Gene gmpt for regulating soybean root nodule symbiotic nitrogen fixation and application thereof

Abstract

The present application relates to a gene GmPMT for regulating soybean root nodule symbiotic nitrogen fixation and application thereof. Specifically, the present application relates to an isolated gene for regulating soybean root nodule symbiotic nitrogen fixation or nodule number, the coding region sequence of the gene is shown as SEQ ID NO:1 or a homologous sequence thereof has one or more substitutions, deletions and / or insertions of nucleotides compared with the sequence shown as SEQ ID NO:1. The present application also provides the use of the gene as described above in breeding soybeans with increased yield or changed nodule number, optionally, the changed nodule number is manifested as increased nodule number, nodule number per root and / or nodule number per unit root length, optionally, the changed nodule number is manifested as decreased nodule number, nodule number per root and / or nodule number per unit root length. The present application has great theoretical and application value for regulating soybean root nodule symbiotic nitrogen fixation or nodule number and its related application research.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology and botany, and particularly relates to a gene GmPMT for regulating soybean root nodule symbiotic nitrogen fixation and application thereof. BACKGROUND

[0002] Nodule is one of the most mysterious evolutionary events, and its process requires high energy input. In the nodule, there is a symbiotic relationship between plants and rhizobia, and plants need to provide carbon sources (such as glucose) to rhizobia in exchange for nitrogen sources produced by nitrogen fixation. Glucose is one of the main energy sources for plants, and through glucose transmembrane transport, plants can transport energy from source leaves (such as leaves) to sink organs (such as roots) to support the energy consumption required for nodule and nitrogen fixation. Therefore, transmembrane transport of glucose is crucial to maintain this symbiotic relationship. PMT genes encode a broad spectrum of polyol and sugar-H+co-transporters, which can effectively transport sugars such as glucose from high-concentration areas to low-concentration areas, which is very critical for energy distribution and utilization. Although the role of PMT genes in other plants has been reported, their specific functions in soybean nodulation have not been reported. Through the study of PMT genes in soybean nodulation, we can not only deeply understand the energy and carbon resource regulation mechanism of the nodule process, explore its potential in improving soybean nitrogen fixation efficiency and stress resistance, but also provide new ideas for genetic improvement of soybean. SUMMARY

[0003] Nodule number has a significant impact on crop yield and quality, mainly through increasing nitrogen supply, promoting root development, enhancing disease resistance and stress tolerance to improve yield, and through improving protein content, mineral content and other ways to improve quality. Although high nodule number can improve nitrogen supply, excessive nodulation may affect plant growth and resource allocation. Therefore, in breeding, it is necessary to balance the relationship between nodule number and plant growth to achieve the best yield and quality. The purpose of the present application is to provide a gene for regulating soybean root nodule symbiotic nitrogen fixation or nodule number and application thereof.

[0004] The inventors used the means of molecular biology and transcriptomics to clone a related gene cluster (also referred to as GmPMTs in this article) that regulates the number of soybean (Glycine max) nodules from the Chinese soybean germline Zhonghuang 13. The location of the GmPMTs encoding gene in the sequenced genome of Gmax_ZH13_V2.0 version is Chr11: 4970318..5003929, which includes GmPMT3, GmPMT4, GmPMT5, GmPMT6, GmPMT7 and GmPMT8. According to the transcriptome data, GmPMT7 and GmPMT8 are expressed at low levels in nodules, while GmPMT3 / 4 / 5 / 6 are specifically expressed in nodules, and GmPMT3 has the highest expression level. The cloning of GmPMT3 provides a theoretical basis and genetic resources for subsequent molecular-assisted breeding and molecular-design breeding.

[0005] In a specific embodiment of the present invention, the cDNA sequence of the GmPMT3 gene is shown as SEQ ID NO: 1. In a specific embodiment of the present invention, the amino acid sequence of the GmPMT3 gene is shown as SEQ ID NO: 2.

