Application of PnMYB8 transcription factor in regulation and control of dencichine biosynthesis

Abstract

The invention discloses an application of a PnMYB8 transcription factor in regulation and control of biosynthesis of dencichine. According to the present invention, the first research results show that when the PnMYB8 gene is silenced, the dencichine content in the dencichine synthesis plant such as panax notoginseng is significantly increased, and when the PnMYB8 gene is overexpressed, the dencichine content in the dencichine synthesis plant such as panax notoginseng is significantly reduced, such that the PnMYB8 transcription factor can positively regulate the biological synthesis of the dencichine; regulation of the PnMYB8 transcription factor on dencichine biosynthesis comprises two aspects: application of a PnMYB8 expression promoter in promoting dencichine biosynthesis (that is, the PnMYB8 expression promoter is adopted to promote dencichine biosynthesis), and application of a PnMYB8 silencing agent in inhibiting dencichine biosynthesis (that is, the PnMYB8 silencing agent is adopted to inhibit dencichine biosynthesis).

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of PnMYB8 transcription factor in regulating the biosynthesis of notoginseng. Background Art

[0002] MYB transcription factors are the largest family of transcription factors in plants. They are divided into four subfamilies based on the different MYB domains. Among them, R2R3 type MYB transcription factors play a vital role in regulating plant secondary metabolism and can participate in regulating the biosynthesis of compounds such as flavonoids, terpenes, and polyphenols.

[0003] For example, in buckwheat, the R2R3-MYB transcription factor FeMYBF1 activates the expression of flavonol synthase genes, promoting flavonol synthesis. Studies on six plant species, including Asarum (Aristolochiaceae), have found that various R2R3-MYB transcription factors can alter flower color by regulating anthocyanin content. In Artemisia annua, the AaMYB1 transcription factor binds to the promoter of key enzyme genes in the artemisinin biosynthesis pathway, promoting artemisinin biosynthesis. In mint, the MhMYB1 and MhMYB2 transcription factors regulate the expression of genes involved in the synthesis of monoterpenes such as menthol, influencing the formation of mint aroma. In cabbage, MYB transcription factors are involved in the biosynthesis of polyphenolic compounds.

[0004] However, to date, there have been no reports on the role of MYB transcription factors in regulating the biosynthesis of amino acid components (such as notoginseng). Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the PnMYB8 transcription factor in regulating the biosynthesis of notoginseng, and to provide a pathway for regulating the biosynthesis of notoginseng in notoginseng-synthesizing plants such as Panax notoginseng.

[0006] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0007] The present invention first provides an application of the PnMYB8 transcription factor in regulating the biosynthesis of notoginseng. The nucleotide sequence of the PnMYB8 transcription factor is shown in SEQ ID No.1.

[0008] The present invention discovered for the first time that when the PnMYB8 gene was silenced, the content of notoginseng in notoginseng-synthesizing plants such as Panax notoginseng was significantly increased, while when the PnMYB8 gene was overexpressed, the content of notoginseng in notoginseng-synthesizing plants such as Panax notoginseng was significantly decreased, indicating that the PnMYB8 transcription factor can positively regulate the biosynthesis of notoginseng.

[0009] Therefore, the regulation of notoginseng biosynthesis by PnMYB8 transcription factor includes two aspects: the application of PnMYB8 expression promoter in promoting notoginseng biosynthesis (i.e., using PnMYB8 expression promoter to promote notoginseng biosynthesis), and the application of PnMYB8 silencer in inhibiting notoginseng biosynthesis (i.e., using PnMYB8 silencer to inhibit notoginseng biosynthesis).

[0010] In the above applications, the PnMYB8 transcription factor can be used to regulate the biosynthesis of notoginseng in the roots, stems or leaves of notoginseng-synthesizing plants.

[0011] Preferably, in the above application, the PnMYB8 expression promoter comprises Agrobacterium containing a PnMYB gene overexpression vector;

[0012] The application comprises injecting the PnMYB8 expression promoter into the roots, stems or leaves of the notoginseng synthesis plant.

[0013] Preferably, in the above application, the PnMYB8 silencing agent comprises Agrobacterium containing a PnMYB gene silencing vector;

[0014] The application comprises injecting the PnMYB8 silencing agent into the roots, stems or leaves of the notoginseng synthesizing plant.

