Construction and application of bovine TEX10 gene eukaryotic overexpression vector
By constructing a recombinant overexpression vector of pcDNA3.1-TEX10 and transfecting bovine muscle cells, the research problems of bovine TEX10 gene in regulating muscle growth and development were solved, efficient expression and functional identification of TEX10 gene were achieved, and differentiation and proliferation of muscle cells were promoted.
Patent Information
- Application Number
- CN202510777479.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-08-29
AI Technical Summary
There is a lack of effective methods in the prior art to study the function of the bovine TEX10 gene in regulating muscle growth and development, especially in livestock breeding.
A recombinant overexpression vector of pcDNA3.1-TEX10 was constructed, and the TEX10 gene was inserted into the shuttle plasmid by double-enzyme cleavage, and screened using the prokaryotic ampicillin resistance gene to obtain a plasmid-type overexpression vector, and transfected with bovine muscle cells to achieve efficient expression of the TEX10 gene.
The efficient expression of the bovine TEX10 gene in host cells has been achieved, which promotes the differentiation and proliferation of muscle cells, and provides the basis for studying its functions and regulating muscle growth and development.
Smart Images

Figure CN120555508A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and relates to a eukaryotic overexpression vector pcDNA3.1-TEX10 and a construction method thereof. The overexpression vector can be used in transforming seed cells and identifying the function of bovine TEX10. Background Art
[0002] Gene expression has become a mainstream technique in biology, medicine, and drug development research. Gene overexpression is the "rational reversal" of gene knockout. Gene overexpression ensures the production of more messenger RNA, which in turn increases the production of proteins or downstream products. It can positively regulate a gene's performance, facilitating the study of its function in vivo.
[0003] Numerous plasmid vectors have been developed for gene overexpression. The pcDNA3.1(+ / -) vector is one of the most commonly used mammalian expression vectors. It utilizes the strong CMV promoter to regulate exogenous gene expression. The vector has high copy number and expression levels, is fluorescently labeled, and carries no tags. It also possesses resistance to Amp+ prokaryotic selection and Neo+ eukaryotic selection, allowing stable cell lines to be selected using G418. The pcDNA3.1(+ / -) vector plasmid is 5.4 kb in size and contains a multiple cloning site region with multiple restriction enzyme sites. The target gene can be integrated through double enzyme digestion to construct a recombinant plasmid for target gene expression.
[0004] In molecular biology experiments, two different restriction enzymes are typically used to simultaneously treat the target gene and vector to prevent self-ligation or reverse ligation between the target gene and vector. The double enzyme digestion method utilizes the principle that restriction endonucleases can recognize and cleave specific nucleotides. Two different restriction endonucleases are used to digest the target gene, yielding a target gene fragment with sticky ends at both ends. These fragments are then ligated with a linear vector with the same sticky ends obtained by digesting with the two restriction endonucleases using T4 DNA ligase, thereby achieving gene cloning.
[0005] The TEX10 gene is located on chromosome 14 in the human genome. It encodes a protein called Testis Expressed 10 (TEX10). TEX10 contains multiple domains, including a HEAT repeat domain at the N-terminus, a Coiled-coil domain in the middle, and a C2H2-type zinc finger domain at the C-terminus. These domains enable TEX10 to interact with other proteins, thereby participating in the regulation of important biological processes such as the cell cycle, DNA replication, and DNA repair. TEX10 influences cell proliferation, differentiation, or apoptosis, thereby influencing the integrated regulation of somatic cell growth, reproduction, and immune responses. The TEX gene family is closely associated with cell proliferation and differentiation and includes several members, including TEX1, TEX2, TEX11, and TEX15. These genes play important roles in processes such as cell division, DNA replication, DNA repair, and gene transcription. Recent studies have suggested that the TEX gene family may play a crucial role in the development of certain cancers. For example, TEX15 is overexpressed in certain liver cancers, while TEX11 is overexpressed in certain gastric cancers. Researchers used gene editing technology to delete these genes from cancer cells and found that the proliferation capacity of these cells was significantly reduced, indicating that the TEX gene family may play an important role in the development of certain cancers. In addition, some studies have also shown that the TEX gene family may be related to certain autoimmune diseases. For example, the TEX11 gene is overexpressed in some patients with rheumatoid arthritis, while the TEX101 gene is overexpressed in some patients with systemic lupus erythematosus. These research results suggest that the TEX gene family may become a new target for the treatment of certain diseases. Studies have now confirmed that the growth and fiber composition of mouse skeletal muscle are regulated by the transcription factor TEX10. As an important component of the animal body, skeletal muscle is closely related to the animal's meat production characteristics.