[0006] The inventors discovered that when the GmPMT3 protein is expressed via RNAi using a plant expression vector such as Agrobacterium rhizogenes, the resulting plants exhibit significantly fewer nodules than the source strain. This effect was unexpected based on existing technology. Therefore, this application provides an isolated protein associated with soybean rhizobium symbiotic nitrogen fixation and, for the first time, annotates the function of its coding sequence in the soybean genome.

[0007] In the present invention, existing plant expression vectors can be used to construct recombinant vectors containing the target gene. These include binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment. To facilitate identification and screening of transgenic plant cells or plants, the plant expression vectors can be modified, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants and produce color changes, antibiotic resistance markers, or chemical resistance marker genes. For safety reasons, the transgenic plants can be screened directly for transformed plants using stress without the addition of any selectable marker genes. The plant expression vectors can also contain enhancers to increase expression of the inserted nucleotide fragments.

[0008] To achieve the above objectives, the present invention also provides a method for obtaining transgenic hairy roots, which comprises introducing the aforementioned gene or a vector or host cell containing the aforementioned gene into target soybeans to obtain soybean hairy roots showing an altered number of nodules compared to control soybeans.

[0009] To achieve the above object, the application further provides application of the protein or the gene or the vector or the host cell containing the gene in soybean genetic engineering.

[0010] The soybean nodule number related protein and the coding nucleic acid provided by the application are the first discovery of the applicant in the function of regulating soybean nodule number, and the phenotype analysis of the transgenic hairy root and the trans-empty vector hairy root plant verifies that the silencing of the soybean nodule symbiotic nitrogen fixation or nodule number related protein expressed by the application can reduce the nodule number of the soybean transgenic hairy root. The application has great theoretical and application value in regulating the soybean nodule symbiotic nitrogen fixation or nodule number and the related application research.

[0011] Specifically, the application provides the following technical solutions:

[0012] In one aspect, the application provides an isolated gene for regulating soybean nodule symbiotic nitrogen fixation or nodule number, wherein the coding region sequence of the gene is shown as SEQ ID NO: 1 or a homologous sequence having one or more substitutions, deletions and / or insertions of nucleotides compared with the sequence shown as SEQ ID NO: 1.

[0013] In another aspect, the application provides a protein for regulating soybean nodule symbiotic nitrogen fixation or nodule number, wherein the amino acid sequence of the protein is shown as SEQ ID NO: 2 or a homologous sequence having one or more substitutions, deletions and / or insertions of amino acid residues compared with the sequence shown as SEQ ID NO: 2.

[0014] In another aspect, the application provides an expression vector, which comprises the gene as described above or comprises a nucleotide sequence encoding the protein as described above, or comprises a sequence inhibiting the expression of the gene or the protein as described above, for example, an interference sequence of the gene or an interference sequence of the nucleotide sequence encoding the protein.

[0015] In some embodiments, the nucleotide sequence of the interference sequence is shown as SEQ ID NO: 3.

[0016] In some embodiments, the expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and an anti-chemical reagent marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, and the anti-chemical reagent marker is an anti-herbicide marker.

[0017] In another aspect, the application provides a host cell comprising the expression vector as described above.

[0018] In another aspect, the present application provides a method of obtaining a soybean hairy root, comprising transforming a gene or a nucleotide sequence encoding a protein as described above, or a sequence inhibiting the expression of a gene or a protein as described above, or an expression vector or a host cell as described above into a soybean cell or tissue and cultivating a transgenic hairy root, optionally, the nodule number of the transgenic hairy root is changed relative to a hairy root without gene transformation.

[0019] In some embodiments, the vector is a plant expression vector, including a binary Agrobacterium vector and / or a vector that can be used for plant microprojectile bombardment.

[0020] In some embodiments, the host cell is selected from the group consisting of an E. coli cell, an Agrobacterium cell (e.g., a Rhizobium cell) and a plant cell.

[0021] In some embodiments, the Rhizobium cell is selected from the group consisting of K599, AR1193, C58cl, Arqual, MSU440, LBA9402 and R1601.

