special feeds: high-fat high-cholesterol feed and low-fat feed, that is, obtain low-fat wild-type group, low-fat knockout group, high-fat wild-type group and high-fat knockout group, and record the body weight of mice in each group;

[0053] (2) After 12 weeks of feeding, each group of mice is anesthetized by inhaling isoflurane, and blood is collected from the orbital vein, and serum is separated. The biochemical indicators in the serum are detected by a biochemical analyzer; each group of mice is euthanized, and the liver of the euthanized mice is cut off, washed with phosphate buffer solution, and then excess water is removed. The liver weight of the mice is recorded.

[0054] (3) The liver tissue sections of each group of mice are stained with hematoxylin-eosin (HE) and oil red O, and the pathological changes of the liver tissue of each group of mice are observed under a microscope.

[0055] The detection results of the body weight, liver weight and liver / body weight of each group of mice are shown in Figure 3 , Figure 4 and Figure 5 , and the results show that after the mice are fed with high-fat high-cholesterol feed, the body weight Figure 3 of the mice is significantly higher than that of the low-fat feeding group; and after the mice are fed with high-fat high-cholesterol feed, the body weight of the mice in the high-fat knockout group increases less than that in the high-fat wild-type group, and the liver weight Figure 4 and the liver / body weight Figure 5 are also significantly less than those in the high-fat wild-type group.

[0056] The detection results of triglycerides and total cholesterol in the serum are shown in Figure 6 , and the results show that after the TRIM44 is knocked out, the triglyceride and total cholesterol levels in the serum of the mice fed with high-fat high-cholesterol feed decrease.

[0057] The results of observing the pathological changes of the liver tissue of each group of mice under a microscope after hematoxylin-eosin staining and oil red O staining are shown in Figure 7As shown in the results, under the condition of high-fat high-cholesterol feed, the liver tissue of the high-fat knockout group of mice has less fat deposition and vacuolation, and the liver steatosis of the mice is significantly lower than that of the high-fat wild-type group of mice.

[0058] In summary, the fatty liver lesions of the high-fat knockout group of mice under the condition of high-fat high-cholesterol feed are significantly improved, i.e., TRIM44 gene knockout can treat non-alcoholic fatty liver.

[0059] Example 3: Effect of TRIM44 knockdown on fat accumulation

[0060] The shRNA sequence for knocking down TRIM44 is: GGCTTGATTTGAGTACCTATT (SEQ ID NO. 2).

[0061] (1) Construct a lentiviral expression vector for TRIM44 knockdown, transfect HEK-293T cells, package lentivirus, infect AML-12 cells to construct a stable cell line for knocking down TRIM44, set up as a knockdown group, and transfect an empty vector as a control group. Western blotting was used to detect whether the stable cell line for knocking down TRIM44 was successfully constructed.

[0062] The results of Western blotting detection are shown in Figure 8 The results show that the protein expression level of TRIM44 in the knockdown group is significantly higher than that in the control group, indicating that the AML-12 stable cell line for knocking down TRIM44 is successfully constructed.

[0063] (2) Plate the AML-12 cells of the control group and the knockdown group, and after the cells adhere, add palmitic acid (final concentration 0.4 mM) and oleic acid (0.8 mM) for stimulation, set up as the experimental group and the knockdown experimental group, and set up a control (add the same amount of bovine serum albumin), set up as the control group and the knockdown control group. After 24 h, each group was subjected to oil red O staining.

[0064] The results of oil red O staining are shown in Figure 9 The results show that when bovine serum albumin is used to treat AML-12 cells, the AML-12 cells in the control group and the knockdown control group are not significantly colored; however, after the addition of palmitic acid and oleic acid for stimulation, compared with the control group, the number of AML-12 cells stained by oil red O and the degree of coloring in the experimental group significantly increase, and compared with the experimental group, the number of AML-12 cells stained by oil red O and the degree of coloring in the knockdown experimental group decrease. This indicates that TRIM44 gene knockdown can alleviate the lipid deposition of hepatocytes caused by palmitic acid and oleic acid stimulation.

[0065] According to the experimental results of Embodiment 1-Embodiment 3, it can be concluded that TRIM44 as a target, by reducing the expression level of TRIM44, relieves and treats non-alcoholic fatty liver. The TRIM44 inhibitor makes the patient's liver weight and the proportion of liver in body weight under the condition of high-fat high-cholesterol and other adverse diet significantly reduced, the lipid accumulation is reduced, the degree of fatty deposition and vacuolization of liver tissue is reduced, and the texture of liver is improved, thereby relieving and treating non-alcoholic fatty liver and improving the health status of the patient.

[0066] The above merely describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a TRIM44 inhibitor in the preparation of a drug for preventing, alleviating and / or treating non-alcoholic fatty liver, characterized in that: The TRIM44 inhibitor is an shRNA that inhibits the expression level of TRIM44, and the sequence of the shRNA is shown as SEQ ID NO.

2.

2. Use of a TRIM44 nucleic acid construct in the preparation of a medicament for preventing, alleviating and / or treating non-alcoholic fatty liver, characterized in that: The TRIM44 nucleic acid construct contains an sgRNA for completely knocking out the TRIM44 gene, and the sequence of the sgRNA is shown as SEQ ID NO. 1.

Images