[0015] The present invention also provides the use of PnMYB8 transcription factor as an expression regulator of the key gene PnAAE1 for notoginseng biosynthesis, wherein the above-mentioned use comprises using the PnMYB8 expression promoter to upregulate the expression of the key gene PnAAE1 for notoginseng biosynthesis;

[0016] Alternatively, PnMYB8 silencing agent was used to downregulate the expression of PnAAE1, a key gene in notoginseng biosynthesis.

[0017] The present invention also provides an application of the PnMYB8 transcription factor as an expression regulator of the key gene PnBAHD1 for notoginseng biosynthesis, wherein the application comprises using the PnMYB8 expression promoter to upregulate the expression of the key gene PnBAHD1 for notoginseng biosynthesis;

[0018] Alternatively, PnMYB8 silencing agent was used to downregulate the expression of PnBAHD1, a key gene in notoginseng biosynthesis.

[0019] The present invention found that the PnMYB8 transcription factor promotes the transcription of PnAAE1 and PnBAHD1, the key genes for notoginseng biosynthesis, by binding to the promoters of PnAAE1 and PnBAHD1, thereby promoting the biosynthesis of notoginseng.

[0020] Compared with the prior art, the beneficial effects of the present invention are embodied in:

[0021] (1) The present invention first discovered that when the PnMYB8 gene was silenced, the content of notoginseng in notoginseng-synthesizing plants such as Panax notoginseng was significantly increased, while when the PnMYB8 gene was overexpressed, the content of notoginseng in notoginseng-synthesizing plants such as Panax notoginseng was significantly decreased, indicating that the PnMYB8 transcription factor can positively regulate the biosynthesis of notoginseng.

[0022] (2) The present invention found that the PnMYB8 transcription factor promotes the transcription of PnAAE1 and PnBAHD1, the key genes for the biosynthesis of notoginseng, by binding to the promoters of notoginseng, thereby promoting the biosynthesis of notoginseng. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Agarose gel electrophoresis diagram of PCR amplification of PnMYB8;

[0024] Among them, Marker indicates marker, 1-2 are PCR amplification bands of PnMYB8;

[0025] Figure 2 The amino acid sequence alignment results of PnMYB8 and other MYB transcription factors;

[0026] Figure 3 The phylogenetic tree analysis results of PnMYB8 and Arabidopsis R2R3 type MYB proteins;

[0027] Figure 4 This is the agarose gel electrophoresis image of colony PCR of pCAMBIA1300-35S-GFP-PnMYB8;

[0028] Among them, 1 to 3 are colony PCR bands of pCAMBIA1300-35S-GFP-PnMYB8;

[0029] Figure 5 The results of subcellular localization analysis of PnMYB8;

[0030] Among them, GFP indicates green fluorescent protein signal, Osghd7:RFP indicates nuclear marker signal, Chlorophyllfluorescence indicates chlorophyll fluorescence signal, Bright field indicates bright field observation, and Merged indicates (all signals) merged;

[0031] Figure 6 This is the agarose gel electrophoresis diagram of colony PCR of pGBKT7-PnMYB8;

[0032] Among them, 1 to 3 are colony PCR bands of pGBKT7-PnMYB8;

[0033] Figure 7 The results of the analysis of the transcriptional activation activity of PnMYB8;

[0034] Figure 8 Comparison of the expression levels of PnMYB8 in different tissues of Panax notoginseng;

[0035] Root, Stem, and Leaf represent root, stem, and leaf, respectively; Relative expression level represents the relative expression level of PnMYB8; Content of Dencichine represents the concentration of Dencichine; * indicates P < 0.05 compared with the root; *** indicates P < 0.01 compared with the root;

[0036] Figure 9 Agarose gel electrophoresis diagram of colony PCR for PnMYB8 gene silencing;

[0037] Among them, 1 and 2 are the forward target colony PCR verification bands of PnMYB8; 3 and 4 are the reverse target colony PCR verification bands of PnMYB8;

[0038] Figure 10 This is the gel electrophoresis image of colony PCR of pCAMBIA1300-35S-PnMYB8;

[0039] Among them, 1 to 3 are colony PCR bands of pCAMBIA1300-35S-PnMYB8;

[0040] Figure 11 Analysis of PnMYB8 expression and notoginseng content in Panax notoginseng leaves after PnMYB8 gene silencing;

[0041] Figure A shows the relative expression level of the PnMYB8 gene after silencing the PnMYB8 gene; Figure B shows the notoginseng content after silencing the PnMYB8 gene; ** indicates P < 0.01 compared with the CK group;