[0022] In another aspect, the present application provides use of a gene or a nucleotide sequence encoding a protein as described above, or a sequence inhibiting the expression of a gene or a protein as described above, or an expression vector or a host cell as described above in cultivating a soybean with a changed nodule number.

[0023] In some embodiments, the change in nodule number is manifested as an increase in nodule number, nodule number per root and / or nodule number per unit root length.

[0024] In some embodiments, the change in nodule number is manifested as a decrease in nodule number, nodule number per root and / or nodule number per unit root length.

[0025] In another aspect, the present application provides a method of cultivating a transgenic plant with increased yield or a changed nodule number and / or nodule number per unit root length, comprising introducing a gene or a nucleotide sequence encoding a protein as described above, or a sequence inhibiting the expression of a gene or a protein as described above, or an expression vector or a host cell as described above into a target plant cell or tissue to obtain a transgenic plant, wherein the transgenic plant has an increased yield or a changed nodule number relative to the target plant, and the plant is soybean, optionally, the change in nodule number is manifested as an increase in nodule number, nodule number per root and / or nodule number per unit root length, optionally, the change in nodule number is manifested as a decrease in nodule number, nodule number per root and / or nodule number per unit root length.

[0026] Definitions

[0027] CDS sequence: CDS is the portion of a transcript that is actually translated into protein, i.e. the sequence of exons. It represents the sequence in a gene that encodes amino acids and is the direct template for protein synthesis. CDS usually does not include introns, as introns are spliced out during post-transcriptional processing, leaving only the exon sequence that encodes the protein.

[0028] Transcript sequence: A transcript is an RNA molecule produced by the transcription of a gene, including mRNA, tRNA, and rRNA, etc. Transcripts can contain introns and exons, introns are spliced out during post-transcriptional processing, while exons are retained and eventually used to encode proteins.

[0029] Tandem duplication: Tandem duplication mainly occurs in chromosomal recombination regions. The members of the gene family formed by tandem duplication are usually closely arranged on the same chromosome, forming a gene cluster with similar sequences and similar functions.

[0030] Beneficial effects

[0031] There are a total of 9 PMTs in the soybean genome. Homology and evolutionary analysis shows that GmPMT3 / 4 / 5 / 6 / 7 / 8 has undergone a tandem duplication event from soybean. However, GmPMT7 and GmPMT8 have low expression levels in nodulation. The specific expression of GmPMT1 / 3 / 4 / 5 / 6 in nodulation may help to supply energy and affect the development of nodulation (Figures 1A and 1B). To verify this hypothesis, we used RNA interference (RNAi) method to inhibit the expression of GmPMT1 / 3 / 4 / 5 / 6, and found that the GmPMTs RNAi strain showed a significant reduction in the number of nodules compared with the control (Figures 1C-1E). This finding suggests that GmPMTs may play a key role in soybean nodulation development by affecting sugar supply. Figure 1 Figure 1 C-1E). This finding suggests that GmPMTs may play a key role in soybean nodulation development by affecting sugar supply. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 . Functional analysis and verification of root nodule organ-specific expressed genes GmPMTs. Among them:

[0033] A: Expression pattern analysis of GmPMTs. Heat map of GmPMTs expression in nodule tissue and root & nodule tissue. Column chart compares the total expression of root nodule tissue, root & nodule tissue and other tissues. GmPMTs are numbered according to their position on the chromosome.

[0034] ​B: Homology of the genomic region containing GmPMTs on chromosome 11 of soybean genome and its homology between soybean and other four legume plants. Genes are indicated with rectangular arrows and the direction. Homologous genes are indicated with the same color and connected by curves. The connection between GmPMTs is highlighted with pink.

[0035] C: Phenotype of control and GmPMTs RNAi lines in soybean hairy root transformed plants.

[0036] D: Comparison of the number of nodules per root in control and GmPMTs RNAi lines.