[0006] TEX10 has a wide range of physiological and pathological functions in the human body. TEX10 is associated with methylation of the chtop (chromatin-associated protein) and RIX complexes and is crucial for cell cycle regulation, ribosome biogenesis, and transcriptional regulation. Most importantly, TEX10 is a novel stemness factor that interacts with Sox2 to participate in the establishment and maintenance of pluripotency. TEX10 is enriched at super-enhancer (SE) sites in a Sox2-dependent manner, where it coordinates DNA demethylation and histone acetylation. The embryonic stem cell-associated pluripotency transcription factor (Oct4) is frequently expressed in hepatocytes, and its expression is associated with putative stem cell (CSC) markers and CSC properties. Dysregulated TEX10 expression is also suggested to be closely related to cancer pathogenesis and progression. TEX10 promotes HCC cell proliferation, migration, invasion, and metastasis both in vitro and in vivo. Furthermore, TEX10 has been shown to regulate invasion and epithelial-mesenchymal transition through signal transducer and activator of transcription 3 (STAT3) signaling. These findings suggest that TEX10 functions as an oncogene by upregulating STAT3 activity, thereby indicating that TEX10 may serve as a prognostic biomarker and / or therapeutic target for HCC patients.
[0007] At present, most of the research on the TEX10 gene focuses on disease treatment. Although the TEX10 gene can affect cell proliferation and differentiation, making the TEX10 gene of great significance in livestock breeding, there are few reports in this regard. Summary of the Invention
[0008] The purpose of the present invention is to provide a construction and application of a eukaryotic overexpression vector of the bovine TEX10 gene. By constructing a pcDNA3.1-TEX10 recombinant overexpression vector and transfecting cells, it can be used to study the function of the bovine TEXI0 gene and its role in regulating muscle growth and development.
[0009] To achieve the above objectives, the present invention provides the following technical solution: a plasmid-type overexpression vector, which can express the TEX10 gene in bovine muscle cells.
[0010] Furthermore, the bovine muscle cells are derived from cattle muscle tissue, including bovine muscle cells and their precursor cells, bovine fat cells and their precursor cells.
[0011] Furthermore, the overexpression vector is a positive plasmid containing the bovine TEX10 gene.
[0012] Furthermore, the TEX10 gene was inserted into the shuttle plasmid using a double enzyme digestion method to obtain the overexpression vector, wherein the enzyme digestion sites were Kpn I and BamH I.
[0013] Furthermore, after the TEX10 gene was inserted into the shuttle plasmid using the double enzyme digestion method, it was screened using the prokaryotic ampicillin resistance gene to obtain the overexpression vector.
[0014] Furthermore, the bovine TEX10 gene sequence was obtained by PCR amplification, and the bovine TEX10 gene amplification product obtained by double enzyme digestion and the shuttle plasmid were ligated using DNA ligase to obtain a plasmid-type overexpression vector;
[0015] Preferably, the bovine TEX10 gene coding region sequence is amplified using high-fidelity enzyme PCR, and the distal ends of the upstream and downstream primers of the amplified product have Kpn I and BamH I restriction sites; the amplified product and the shuttle plasmid (for example, pcDNA3.1 vector) are double-digested with Kpn I and BamH I, respectively, and the bovine TEX10 gene coding region sequence obtained by double enzyme digestion and the linearized pcDNA3.1 vector are ligated using DNA ligase. After the ligation product is transformed and plated (resistance screening), a single clone is picked for identification to obtain the recombinant vector pcDNA3.1-TEX10.