[0042] Figure 12 is the expression level of PnAAE1 and PnBAHD1 genes after silencing of PnMYB8 gene;

[0043] Figure A shows the relative expression level of the PnAAE1 gene after PnMYB8 gene silencing; Figure B shows the expression level of the PnBAHD1 gene after PnMYB8 gene silencing; ** indicates P < 0.01 compared with the CK group;

[0044] Figure 13 Analysis of PnMYB8 expression and notoginseng content in Panax notoginseng leaves after overexpression of PnMYB8 gene;

[0045] Figure A shows the relative expression level of the PnMYB8 gene after overexpression of the PnMYB8 gene; Figure B shows the notoginseng content after overexpression of the PnMYB8 gene; ** indicates P < 0.01 compared with the CK group;

[0046] Figure 14 is the expression level of PnAAE1 and PnBAHD1 genes after overexpression of PnMYB8 gene;

[0047] Figure A shows the relative expression level of the PnAAE1 gene after overexpression of the PnMYB8 gene; Figure B shows the expression level of the PnBAHD1 gene after overexpression of the PnMYB8 gene; ** indicates P < 0.01 compared with the CK group;

[0048] Figure 15 This is the agarose gel electrophoresis diagram of Panax notoginseng total DNA;

[0049] Among them, 1 and 2 are P. notoginseng DNA samples;

[0050] Figure 16 Agarose gel electrophoresis diagram of PnAAE1 and PnBAHD1 promoter clones;

[0051] Figure A shows the PnAAE1 promoter clone; Figure B shows the PnBAHD1 promoter clone; 1 to 2 represent two replicates;

[0052] Figure 17 For the construction of bait vectors for PnAAE1 and PnBAHD1;

[0053] Figure A shows the construction of the PnAAE1 bait vector; Figure B shows the construction of the PnBAHD1 bait vector; 1 to 3 represent 3 repeats;

[0054] Figure 18 Screening for the lowest AbA inhibition concentration of PnAAE1-Promoter and PnBAHD1-Promoter bait strains;

[0055] Figure A shows the screening of the lowest AbA inhibition concentration of the PnAAE1-Promoter bait strain; Figure B shows the screening of the lowest AbA inhibition concentration of the PnBAHD1-Promoter bait strain;

[0056] Figure 19 Agarose gel electrophoresis of colony PCR of PnMYB8-pGADT7;

[0057] Among them, 1 to 3 are colony PCR bands of pGADT7-PnMYB8;

[0058] Figure 20Yeast one-hybrid assay for PnMYB8 and PnAAE1 and PnBAHD1 promoters;

[0059] Figure 21 Agarose gel electrophoresis diagram of colony PCR for the construction of pGreenⅡ0800-LUC vector for PnMYB8-pGreenⅡ-62-SK vector, PnAAE1-Promoter, and PnBAHD1-Promoter;

[0060] Figure A shows the colony PCR of pGreenⅡ-62-SK-PnMYB8 vector; Figure B shows the colony PCR band of pGreenⅡ0800-LUC-PnAAE1-Promoter; Figure C shows the colony PCR band of pGreenⅡ0800-LUC-PnBAHD1-Promoter; 1 to 3 represent three replicates;

[0061] Figure 22 Dual luciferase assay for PnMYB8 binding to PnAAE1 and PnBAHD1 promoters;

[0062] Figure A is a schematic diagram of the construction of the dual-luciferase reporter system vector; Figure B is the dual-luciferase analysis of PnMYB8;

[0063] Figure 23 This is the agarose gel electrophoresis image of pET28a-PnMYB8 colony PCR;

[0064] Among them, 1 to 3 are pET28a-PnMYB8 colony PCR bands;

[0065] Figure 24 For prokaryotic expression analysis of PnMYB8;

[0066] Figure 25 Analysis of the binding sites between PnMYB8 and PnAAE1 promoter;

[0067] Among them, Mutation probe represents hybridization probe, Biotin probe represents biotin-labeled probe, Unlabeled probe represents unlabeled probe, Bound probe represents capture probe, and Free probe represents free probe;

[0068] Figure 26 Analysis of the binding sites between PnMYB8 and PnBAHD1 promoter;

[0069] Figure 27 The CHIP-qPCR results of PnMYB8, PnAAE1 and PnBAHD1 promoters are shown;

[0070] Figure A shows the CHIP-qPCR of PnMYB8 and PnAAE1 promoters; Figure B shows the CHIP-qPCR of PnMYB8 and PnBAHD1 promoters; ** indicates P < 0.01 compared with CK. DETAILED DESCRIPTION

[0071] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and embodiments.