[0037] E: Relative expression of GmPMTs in control and GmPMTs RNAi lines. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the present application clearer, further detailed description will be made to the present application with reference to the specific embodiments and the accompanying drawings.

[0039] The following examples are intended to better illustrate the present application but not to limit the present application. In the following examples, the experimental methods are conventional methods or selected according to the product instructions unless otherwise specified. In the following examples, the test materials are commercially available unless otherwise specified. In the following examples, the quantitative tests are set up with at least three repeated experiments, and the results are averaged.

[0040] In the following examples, the soybean hairy root transformation receptor is Zhonghuang 13. Zhonghuang 13 is obtained by sexual hybridization of Yudou 8 as the female parent and Zhongzu 90052-76 as the male parent, and is bred by pedigree method. The growth period of the variety is 100-105 days, the spring sowing period is 125-127 days, the pod setting habit is limited, the flower color is purple, the pubescence is gray, the leaf shape is oval, the effective branch number is 3-5, the hundred-grain mass is 24-26 grams, the grain shape is oval, the grain color is yellow with brown hilum, the protein content is high, the lodging resistance is strong, the disease resistance is strong, the commodity quality is good, and the adaptability is strong. In 2001, it was approved by the National Crop Variety Approval Committee, and the approval number is 2001008. The pDonor221 vector, the pK7GWII RR vector, the Agrobacterium rhizogenes strain K599, and the Bradyrhizobium diazoefficiens strain USDA110 were purchased from the China Plasmid Vector Strain Cell Gene Preservation Center (Biovector Science Lab, Inc).

[0041] The Gateway and recovery kits used for RNAi vector construction were purchased from Thermo and Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0042] Gene names and gene numbers of the present application:

[0043] GmPMT2 SoyZH13_02G054200

[0044] GmPMT9 SoyZH13_16G124800

[0045] GmPMT7 SoyZH13_11G064900

[0046] GmPMT8 SoyZH13_11G065000

[0047] GmPMT3 SoyZH13_11G064402

[0048] GmPMT6 SoyZH13_11G064800

[0049] GmPMT4 SoyZH13_11G064600

[0050] GmPMT1 SoyZH13_01G158000

[0051] GmPMT5 SoyZH13_11G064701

[0052] Example 1 Establishment of GmPMT gene silencing transgenic plants

[0053] On the basis of a large number of sequence analysis and functional verification, a polyol and sugar-H+co-transporter for regulating nodule number was found in soybean variety Zhonghuang 13, which was named GmPMT3, the coding region sequence thereof is shown as SEQ ID NO: 1, and the protein sequence encoded thereby is shown as SEQ ID NO: 2. Since soybean has GmPMT genes, the function of the genes is studied by gene silencing in the present application.

[0054] I. Construction of recombinant plasmid

[0055] 1. The nodule tissue in soybean variety Zhonghuang 13 was separated from the root, and the RNA was extracted and then reverse transcribed to obtain the nodule tissue cDNA of soybean variety Zhonghuang 13.

[0056] 2. The cDNA synthesized in step 1 was used as a template, and a primer pair composed of F1 and R1 was used for PCR amplification to obtain a PCR amplification product (SEQ ID NO: 3).

[0057] F1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTT

[0058] CTAGCCACGGTTGG-3' (SEQ ID NO: 4);

[0059] R1: 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGC

[0060] AAGACCTTGTGC-3' (SEQ ID NO: 5).

[0061] 3, Gel recovery PCR products.

[0062] 4, The PCR products of step 3 and intermediate vector pDonor221 were connected by BP ClonaseTM II enzyme mix (Invitrogen 11789-020) to obtain recombinant plasmid GmPMT3-pDonor221. According to the sequencing results, it was confirmed that the recombinant plasmid GmPMT3-pDonor221 was inserted with a double-stranded DNA molecule as shown in SEQ ID NO: 3 in the pDonor221 vector.