[0016] The specific primers for PCR amplification of the coding region of the bovine TEX10 gene are:
[0017] Upstream primer: 5'>GGGGTACCCTGAGGAGCTGCCTGTAGTG<3'
[0018] Downstream primer: 5'>CGGGATCCCTCCGCTCTTCAGTGTTGTG<3'
[0019] The underlined parts of the upstream and downstream primers are the Kpn I and BamH I restriction sites.
[0020] Furthermore, the TEX10 gene is a cloned exogenous or endogenous TEX10 gene; and the shuttle plasmid is selected from pcDNA3.1.
[0021] The present invention also provides use of the above-mentioned plasmid-type overexpression vector in the functional identification of the TEX10 gene.
[0022] Preferably, in the functional identification of the TEX10 gene of Qinchuan cattle, the recombinant vector pcDNA3.1-TEX10 is transfected into isolated bovine myoblasts (for example, bovine primary myoblasts), and the mRNA and protein expression levels of the TEX10 gene in the bovine muscle cells are detected after 12-24 hours; at the same time, the expression of bovine muscle cell proliferation and differentiation marker genes (PCNA, CDK2, CylinD1, MyoD, MyoG, MYHC) after overexpression of the TEX10 gene is detected.
[0023] The present invention also provides the use of the above-mentioned plasmid overexpression vector in cell transformation.
[0024] The present invention also provides the use of the above-mentioned plasmid overexpression vector in regulating muscle growth and development in vivo or in vitro.
[0025] Preferably, the recombinant vector pcDNA3.1-TEX10 is transfected into bovine muscle cells (e.g., bovine primary muscle cells) isolated from individuals of the corresponding cattle breed. After overexpression of the TEX10 gene is detected in the bovine muscle cells, the bovine muscle cells are continued to be cultured. It was found that overexpression of the TEX10 gene can promote the differentiation of muscle cells, thereby accelerating the muscle development process and regeneration.
[0026] Compared with the prior art, the present invention has at least the following beneficial effects:
[0027] The present invention constructs a recombinant vector capable of overexpressing the bovine TEX10 gene. After the vector constructed by the present invention is transfected into homologous or heterologous host cells such as primary cultured bovine muscle cells, efficient expression of TEX10 gene mRNA and TEX10 protein can be obtained in the host cells, laying the foundation for the functional identification of the TEX10 gene and cell transformation, as well as the regulation of muscle metabolism and growth and development.
[0028] Furthermore, the present invention found that pcDNA3.1 is superior to other vector backbones such as pcDNA3 in terms of transfection of host cells, inducing overexpression levels, and marker gene activation capabilities. By selecting enzyme cutting sites, the problem of the hairpin structure generated by the vector backbone affecting the expression efficiency of the inserted gene is solved. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 A is the result of the overexpression efficiency test of pcDNA3.1-TEX10 recombinant plasmid mRNA level;
[0030] Figure 1 B and Figure 1 C is the result of quantitative PCR and western blot analysis of the expression of myoblast differentiation marker genes after transfection with pcDNA3.1-TEX10;
[0031] Figure 1 D is the result of quantitative PCR detection of the expression of myoblast proliferation marker genes after transfection with pcDNA3.1-TEX10;
[0032] Figure 2 A is the result of western blot analysis of the expression of myoblast proliferation marker genes after transfection with pcDNA3.1-TEX10;
[0033] Figure 2 B and Figure 2C shows the results of EdU and CCK-8 detection of pcDNA3.1-TEX10-positive cells transfected. DETAILED DESCRIPTION
[0034] The present invention will be further described in detail below with reference to the accompanying drawings and examples. The examples are only used to explain the present invention but not to limit the scope of protection of the present invention.