[0072] Example 1 Analysis of the regulatory effect of PnMYB8 on notoginseng biosynthesis

[0073] 1. Materials and instruments

[0074] The experimental materials, vectors and strains, experimental reagents, experimental instruments, and data processing software used in this example are as follows:

[0075] 1.1 Experimental Materials

[0076] The experimental materials used for transcriptome screening and tissue-specific analysis were three-year-old Panax notoginseng; the experimental materials used for transcription factor gene overexpression and gene silencing experiments were two-year-old Panax notoginseng, purchased from Wenshan, Yunnan; Panax notoginseng was adaptively cultivated in Beijing for 3 days and then set aside.

[0077] 1.2 Vectors and strains

[0078] Vectors such as pCAMBIA1300-35S-3XFlag, pCAMBIA1300-35S-GFP, pMD19-T (Takara), pGBKT7, and pGADT7 were purchased from Wuhan Biotransduction Laboratory Co., Ltd., the pHELLSGATE2 vector was purchased from Baosai Biotechnology Co., Ltd., and competent cells including Escherichia coli Trans T1, Agrobacterium EHA105, and Y2H Gold yeast competent cells were purchased from Beijing Quanshijin Technology Co., Ltd. and Wuhan Biotransduction Laboratory.

[0079] 1.3 Experimental Reagents

[0080] Chromatographically pure acetonitrile and chromatographically pure methanol (MERCK, Germany) were purchased from Zhejiang Huifeng Biotechnology Co., Ltd., phosphoric acid was purchased from Wuxi Jiani Chemical Co., Ltd., tetrabutylammonium hydroxide (CAS No. 147741-30-8, McLean) was purchased from Zhejiang Hongda Biotechnology Co., Ltd., and notoginseng reference substance (CAS No. 5302-45-4, HPLC ≥98%, Shanghai Yuanye) was purchased from Hangzhou Shuilu Biotechnology Co., Ltd.

[0081] 2× Taq PCR Mix was purchased from Novozymes, and reagents such as agarose (Biowest Agrose, Spain), DNA Marker, aminomycin, rifampicin, spectinomycin, and SD / -Ade / -His / -Trp / X-α-gal culture medium were purchased from Beijing Biode Biotechnology Co., Ltd. Primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd., and Kpn I, Sal I, Nde I, Xba I, and Xho I endonucleases were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0082] 1.4 Experimental Instruments

[0083] The detailed information of the instruments used in this example is shown in Table 1 below.

[0084] Table 1 Experimental instruments

[0085]

[0086] 1.5 Data processing software

[0087] The software used for data processing are: GraphpadPrism 8, Microsoft Excel Software 2021, SPSS21.0. The data are presented in the form of It indicates that the ANOVA method was used for single-factor test. When P < 0.05, it was considered that there was a significant difference, and when P < 0.01, it was considered that there was an extremely significant difference.

[0088] 2. Screening and analysis of specific transcription factors in Panax notoginseng

[0089] 2.1 Transcriptome Sequencing and Analysis

[0090] Panax notoginseng plant tissue was extracted, RNA was extracted, reverse transcribed into cDNA, and sequenced using the BGI DNBSEQ platform. After fragment splicing, the transcriptome data of Panax notoginseng was generated, from which relevant differentially expressed genes were screened. In this example, a MYB transcription factor belonging to the R2R3 type MYB transcription factor was screened and named PnMYB8.

[0091] 2.2 Gene cloning of PnMYB8

[0092] Based on the full-length gene of PnMYB8 in the transcriptome (SEQ ID No. 1), specific primers (5'-3') were designed first:

[0093] PnMYB8-F: ATGGATGTAGTTAAAGGTGAAGCTG (SEQ ID No. 2);

[0094] PnMYB8-R:TCAAATATTGTTGCTGAATTG CTGC (SEQ ID No. 3);

[0095] Then perform PCR amplification according to the following system and procedures:

[0096] PCR amplification system: cDNA 1.6 μL, LATaq (2.5 U·μL -1 )0.5μL, 10×LATaqbuffer 5μL, dNTPMix (2.5mmol·L -1 ) 4 μL, Primer-F 1 μL, Primer-R 1 μL, and dd H2O to make up to 50 μL.

