Brown planthopper transcription factor CEBP and application thereof
By screening the transcription factor CEBP and using RNAi technology to inhibit the expression of the trehalase gene NlTRE2 of the brown planthopper, the problem of drug resistance of brown planthopper was solved, and its sensitivity to thiazide one drugs was enhanced, and a new low-toxic and efficient prevention and treatment method was provided.
Patent Information
- Application Number
- CN202510672914.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-09-02
AI Technical Summary
The resistance of brown planthoppers to chemical insecticides has evolved, resulting in difficulties in prevention and control, and it is difficult for the existing technology to effectively control their resistance.
By screening out the transcription factor CEBP, the RNAi technology was used to inhibit the expression of the trehalase gene NlTRE2 of the brown planthopper, and its sensitivity to thiazide one drugs was enhanced.
It significantly reduced the expression of the trehalase gene NlTRE2 of brown planthopper, enhanced the sensitivity of brown planthopper to thiazide monas, and provided a new low-toxic and efficient anti-brown planthopper control method.
Smart Images
Figure CN120574864A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of insect gene technology, and specifically, the present invention relates to the brown planthopper transcription factor CEBP and its application Background Art
[0002] The brown planthopper (NLP) is a monophagous pest that damages rice plants by sucking and laying eggs. Its excrement can also adversely affect rice photosynthesis. Furthermore, it can act as a vector for rice viruses, causing severe yield declines and posing a significant threat to rice production. Chemical pesticides are the primary means of suppressing NLP. However, long-term use has led to the evolution of resistance, making their control challenging.
[0003] Membrane-bound trehalase is an important enzyme that plays a key role in insect physiological processes. It is primarily responsible for catalyzing the conversion of trehalose to glucose, a process crucial for insect development, chitin synthesis, flight metabolism, and other physiological activities. Studies on the membrane-bound trehalase gene of the brown planthopper (Bryophyllum lugens) have shown that interference with this gene significantly impairs the molting, metamorphosis, and survival of the brown planthopper, indicating that membrane-bound trehalase plays a crucial role in insect growth and development.
[0004] The transcription factor CEBP belongs to the CCAAT enhancer binding protein (C / EBP) transcription factor family and is an important transcriptional regulatory factor. It mainly participates in important life activities such as cell proliferation and differentiation, tumorigenesis and apoptosis, cell cycle regulation, glucose metabolism and lipid metabolism by regulating the transcription of target cell genes.
[0005] RNA interference (RNAi) is a highly conserved phenomenon in evolution, in which double-stranded RNA (dsRNA) induces the efficient and specific degradation of homologous mRNA. It is a powerful tool for studying gene function and also holds great potential for pest control. Given the evolving pesticide resistance of brown planthoppers (NLP), and the specificity and non-target biosafety of RNAi technology for pest control, identifying key targets for NLP control and applying RNAi technology for its control is of great significance in its application. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to control the insecticide resistance of the rice pest brown planthopper. To address this technical problem, the present invention discovered a transcription factor, CEBP, through extensive screening, that can promote the expression of the trehalase gene promoter. By inhibiting CEBP through RNAi, the present invention downregulated the expression of the brown planthopper's trehalase gene, thereby enhancing the brown planthopper's sensitivity to thiazolinone drugs.
[0007] In one aspect of the present invention, the present invention discloses a transcription factor of the brown planthopper trehalase gene NlTRE2, wherein the transcription factor is CEBP, and the nucleotide sequence thereof is shown in SEQ ID NO.20.
[0008] In one aspect, the present invention discloses the use of the transcription factor CEBP of the brown planthopper trehalase gene NlTRE2, described herein, in the preparation of a reagent for regulating the expression of the brown planthopper trehalase gene NlTRE2. The reagent can enhance or inhibit the expression of NlTRE2. In one embodiment, the reagent enhances the expression of NlTRE2 by enhancing CEBP; preferably, in one embodiment, the reagent inhibits CEBP and thereby inhibits the expression of NlTRE2.
[0009] In one aspect of the present invention, the present invention discloses the use of the transcription factor CE BP of the brown planthopper trehalase gene NlTRE2 in anti-brown planthopper. The nucleotide sequence of the transcription factor CEBP is shown in SEQ ID NO.20. By inhibiting the transcription factor, the expression of the NlTRE2 gene is reduced, and the sensitivity of the brown planthopper to thiazolinone drugs is enhanced.
[0010] In a preferred embodiment, the inhibition is performed by RNAi, that is, CEBP is inhibited by RNAi, thereby reducing the expression of the NlTRE2 gene and enhancing the sensitivity of the brown planthopper to thiazolinone drugs.