[0063] 5, The plasmid GmPMT3-pDonor221 obtained in step 4 was connected with the final vector pK7GWII RR by LR CLONASEII ENZYME MIX (Invitrogen 11791-020) to obtain the recombinant plasmid GmPMT3-pK7GWII RR. According to the sequencing results, the structure of the recombinant plasmid GmPMT3-pK7GWII RR is described as follows: a double-stranded DNA molecule as shown in SEQ ID NO: 3 is inserted between attR1 and attR2 of the pK7GWII RR vector, that is, the construction of the expression cassette is completed.

[0064] Table 1 Primers for vector construction

[0065]

[0066] II. Obtaining of GmPMT3 gene silenced transgenic hairy roots

[0067] 1, The recombinant plasmid GmPMT3-pK7GWII RR was introduced into Agrobacterium rhizogenes strain K599 to obtain a recombinant Agrobacterium, which was stored at -80°C in glycerol.

[0068] 2, The Agrobacterium rhizogenes obtained in step 1 was used to transform Zhonghuang 13, a receptor plant, by the hairy root transformation method. The specific operation steps are as follows:

[0069] (1) Select soybean seeds of Zhonghuang 13 that are large, full, and free of disease spots.

[0070] (2) The selected seeds are sowed in vermiculite and germinated in a greenhouse for 3 days. When the soybean cotyledon is about to open, the transformation is performed.

[0071] (4) The Agrobacterium rhizogenes K599 containing the target vector is streaked on solid LB medium and cultured in a 28°C incubator for about 2 days. On the day before infection, single colonies are inoculated into 3-5 mL of LB liquid medium containing rifampicin (50 μg / mL), streptomycin (10 μg / mL), and spectinomycin (100 μg / mL) and cultured overnight at 28°C on a shaker.

[0072] (5) When the OD600 of the bacterial solution is about 0.8, the bacteria are collected by centrifugation at 5000 rpm for 6 min. The infection solution (10 mM MES (2-morpholinoethanesulfonic acid) and 10 mM MgCl2) is used to resuspend the bacteria for infection of the soybean hypocotyls.

[0073] (6) The hypocotyls of the seedlings are infected by the puncture injection method. The injection site is the middle of the hypocotyls below the cotyledon. Two drops of injection solution are left on both sides of the stem.

[0074] (7) After the injection is completed, the black tray is filled with water, covered with a transparent cover, and fixed with tape (high-humidity environment for rooting). The transgenic hairy roots are induced on the hypocotyls after 9-14 days of culture at 28°C. The roots are cut and cultured in a disposable plastic cup filled with water.

[0075] (8) The dsRED screening label is observed after excitation of green fluorescence. The positive roots are screened.

[0076] (9) The positive plants are transplanted into pure vermiculite for culture.

[0077] Example 2 Changes in the number of nodules in GmPMT3 gene silencing

[0078] 1. Rhizobium inoculation

[0079] (1) 1 mL of the preserved Bradyrhizobium diazoefficiens strain USDA110 is added to 200 mL of TY liquid medium (tryptone 5 g / L, yeast extract 3 g / L, CaCl2·2H2O 0.7 g / L) containing 50 mg / L spectinomycin and cultured at 28°C on a shaker at 200 rpm for about 4 days until the OD600 is between 0.8 and 1.

[0080] (2) The bacterial solution is collected in a 500 mL centrifuge bottle and centrifuged at 6000 rpm for 10 min. The bacteria are resuspended with sterilized ddH2O to an OD600 of about 0.04 for inoculation.

[0081] (3) Each seedling was inoculated with 50 mL of the resuspended bacterial solution.

[0082] (4) The nodule phenotype was observed 21 days after inoculation.

[0083] 2. Nodule number phenotype statistics and analysis

[0084] The plants 21 days after inoculation were washed with tap water and the water was absorbed with paper. The positive empty vector and GmPMT3-RNAi transformed soybean hairy roots were observed under a green fluorescent light. It was found that the number of nodules of the GmPMT3-RNAi transformed hairy roots was significantly lower than that of the control (empty vector transformed hairy roots) (see Figure 1 C).