[0097] PCR amplification program: 94°C for 5 min, one cycle; 94°C for 40 s; 50-68°C for 30 s; 35 cycles; 72°C for 60 s; 72°C for 10 min, one cycle; 4°C for ∞ min, one cycle.

[0098] from Figure 1 As can be seen in the figure, the amplified gene is about 1000bp. After gel excision and recovery, the gene was sequenced and found to be 1002bp in length, encoding 333 amino acids.

[0099] PnMYB8 gene sequence (5'-3'):

[0100] ATGGATGTAG TTAAAGGTGA AGCTGGAAAT TCAGAGGTTG AAGTTATGATGATGAGTAGTGATCAAGAAG AGTTGATGAT GGACTTACGG CGAGGCCCATGGACTGTTGA AGAAGACTTT GCTCTCATTACATCGC TCAACACGGCGAAGGTCGTTCGTTCGTT GCAGGACTGAAGAGAACTGGAAAAAGCTGC AGATTAAGAT GGCTGAATTA TTTACGTCCT GACGTTCGACGTGGAAATATCACCCTTGAA GAACAACTCT TGATTCTTGA GCTTCATTCTCGTTGGGGCA ACAGATGGTC GAAAATTGCACAACACTTGC ACGAGTCCAAAAACACGCGAAACAACTCAA ATGCGACGTG AACAGCAAGC AATTCAAGGA CACCATGCGTTACCTTTGGATGCCGAGATT AGTTGAAAGA ATTCAGGCGG CCGCCAGCTCCACCGGAAAT TTCACCTACA ATACCAGCAACATGAATAAT AATAATAATAGAACCATGACCATGAGAGAG TGGTACTGCCACAGGAGGCCAATATTATTA TGTGCAACAA CTTCGAGGGT ACGGTCCAAT CGGTTAATAACGCTAGTAGTTTCACACCCG AAAATTCTTG TACCACGGCC TCATCGGACTCGTTTGGACG ATCACAAGTA TCGCCGGTTTCTGACCTCAC TGATTGTCTACTTAGTTTA ATCCATAATCAGGATTTACCACCAGGGA AATCAGCTGG GATTCACAGA ATCCCTAATT AGCCCCTCTGGTTACTTTTAATCAAGGTTTG GACTTTCAAG CTTCTATGGA TCAGCAAAGCAACAATAATA ACCCATGGATAGACGGTGGGGACGTATCGG ACAATTTGTGGAATGATGAG GACATTTGGC TCCTACAGCA GCAATTCAGC AACAATATTTGA.

[0101] 2.3 Bioinformatics analysis of PnMYB8

[0102] First, the ProtParam toolkit was used to characterize the target protein's physicochemical properties, quantitatively analyzing its amino acid composition, molecular weight distribution, and isoelectric point parameters, and evaluating its thermodynamic stability. The TMHMM 2.0 online prediction system was then used to model the protein's transmembrane topology to eliminate the possibility of a transmembrane domain.

[0103] The functional association analysis phase involved two key validation steps: 1. Protein homology comparisons were performed using the NCBI BlastP database, focusing on identifying R2R3-MYB family members involved in terpenoid biosynthesis regulation; 2. Multiple sequence alignment analysis was performed using DNAMAN 9.0 software to establish conserved domain relationships between target proteins and functional homologs. Finally, molecular phylogenetic analysis was performed using the MEGA 7 software package. Using the neighbor-joining method, a phylogenetic tree model was constructed that included representative Arabidopsis R2R3-MYB members, revealing the evolutionary status and functional clustering characteristics of PnMYB8.

[0104] 2.3.1 Analysis of the physicochemical properties of PnMYB8

[0105] Based on the Protparam online analysis platform integrated into the Expasy bioinformatics resource library (accessible at: https: / / web.expasy.org / protparam / ), this study systematically analyzed the molecular characteristics of the PnMYB8 transcription factor. The target protein is composed of 333 amino acid residues, and its molecular topological parameters are characterized as follows: ① The atomic composition spectrum shows a total atomic weight of 5221 (molecular formula C 1649 H 2543 N 483 O 526 S 20 ); ② The relative molecular mass is 38191.45Da; ③ The theoretical isoelectric point (PI) is 5.23, indicating that the protein has the best solubility characteristics in a weakly acidic environment.