[0011] In one aspect, the present invention discloses an agent for inhibiting the expression of the brown planthopper trehalase gene N1TRE2, wherein the agent is an RNAi agent transcribed using the transcription factor CEBP as a template, the sequence of the transcription factor CEBP being shown in SEQ ID NO. 20. Preferably, in one embodiment, the RNAi sequence is shown in SEQ ID NO. 21.
[0012] In one aspect, the present invention discloses an agent for enhancing the sensitivity of brown planthoppers to thiazolinone drugs, wherein the agent is an RNAi agent transcribed using the transcription factor CEBP as a template, wherein the sequence of the transcription factor CEBP is shown in SEQ ID NO. 20. Preferably, in one embodiment, the RNAi sequence is shown in SEQ ID NO. 21.
[0013] In one aspect of the present invention, a method for treating brown planthopper with dsRNA is disclosed, the method comprising the following steps:
[0014] S1. Cloning of the brown planthopper transcription factor CEBP from the brown planthopper;
[0015] S2, design primers for the transcription factor gene CEBP of the brown planthopper trehalase gene and synthesize dsRNA;
[0016] S3. Introduce dsRNA into brown planthopper to perform RNAi on the transcription factor CEBP of the brown planthopper's trehalase gene.
[0017] The present invention cloned the promoter sequence upstream of the NlTRE2 gene fragment of the brown planthopper membrane-bound trehalase gene from the brown planthopper, predicted and verified that the transcription factor CEBP can promote the expression of the trehalase gene promoter, and used RNAi interference to prove that CEBP causes the low expression of the trehalase gene NlTRE2 gene fragment, resulting in increased sensitivity of the brown planthopper to thiazolinone drugs.
[0018] Beneficial effects
[0019] This study screened for transcription factors that influence NlTRE2 gene expression, demonstrating that brown planthoppers mediate their adaptability to adverse environmental stressors through the expression of trehalase. This study provides a novel method for enhancing brown planthoppers' sensitivity to thiazolinones, paving the way for understanding the relationship between brown planthoppers' energy metabolism and drug resistance, and laying the foundation for developing highly effective, low-toxic anti-brown planthopper drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 The present invention is the cloning of the promoter of the trehalase gene NlTRE2 from the brown planthopper and the analysis of its transcription start site.
[0021] Figure 2 It is the truncated promoter activity of the brown planthopper trehalase gene NlTRE2.
[0022] Figure 3 The brown planthopper transcription factor NlCEBP is involved in the regulation of the promoter fragment of the brown planthopper trehalase gene NlTRE2.
[0023] Figure 4 is the interference efficiency of ds CEBP after 24, 48, and 72 h of interference.
[0024] Figure 5 This is the effect of ds CEBP interference on NlTRE2 expression after 24, 48, and 72 hours.
[0025] Figure 6This is a test of the sensitivity of brown planthopper to buprofen after ds CEBP interference.
[0026] In the present invention, the brown planthopper trehalase gene N1TRE2 is also referred to as TRE2, and both have the same meaning. DETAILED DESCRIPTION
[0027] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the following examples. Unless otherwise specified, the equipment and reagents used in each example and test example can be obtained from commercial sources. Unless otherwise specified, the reagents used in the present invention are all analytical grade reagents. The specific examples described herein are only used to illustrate the present invention and are not intended to limit the present invention.
[0028] Example 1: Cloning and truncation of the brown planthopper trehalase gene promoter
[0029] The NlTRE2 gene sequence (NCBI accession number GQ397451.1) was searched on the NCBI website, and a 2000 bp sequence upstream of the gene including the start codon was obtained (SEQ ID NO. 19). The positions of the functional elements in the sequence were analyzed (see Figure 1 ), with the transcription start site at +1. Primers were designed based on the sequence (see SEQ ID NOs. 1-2 in Table 1) and PCR amplified from genomic DNA of the brown planthopper to obtain a PCR product. This product was purified, ligated into a TA vector, and transformed into Escherichia coli. A single clone with the correct sequence was cultured and the plasmid was extracted, ultimately obtaining a clone containing the NlTRE2 promoter region.
[0030] Based on the distribution of cis-acting elements within the promoter sequence, seven pairs of primers (see SEQ ID NOs. 3-10 in Table 1) were designed. Using the NlTRE2 promoter cloning plasmid as a template, seven promoter fragments of varying lengths were amplified: P(-2267 / +290), P(-1745 / +290), P(-1501 / +290), P(-1209 / +290), P(-925 / +290), P(-583 / +290), and P(-75 / +290). After linearization of the empty pGL3-Basic plasmid, each of the seven promoter fragments was constructed into the pGL3 vector. The recombinant products were transformed into Escherichia coli, and single clones identified by sequencing were expanded and plasmids were extracted. Ultimately, seven pGL3-prTRE2 recombinant plasmids were obtained.