[0085] The inventors counted the number of nodules of the GmPMT3-RNAi transformed hairy roots and the empty vector transformed hairy roots, as shown in Figure 1 D. It can be seen from Figure 1 C and Figure 1 D that the average number of nodules per root of the GmPMT3-RNAi transformed hairy roots was only 30% of that of the control (empty vector transformed hairy roots), which indicates that the GmPMT3 gene is involved in the production of soybean nodules.

[0086] 3. Expression amount identification of the gene

[0087] The empty vector transformed hairy roots and the GmPMT3 gene silenced hairy roots were identified as follows:

[0088] (1) The roots and nodules were taken, total RNA was extracted and reverse transcribed into cDNA.

[0089] (2) The cDNA extracted in step (1) was used as a template, and the expression amount of the GmPMT3 gene was identified using primers F and R, and the expression amount of the internal reference gene (Actin gene) was identified.

[0090] The conditions for quantitative PCR amplification were as follows: pre-denaturation at 95°C for 5 min; amplification (45 cycles) at 95°C for 10 s, 59°C for 15 s, and 72°C for 20 s. After the amplification cycle, the melting curve was started: 95°C for 5 s, 65°C for 1 min, and 65-97°C (temperature increased at a rate of 0.11°C / s).

[0091] The expression amount of the GmPMT3 gene in different materials obtained by using each specific primer pair for quantitative PCR amplification with the cDNA as a template is shown in Figure 1 E. It can be seen from Figure 1As can be seen in E, in the gene silencing line GmPMT3-RNAi, the average gene expression of GmPMT3 accounts for only 40% of the control of the empty vector, the average gene expression of GmPMT6 accounts for only 50% of the control of the empty vector, the average gene expression of GmPMT4 accounts for only 30% of the control of the empty vector, the average gene expression of GmPMT1 accounts for only 20% of the control of the empty vector, and the average gene expression of GmPMT5 accounts for only 40% of the control of the empty vector.

[0092] Table 2 Quantitative identification primer

[0093]

[0094] Sequence

[0095] SEQ ID NO: 1 GmPMT3 coding region sequence

[0096]

[0097] SEQ ID NO: 2 Amino acid sequence of GmPMT3

[0098] MAGALLFIKEELQISDLQVGLLAGILNVCALPACMVAGRTSDYLGRRYTIILASVIFLLGSLLMGYGPSYSILIIGRCIVGIGVGFALIIAPVYSAEISSPSYRGFLISLPDVSLNFGLLLGYVSNYFLGKLSLKLGWRTMLVVPAVPSLVLVILMFKLVESPRWLIMQGRVGEARKVLLLVSNTKEEAEKRLKEIKGAAGIDEKCTEDIVHVPKQIRSGAGALKELLCKPSLPVRNILVAAIGVHVFQQVCGIESILLYSPRVFEKTGIMDKSMLLLATVGMGISQAVFTFISAFLLDRVGRRILLLISAGGVVVTLLGLGFCMTMVENSKEKQLWAMGFTIVFTYIFVAFVAIGIGPVTWVYSSEIFPLRLRAQGLAIGVTVNRIANVVVVTSFISIYKKITLGGTFFMYVGITALAWWFYYSLPETKGRSLEDMETIFGKNSKSEIQVKPELWISCMK

[0099] SEQ ID NO: 3 GmPMT3 RNAi fragment

[0100] CTCCTTCTAGCCACGGTTGGTATGGGAATTAGCCAAGCTGTGTTTACATTCATATCTGCTTTCTTGTTGGACAGGGTTGGGAGGAGGATTCTGTTGCTGATTAGTGCAGGTGGTGTGGTTGTGACCCTCTTAGGATTGGGTTTTTGCATGACCATGGTGGAAAACTCCAAAGAAAAACAATTGTGGGCAATGGGTTTTACCATTGTTTTTACCTACATATTTGTAGCTTTTGTGGCTATTGGTATTGGACCTGTGACGTGGGTTTATAGCTCTGAGATTTTTCCCCTCAGGTTGAGAGCACAAGGTCTTGCCATTGG