[0035] In order to study the function of the bovine TEXI0 gene and its role in regulating muscle growth and development, the present invention designed primers for the coding region of the Qinchuan cattle TEX10 gene, amplified the corresponding bovine TEX10 gene, constructed a pcDNA3.1-TEX10 recombinant overexpression vector, and transfected cells to explore the function of the bovine TEXI0 gene. The specific operations are as follows:
[0036] 1. Construction of plasmid-based recombinant overexpression vector pcDNA3.1-TEX10
[0037] 1. Materials and Methods
[0038] 1.1 Instruments
[0039] Clean bench, biochemical incubator, gene amplifier, PTC-200 single-slot gradient gene amplifier, Heraeus refrigerated high-speed centrifuge (Germany), Bio-Rad gel imaging analyzer (USA), CO2 incubator, HZS-H water bath oscillator (Harbin), Eppendorf pipette, DYY-Ⅲ type constant voltage and constant current electrophoresis apparatus (Beijing Liuyi), DYY-Ⅲ31A and DYY-Ⅲ28D electrophoresis tanks (Beijing Liuyi), ice maker, MDF-382E ultra-low temperature refrigerator (Sanyo, Japan), Eppendorf desktop high-speed centrifuge, Sartorious electronic balance (Germany), conventional refrigerator, etc.
[0040] 1.2 Biochemical reagents and kits
[0041] Long Taq polymerase, PrimeSTAR DNA polymerase, DNA restriction endonucleases (Kpn I, BamH I, etc.), collagen, trypsin, collagenase I, DNA marker, T4 DNA ligase, Trizol, reverse transcription kit, expression vector (pcDNA3.1(+)), plasmid extraction kit, DNA gel recovery kit, fetal bovine serum, etc.
[0042] 1.3 Culture medium
[0043] 1) Resistance screening
[0044] LB medium: tryptone, yeast extract, NaCl, and agar powder; add 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl to 950 mL of deionized water, adjust the pH to 7.0 with 5 mol / L NaOH, and add 15 g of agar powder.
[0045] Resistance: Ampicillin (added at a ratio of 1:100).
[0046] 2) Cell culture
[0047] DMEM complete culture medium.
[0048] 1.4. Common reagents
[0049] Heparin sodium, Tris, EDTA, NaCl, NaOH, anhydrous ethanol, sodium acetate, sodium dodecyl sulfate (SDS), ethidium bromide (EB), bromophenol blue, dimethyl benzocyanine FF, acetic acid, sucrose, deionized formamide, nitric acid, hydrochloric acid, silver nitrate, anhydrous sodium carbonate, sodium thiosulfate, formaldehyde, boric acid, agarose, KCl, Na2HPO4, KH2PO4, Tris-saturated phenol (pH=8.0), chloroform, isoamyl alcohol, glycerol, paraffin oil.
[0050] 2. Synthesis of PCR primers for Qinchuan cattle TEX10 gene
[0051] With reference to the TEX10 gene mRNA sequence published in GenBank (NC_037328.1),
[0052] Primers were designed to amplify the coding region of the TEX10 gene, as shown in SEQ ID NOs: 1 and 2:
[0053] Sequence 1-upstream primer: 5'>GGGGTACCCTGAGGAGCTGCCTGTAGTG<3'
[0054] Sequence 2-downstream primer: 5'>CGGGATCCCTCCGCTCTTCAGTGTTGTG<3'
[0055] The underlined parts of the upstream and downstream primers are the Kpn I and BamH I restriction sites.
[0056] 3. PCR amplification of the TEX10 gene fragment of Qinchuan cattle
[0057] (1) Obtaining cDNA from Qinchuan cattle muscle tissue
[0058] Qinchuan cattle muscle tissue was collected (Shaanxi Qinbao Animal Husbandry Co., Ltd. slaughterhouse, March 2019), RNA was extracted using Trizol method, and PrimeScript was used to analyze the RNA. TMReverse transcription RT kit (Clontech, TaKaRa) was used to synthesize cDNA based on the extracted RNA, as shown in Sequence 3:
[0059]
[0060] (2) The PCR reaction system is 20 μL, see Table 1:
[0061] Table 1 PCR primer amplification system
[0062]
[0063] (3) PCR reaction procedure, see Table 2.