[0106] In terms of stability assessment, the protein's instability coefficient, as measured by the Guruprasad instability index calculation system, was 57.32, significantly higher than the critical threshold (40.0), thus identifying it as a typical unstable protein. Further hydrophilicity profile analysis revealed an average hydrophilicity index (GRAVY) of -0.720 for the target protein. Based on the Kyte-Doolittle hydrophilicity scale, this negative value clearly indicates that PnMYB8 is a hydrophilic functional protein, a property that is significantly correlated with its potential involvement in nuclear transcriptional regulation.

[0107] 2.3.2 Analysis of the transmembrane region and subcellular localization of PnMYB8

[0108] Through TRMHMM server v2.0(<https: / / services.healthtech.dtu.dk / service.php?TMH> ) predicted the transmembrane region of PnMYB8.

[0109] The results showed that no transmembrane helices were detected (the number of transmembrane helices was 0), the expected value of transmembrane helical amino acid residues was 0.00035, and no transmembrane helices were detected in the first 60 amino acids. In addition, the overall probability of the N-term being located on the cytoplasmic side of the membrane was low, at 0.02021.

[0110] 2.3.3 PnMYB8 amino acid sequence analysis

[0111] DNAman software was used to perform homology analysis based on Blast P (see Figure 2 ), and systematically compared the amino acid sequence of PnMYB8 with R2R3-MYB transcription factors from other species.

[0112] Comparison confirmed that the protein carries a characteristic R2R3-MYB domain, meeting the classification criteria for R2R3-type transcription factors. The amino acid sequence of PnMYB8 shares high sequence similarity with Arabidopsis thaliana AtMYB78 (50.28%), AtMYB108 (50.00%), and grape VvMYB108 (64.48%), but has relatively low similarity with strawberry FaMYB5 (27.01%) and Panax notoginseng PnMYB4 (25.83%).

[0113] 2.3.4 PnMYB8 phylogenetic tree analysis

[0114] Based on the Arabidopsis thaliana Information Resource Library (TAIR, access address: https: / / www.arabidopsis.org / ), a systematic search and acquisition of amino acid sequence data of R2R3-MYB family members was performed. The MEGA 7.0 molecular evolution analysis platform was used to construct a phylogenetic tree using the neighbor-joining method (see Figure 3 ).

[0115] Phylogenetic cluster analysis revealed that PnMYB8 was classified within the Arabidopsis R2R3-MYB subfamily S20 clade, sharing significant homology (>50% similarity) with members including AtMYB78, AtMYB108, AtMYB112, AtMYB2, AtMYB62, and AtMYB116. Functional annotation analysis revealed that AtMYB112 regulates anthocyanin biosynthesis, while AtMYB62 mediates the gibberellic acid metabolism pathway, suggesting that PnMYB8 may possess a conserved functional module regulating secondary metabolism.

[0116] 2.4 Analysis of PnMYB8 subcellular localization

[0117] 2.4.1 Construction of subcellular localization vector and Agrobacterium transformation

[0118] The above-mentioned specific primers PnMYB8-F and PnMYB8-R were used to amplify the full length of PnMYB8, and PCR amplification, product purification, ligation, competent transformation, and colony PCR of PnMYB8 were performed.

[0119] Primers PnMYB8-KpnI-F and PnMYB8-KpnI-R (5'-3') with Kpn I and SalI restriction sites were designed based on the pCAMBIA1300-35S-GFP vector and the full-length sequence of the PnMYB8 gene:

[0120] PnMYB8-KpnI-F: CACGGGGGACGAGCTCGGTACCATGGATGTAGTTAAAGGTGAAGC (SEQ ID No. 4);

[0121] PnMYB8-SalI-R:CAACTTTTTGCTCCAT GTCGAC AATATTGTTGCTGAATTGCTGCTG(SEQ IDNo.5);

[0122] The PCR product containing the target gene PnMYB8 and the vector pCAMBIA1300-35S-GFP were digested with double enzymes to construct the recombinant vector pCAMBIA1300-35S-GFP-PnMYB8. The pCAMBIA1300-35S-GFP-PnMYB8 was verified by colony PCR using universal primers for the pCAMBIA1300-35S-GFP vector. The expected band appeared at around 1200 bp (see the results). Figure 4 ), and after verification by sequencing, the recombinant vector was transformed into Agrobacterium EHA105.