[0031] Table 1. Oligonucleotide primers used in the present invention
[0032]
[0033]
[0034] Example 2: Dual luciferase reporter gene assay to detect promoter activity
[0035] The assay was performed using S2 Drosophila cells and the Promega Dual-Luciferase Reporter Gene Assay System Kit. S2 cells were evenly seeded in 24-well plates. When the cell density reached 80%, various truncated pGL3-prTRE2 recombinant plasmids were transfected. The empty pGL3-Basic plasmid was used as a control. Four replicates were used for each treatment. Each well contained 0.8 μg of plasmid (firefly luciferase recombinant plasmid: sea cucumber luciferase expression plasmid pRL-OpIE2 = 50:1) and 2 μL of Lipofectamine 2000 (Invitrogen).
[0036] 48 hours after cell transfection, cells were lysed, the lysate was collected and centrifuged, and the supernatant was used for luciferase activity determination using a BioTek Synergy 2 enzyme-labeled solution. 100 μL of firefly luciferase substrate LAR was first added to 20 μL of cell lysate supernatant to measure the firefly fluorescence intensity. Then, 100 μL of stop&go buffer was added to measure the Renilla fluorescence intensity. Finally, the ratio of firefly fluorescence intensity to Renilla fluorescence intensity was used as the evaluation standard for promoter activity. The results are shown in Figure 2. Figure 2 The results of the first truncation analysis of NlTRE2 are shown in Figure 2 As shown in Figure a, the fluorescence activity of P(-1718 / +217) was the highest, 2.42 times that of the empty PGL3, but there was no significant difference compared with the adjacent plasmid P(-1209 / +290), but there was a significant difference of 1.39 times with P(-583 / +290), indicating that there may be a transcription factor binding site in the TRE2 promoter from -583bp to -1718bp that plays an important role in gene upregulation. Therefore, truncation analysis was performed again in the -583bp to -1718bp fragment, and the results are shown in Figure 3. Figure 2 As shown in middle b, among the NlTRE2 promoter fragment deletion plasmids, P(-925 / +290) had the highest fluorescence activity, which was 4.52 times that of the empty PGL3 and increased by 1.75 times compared with the adjacent plasmid P(-583 / +290). The activity difference between the two was significant, indicating that there may be transcription factor binding sites in the -583bp to -925bp region of the TRE2 promoter that play an important role in gene upregulation.
[0037] Example 3: Cloning of transcription factors
[0038] Using the PROMO (https: / / alggen.lsi.upc.es / cgi-bin / promo_v3 / promo / promoinit.cgi?dirDB=TF_8.3) and JASPAR websites (https: / / jaspar.elixir.no / search?advanced=true) tools, we identified the transcription factor CEBP by online prediction of potential transcription factor binding sites within the active fragment of the NlTRE2 promoter. We searched for the corresponding sequence using the NCBI website, designed primers based on the sequence, extracted RNA from the brown planthopper (Nilaparvata lugens), and reverse transcribed it into cDNA. Using the cDNA as a template, we cloned the full-length transcription factor sequence (SEQ ID NO. 20).
[0039] The cloned transcription factor CEBP fragment (primers see Table 1 SEQ ID NO.11-12) was homologously recombined with the linearized Drosophila expression vector pAc5.1, and the ligation product was transformed into Escherichia coli. A single colony was picked for sequencing, and the bacterial solution with correct sequencing was expanded and the plasmid was extracted.
[0040] Example 4: Dual luciferase reporter gene assay to test whether transcription factors are involved in the regulation of the NlTRE2 promoter fragment
[0041] The pAc-CEBP plasmid was co-transfected with the pGL3-prTRE2(-925 / +290) plasmid into S2 cells (promoter: transcription factor: internal reference plasmid = 1:1:0.02). The internal reference plasmid was PRL-OPIE2. A promoter expression vector plasmid without transcription factor was used as a control. Each treatment was replicated four times. Dual-luciferase assays were performed 48 hours after cell transfection, following the same procedures as in Example 2.
[0042] The results are as follows Figure 3 As shown: Compared with the cells transfected with empty plasmids of pGL3-Basic (Promega catalog number E1751) and pAc5.1 (Thermo Fisher Scientific catalog number V411020), the fluorescence activity of cells transfected with the promoter reporter plasmid and pAc5.1 empty vector was significantly enhanced, indicating that the promoter fragment was active; compared with the cells transfected with empty plasmids of pGL3-Basic and pAc5.1, there was no significant difference in the fluorescence activity of cells co-transfected with the empty plasmid of pGL3-Basic and the pAc-CEBP expression vector, indicating that the transcription factor CEBP did not affect the expression of pGL3-Basic; and after co-transfection of pAc-CEBP and the pGL3-prTRE2 (-925 / +290) promoter, the relative luciferase activity was significantly higher than that of cells transfected with the promoter reporter plasmid and the pAc5.1 empty vector, indicating that CEBP can bind to the promoter region of the NlTRE2 gene, thereby enhancing the transcriptional activity of NlTRE2 to regulate gene expression.