[0064] Table 2 PCR primer amplification program
[0065]
[0066]
[0067] The PCR products were separated by 1.5% agarose gel electrophoresis, and the amplified TEX10 gene fragment was recovered from the gel.
[0068] (4) The enzyme digestion reaction system is shown in Table 3.
[0069] Table 3 Enzyme digestion reaction system
[0070]
[0071] 4. Construction of pcDNA3.1-TEX10 recombinant plasmid carrying the TEX10 gene
[0072] The amplified product and the plasmid vector were double-digested with restriction endonucleases Kpn I and BamH I and ligated overnight at 16°C. The ligation system is shown in Table 4.
[0073] Table 4 TEX10 gene-plasmid connection system
[0074]
[0075] The connected pcDNA3.1 plasmid vector carrying the TEX10 gene sequence was transformed into Escherichia coli DH5α.
[0076] 5. Transform pcDNA3.1-TEX10 into competent cells
[0077] (1) Add 10 μL of the ligation product to 30 μL of competent cells and place on ice for 30 min.
[0078] (2) Add (water bath) at 42°C for 1 min 30 s and immediately place on ice for 5 min;
[0079] (3) Add antibiotic-free culture medium (LB) to make up to 1 mL and culture at 37°C with shaking for 1.5 h;
[0080] (4) Centrifuge at 3000 rpm for 1 min and extract 400 μL of supernatant;
[0081] (5) 150-200 μL of the solution was inoculated and plated on a kanamycin-resistant LB plate;
[0082] (6) Place in a cool place for 30 minutes, then invert and incubate overnight at 37°C for 12-16 hours;
[0083] (7) Pick monoclonal colonies, perform PCR on the bacterial solution, and send it to the company for sequencing to select successfully transformed samples.
[0084] 6. Select the successfully transformed sample to extract the plasmid
[0085] (1) Take 1.5 mL of bacterial culture and centrifuge at 8000 g for 2 min at room temperature to collect the cells. Pour off or aspirate the culture medium.
[0086] (2) Add 250 μL of Buffer P1 to the bacterial pellet and pipette or shake until thoroughly suspended.
[0087] (3) Add 250 μL of Buffer P2 and immediately gently invert the tube 5-10 times to mix thoroughly. Let stand at room temperature for 2-4 minutes.
[0088] (4) Add 350 μL of Buffer P3 and immediately invert gently 5-10 times to mix thoroughly.
[0089] (5) Centrifuge at a speed of ≥12000g for 5-10 minutes. Carefully transfer all the supernatant into the adsorption column and centrifuge at 9000g for 30 seconds. Pour off the liquid in the collection tube and place the adsorption column in the original collection tube.
[0090] (6) Add 500 μL of deproteinized Buffer DW1 to the adsorption column and centrifuge at 9000 g for 30 seconds. Pour off the liquid in the collection tube and return the adsorption column to the original collection tube (to further reduce protein residue).
[0091] (7) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 g for 30 s, discard the liquid in the collection tube, and return the adsorption column to the original collection tube;
[0092] (8) Repeat the previous step;
[0093] (9) Place the adsorption column and collection tube into a centrifuge and centrifuge at 9000 g for 1 min;
[0094] (10) Add 50-100 μL of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1-2 minutes, and centrifuge at 9000 g for 1 minute. Store the resulting plasmid DNA solution at -20°C for later use.