[0101] SEQ ID NO: 4 Primer Fl

[0102] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0103] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC -3'

[0104] SEQ ID NO: 5 Primer Rl

[0105] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0106] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC -3'

[0107] SEQ ID NO: 6 PMT3-pdonr221-F

[0108] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0109] SEQ ID NO: 7 PMT3-pdonr221-R

[0110] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC -3'

[0111] SEQ ID NO: 8 PMT3-QRT-F

[0112] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0113] SEQ ID NO: 9 PMT3-QRT-R

[0114] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC -3'

[0115] SEQ ID NO: 10 PMTl-QRT-F

[0116] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0117] SEQ ID NO: 11 PMTl-QRT-R

[0118] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCAATGGCAAGACCTTGTGC -3'

[0119] SEQ ID NO: 12 PMT4-QRT-F

[0120] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATCTCCTTCTAGCCACGGTTGG -3'

[0121] SEQ ID NO: 13 PMT4-QRT-R

[0122] ATGAGTGCAAAACCCACGGA

[0123] SEQ ID NO: 14 PMT5-QRT-F

[0124] TGTCACAGGAGTGATGAGTGG

[0125] SEQ ID NO: 15 PMT5-QRT-R

[0126] TGGAAGCGAGAGTGATGGTG

[0127] SEQ ID NO: 16 PMT6-QRT-F

[0128] GCTTTGGCTTGGTGTTTCTACT

[0129] SEQ ID NO: 17 PMT6-QRT-R

[0130] GTGTTGCTCTCTGGCTTCGT

[0131] SEQ ID NO: 18 Actin11-QRT-F

[0132] GAGCTATGAATTGCCTGATGG

[0133] SEQ ID NO: 19 Actin11-QRT-R

[0134] CGTTTCATGAATTCCAGTAGC

[0135] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A method for reducing the number of nodules on soybean plants, characterized in that, The sequence inhibiting the expression of the GmPMT3 protein is introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule number, wherein the GmPMT3 protein sequence is shown as SEQ ID NO:

2.

2. The method of claim 1, wherein, The gene sequence encoding the GmPMT3 protein is shown as SEQ ID NO:

1.

3. A method for reducing the number of nodules on soybean plants, characterized in that, The expression vector containing the sequence inhibiting the expression of the GmPMT3 protein is introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule number, wherein the GmPMT3 protein sequence is shown as SEQ ID NO:

2.

4. The method of claim 3, wherein, The sequence inhibiting the expression of the GmPMT3 protein is an interference sequence.

5. The method of claim 4, wherein, The nucleotide sequence of the interference sequence is shown as SEQ ID NO:

3.

6. The method of claim 3, wherein, The expression vector contains a marker.

7. The method of claim 6, wherein, The marker is selected from a luminescent marker, an antibiotic marker, and an anti-chemical reagent marker.

8. The method of claim 7, wherein, The luminescent marker is selected from a red fluorescent protein and a green fluorescent protein.

9. The method of claim 7, wherein, The antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker, and a tetracycline marker.

10. The method of claim 7, wherein, The anti-chemical reagent marker is an anti-herbicide marker.

11. The method according to any one of claims 3 to 10, characterized in that, The vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

12. A method of reducing the number of nodules on soybean plants, characterized in that, The E. coli cells or Agrobacterium cells containing the expression vector of any one of claims 3 to 11 are introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule number.

13. The method of claim 11, wherein, The Agrobacterium cells are Agrobacterium rhizogenes cells.

14. The method of claim 13, wherein, The Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402, and R1601.

15. Use of a GmPMT3 protein as shown in SEQ ID NO: 2 in a soybean plant having reduced nodule number, characterized in that, The expression of the GmPMT3 protein is inhibited.

Images