[0043] Example 5: dsRNA synthesis and RNA interference
[0044] Primers containing the T7 promoter sequence (taatacgactcactataggg) were designed based on the CEBP sequence (see Table 1, SEQ ID NOs. 17-18). dsDNA was amplified using the CEBP plasmid as a template. The amplified product was recovered and used as the DNA template for dsRNA synthesis. CEBP dsRNA (SEQ ID NO. 21) was synthesized using the T7 RNAi Transcription Kit. dsRNA microinjection was performed using a Nanoject III programmable nanoliter syringe. The dsCEBP gene was injected into third-instar brown planthoppers (N. lugens). dsGFP was used as a negative / positive control. Each nymph was injected with 100 ng of dsRNA, with 50 nymphs injected per treatment, with three replicates. Samples were collected 24, 48, and 72 hours later to assess the knockdown efficiency and the effects on other genes.
[0045] After 24, 48, and 72 hours of dsCEBP RNA injection, the interference efficiency of CEBP was obtained by qPCR (primers see Table 1 SEQ ID NO. 13-16). Figure 4 As shown in Figure 2, compared with the injection of GFP dsRNA, the expression levels of CEBP were 38.69%, 32.87%, and 34.85%, respectively, and the interference efficiency was 61.31%, 67.13%, and 65.15%, respectively. Figure 5 As shown in the figure, compared with GFP dsRNA injection, the relative expression levels of NlTRE2 were 74.92%, 42.99%, and 1.15% after dsCEBP RNA injection at 24, 48, and 72 hours, respectively. The relative expression level decreased significantly at 48 hours, but rebounded at 72 hours. When CEBP expression was silenced, the relative expression level of TRE2 was significantly reduced, indicating that the transcription factor CEBP regulates the trehalase gene TRE2 in the brown planthopper.
[0046] To determine the effect of disrupting the transcription factor CEBP on the sensitivity of brown planthoppers to thiazolinone, LC30 concentration of thiazolinone was used to bioassay the brown planthoppers 24 hours after injection of dsRNA. The bioassay method used the rice seedling immersion method, and the mortality rate was calculated after 5 days. Figure 6 The mortality rate of brown planthoppers in the dsCEBP-injected group increased by 33.33% compared with the control group, indicating that RNAi-mediated CEBP silencing significantly enhanced the sensitivity of brown planthoppers to buprofen.
[0047] The above content is a further detailed description of the present invention in conjunction with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the concept of the present invention, which should be regarded as falling within the scope of protection determined by the claims submitted for the present invention.
Claims
1. A transcription factor of the trehalase gene N1TRE2 of the brown planthopper, characterized in that The transcription factor is CEBP, and its nucleotide sequence is shown in SEQ ID NO.
20.
2. Use of the transcription factor of the brown planthopper trehalase gene N1TRE2 according to claim 1 in preparing a reagent for regulating the expression of the brown planthopper trehalase gene N1TRE2, characterized in that: The agent can enhance the expression of N1TRE2, or the agent can inhibit the expression of N1TRE2.
3. The use of the transcription factor of the brown planthopper trehalase gene N1TRE2 in combating brown planthopper according to claim 1, characterized in that: The transcription factor is CEBP, and its nucleotide sequence is shown in SEQ ID NO.
20. By inhibiting the transcription factor, the expression of the NlTRE2 gene is reduced, thereby enhancing the sensitivity of the brown planthopper to thiazolinone drugs.
4. The use according to claim 3, characterized in that The inhibition is performed by RNAi.
5. An agent for inhibiting the expression of the brown planthopper trehalase gene N1TRE2, characterized in that: The reagent is an RNAi reagent obtained by transcription using the transcription factor CEBP as a template. The nucleotide sequence of the transcription factor CEBP is shown in SEQ ID NO.
20.
6. The reagent according to claim 5, characterized in that The RNAi sequence transcribed using the transcription factor CEBP as a template is shown in SEQ ID NO.
21.
7. An agent for enhancing the sensitivity of brown planthopper to thiazolinone drugs, characterized in that: The reagent is an RNAi reagent obtained by transcription using the transcription factor CEBP as a template. The nucleotide sequence of the transcription factor CEBP is shown in SEQ ID NO.
20.
8. A method for treating brown planthopper with dsRNA, characterized in that: The method comprises the following steps: S1. Cloning of the brown planthopper transcription factor CEBP from the brown planthopper; S2, design primers for the transcription factor gene CEBP of the brown planthopper trehalase gene and synthesize dsRNA; S3. Introduce dsRNA into brown planthopper to perform RNAi on the transcription factor CEBP of the brown planthopper's trehalase gene.