[0095] 2. Application and related testing
[0096] 1. Primary culture of Qinchuan cattle muscle cells
[0097] The fetus was placed in an operating tray and rinsed three times with sterile PBS containing 1% double antibody (penicillin-streptomycin). The epidermal tissue was cut along the fetal spine, and the dorsal muscle was cut out and placed in PBS containing 1% double antibody (6 cm culture dish). The muscle pieces were minced as much as possible with scissors and then collected into a 50 mL centrifuge tube. Collagenase I was added and digested in a 37°C water bath for 1.5 h. The filtrate was filtered through a 200-mesh nylon mesh and collected in a centrifuge tube. The filtrate was centrifuged at 1000 r / min for 10 min. The supernatant was removed and the precipitate was muscle cells. The cells were resuspended in DMEM complete medium containing 15% FBS and 1% double antibody. The cell suspension was inoculated into a 6 cm culture dish at a ratio of 60% by cell counting. After incubation at 37°C, 5% CO2 incubator for 2 h, the upper culture medium was aspirated and continued to be cultured in a new 6 cm culture dish until the cell density reached about 80%-90%. The cells were passaged or frozen for subsequent experiments.
[0098] 2. Transfection of bovine muscle cells with TEX10 recombinant overexpression vector
[0099] When the density of cultured Qinchuan cattle primary muscle cells reached 60%, pcDNA3.1-TEX10 recombinant plasmids encapsulated by liposomes were added (by Lipofectamine TM The cells were transfected with TEX10 (following the instructions of the TEX10 2000 Transfection Reagent kit). Real-time quantitative PCR was used to detect the expression of the TEX10 gene. The expression of muscle cell proliferation marker genes (PCNA, CDK2, CyllnD1) and muscle cell differentiation marker genes (MyoD, MyoG, MYHC) in bovine muscle cells after overexpression of the TEX10 gene was also detected. In addition, Western blot was used to detect the expression of related marker genes.
[0100] 3. EdU assay to detect cell proliferation
[0101] The EdU detection kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd. and the procedure was performed according to the instructions:
[0102] (1) Cell culture and transfection: Primary bovine muscle cells were seeded in 96-well plates, and 100 μL of DMEM complete medium was added to each well (approximately 1×104 cells). When the cell density reached about 70%, the cells were transfected with pcDNA3.1-TEX10 and pcDNA3.1(+) empty vectors, respectively, and cultured for 18-24 h after transfection.
[0103] (2) EdU staining: 100 μL of 50 μmol / L EdU-containing culture medium was added to each well. After incubation for 2 h, the culture medium was removed and the cells were washed three times with PBS, each time for 3-5 min.
[0104] (3) Cell fixation: Add 50 μL of 4% paraformaldehyde solution to each well for fixation, incubate on a decolorizing shaker at room temperature for 30 min, then remove the solution, add 50 μL of glycine solution, incubate at room temperature for 5 min, then discard the solution, and wash the cells 3 times with PBS, each time for 3-5 min.
[0105] (4) Apollo staining: Add 100 μL of Apollo staining reaction solution to each well and incubate on a shaker at room temperature in the dark for 30 min. After discarding, add 100 μL of PBS solution containing 0.5% Triton X-100 and incubate three times, 10 min each time. After discarding, add 100 μL of formaldehyde to each well and wash twice, 5 min each time, and then wash with PBS for 5 min.
[0106] (5) DNA staining: Add 100 μL of 1× Hoechst 33342 reaction solution to each well, incubate on a shaker at room temperature in the dark for 30 min, discard the reaction solution, and wash with PBS three times, 5 min each time.
[0107] (6) EdU imaging: Immediately after staining, images were observed using an inverted fluorescence microscope, and cell number analysis was performed. It was found that after overexpression of TEX10, the number of DNA replication-positive cells increased, indicating that the proliferation rate of bovine primary muscle cells was accelerated compared to the control.
[0108] 4. CCK-8 assay
[0109] (1) Inoculate the cell suspension (100 μL / well) in a 96-well plate. Usually, about 2000 cells are seeded per well for cell proliferation assays. The specific number of cells to be assayed in each well should be determined based on factors such as cell size and proliferation rate.
[0110] (2) Culture and administer 0-10 μL of a specific drug for a period of time (6, 12, 24, or 48 hours) according to experimental requirements;
[0111] (3) Add 10 μL of CCK-8 solution to each well. If the initial culture volume is 200 μL, then add 20 μL of CCK-8 solution (and so on). You can use the cell-free wells to add the corresponding volume of cell culture medium and CCK-8 solution as a control. If you want to understand whether the addition of a specific drug has an effect, you can also add the corresponding volume of cell culture medium, specific drugs, and CCK-8 solution to the cell-free wells as a control.
[0112] (4) Incubate in a cell culture incubator for 1-4 hours. The specific time can be determined by preliminary experiments (microplate reader can be used to detect 0.5, 2, and 4 hours after the preliminary experiment, and then the time point with appropriate absorbance can be selected for the experiment);
[0113] (5) Measure the absorbance at 450 nm using a microplate reader. If a 450 nm filter is not available, a 420-480 nm filter can be used. If the cell suspension is highly turbid, a wavelength greater than 600 nm can be used for measurement.
[0114] (6) If the sample needs to be stored and the OD value is not measured temporarily, 10 μL of 0.1 M HCl solution should be added to each well and stored at room temperature away from light. The absorbance can be maintained for 24 hours.
[0115] 5. Test results
[0116] like Figure 1 As shown in A, the constructed overexpression vector successfully promoted the mRNA expression of TEX10 gene in bovine myoblasts. Figure 1 B and Figure 1 The results of q-PCR and Western-blot in C showed that overexpression of TEX10 gene significantly promoted the expression of differentiation marker genes, including MyhC, although it was not significant, but there was a certain promoting effect. Figure 1 D. Figure 2 The detection results of mRNA and protein levels in A showed that the TEX10 gene plays a promoting role in muscle cell proliferation. Figure 2 B and Figure 2 C shows the results of EdU and CCK-8, which also show that cell proliferation is promoted by overexpression of the TEX10 gene.
Claims
1. A plasmid-type overexpression vector, characterized in that: The overexpression vector can express the TEX10 gene in bovine muscle cells.
2. A plasmid-type overexpression vector according to claim 1, characterized in that: The bovine muscle cells are derived from cattle muscle tissue.
3. A plasmid-type overexpression vector according to claim 1, characterized in that: The overexpression vector is a positive plasmid containing the bovine TEX10 gene.
4. A plasmid-type overexpression vector according to claim 3, characterized in that: The TEX10 gene was inserted into the shuttle plasmid using a double enzyme digestion method to obtain the overexpression vector, wherein the enzyme digestion sites were Kpn I and BamH I.
5. A plasmid-type overexpression vector according to claim 4, characterized in that: After the TEX10 gene is inserted into the shuttle plasmid using the double enzyme digestion method, it is screened using the prokaryotic ampicillin resistance gene to obtain the overexpression vector.
6. A plasmid overexpression vector according to claim 4, characterized in that: The bovine TEX10 gene sequence was obtained by PCR amplification, and the bovine TEX10 gene amplification product obtained by double enzyme digestion and the shuttle plasmid were connected using DNA ligase to obtain a plasmid overexpression vector; The specific primers for PCR amplification of the coding region of the bovine TEX10 gene are: Upstream primer: 5'>GGGGTACCCTGAGGAGCTGCCTGTAGTG<3' Downstream primer: 5'>CGGGATCCCTCCGCTCTTCAGTGTTGTG<3' The underlined parts of the upstream and downstream primers are the Kpn I and BamH I restriction sites.
7. A plasmid overexpression vector according to claim 4, characterized in that: The TEX10 gene is a cloned exogenous or endogenous TEX10 gene; the shuttle plasmid is selected from pcDNA3.
1.
8. Use of the plasmid overexpression vector according to any one of claims 1 to 7 in the functional identification of the TEX10 gene.
9. Use of the plasmid overexpression vector according to any one of claims 1 to 7 in cell transformation.
10. Use of a plasmid overexpression vector according to any one of claims 1 to 7 in regulating muscle growth and development in vivo or in vitro.