[0123] Universal primers (5'-3') for the pCAMBIA1300-35S-GFP vector include:

[0124] 1300-35S-GFP-F: CATTTGGAGAGAACACGGGGGACGAGCT (SEQ ID No. 6);

[0125] 1300-35S-GFP-R: TGAAGTGGTCACGAGGG (SEQ ID No. 7).

[0126] 2.4.2 Isolation and transfection of Arabidopsis protoplasts

[0127] Arabidopsis protoplasts were used for transfection. The protoplast isolation method was referenced to the Biyuntian Plant Protoplast Isolation Kit method (C0362). The transfection method was referenced to the Biyuntian Plant Protoplast Transfection Kit method (C0563). First, the recombinant plasmid pCAMBIA1300-35S-GFP-PnMYB8 and the negative control pCAMBIA1300-35S-GFP were co-transfected with the nuclear marker pCAMBIA1300-35S-RFP-Osghd7 into Arabidopsis protoplasts. The cells were cultured under low light for 8 to 10 hours, and then the distribution of the fusion protein in the Arabidopsis protoplasts was observed under a laser confocal microscope. The results are shown in Figure 2. Figure 5 .

[0128] The Arabidopsis mesophyll protoplast isolation method refers to the Biyuntian plant protoplast isolation kit method (C0362), and the transfection method refers to the Biyuntian plant protoplast transfection kit method (C0563).

[0129] Figure 5 Laser confocal microscopy imaging analysis showed that the GFP::PnMYB8 fusion protein and the RFP::Osghd7 nuclear marker signal showed complete co-localization characteristics; while the GFP fluorescence signal in the empty control group showed a pan-cellular distribution pattern (visible in the nuclear region / cytoplasm / plasma membrane), indicating that PnMYB8 is a nuclear-localized transcriptional regulatory factor.

[0130] 2.5 Transcriptional activity analysis

[0131] 2.5.1 Construction of PnMYB8 transcriptionally active vector

[0132] The full-length PnMYB8 gene was amplified and double-digested using Nde I and BamH I restriction sites according to the pGBKT7 vector and PnMYB8 gene sequences, and then the recombinant vector pGBKT7-PnMYB8 was constructed.

[0133] The double enzyme digestion primer sequence (5'-3') is:

[0134] PnMYB8-pGBKT7-F: CTCAGAGGAGGACCTGCATATGGATGTAGTTAAAGGTGAAGC (SEQID.No.8);

[0135] PnMYB8-pGBKT7-R:

[0136] GGCCGCTGCAGGTCGAC GGATCC CTAAATATTGTTGCTGAATTGC-3 (SEQ ID. No. 9).

[0137] An experimental group (pGBKT7-PnMYB8), a negative control group (pGBKT7 empty vector), and a positive control group (pGBKT7-p53) were set up. The cells were introduced into Y2H Gold yeast competent cells by chemical transformation. After the competent cells grew single clones, single clones were picked and verified by PCR using universal primers for the pGBKT7 vector. The expected band appeared around 1200 bp (see Figure 6 )

[0138] Universal primers for pGBKT7 vector (5'-3') include:

[0139] pGBKT7-F: TAATACGACTCACTATAGGG (SEQ ID.No.10);

[0140] pGBKT7-R: CATAAGAAATTCGCCCGGAAT (SEQ ID. No. 11).

[0141] 2.5.2 PnMYB8 has transcriptional activation activity

[0142] Positive transformants (experimental group, negative control group, and positive control group) were further streaked and cultured in SD / -Ade / -His / -Trp / X-α-gal four-deficient chromogenic medium. After culturing for 2-3 days, the color reaction indicated by β-galactosidase activity was observed: if it turned blue, it indicated that the marker had transcriptional activation activity.

[0143] from Figure 7 The results show that the pGBKT7-p53 positive control transformant exhibited clonal proliferation and a typical blue color development reaction on SD / -Trp-deficient medium, while the negative control transformant did not undergo color development. The pGBKT7-PnMYB8 recombinant strain formed visible colonies under the same culture conditions and showed a positive reaction for β-galactosidase activity (blue color development), indicating that PnMYB8 can autonomously activate the HIS3 / β-gal gene, indicating that it has transcriptional activation activity.

[0144] 2.6 Analysis of tissue-specific expression of PnMYB8

[0145] Panax notoginseng plants were selected and total RNA was extracted from roots, stems, and leaves. Real-time fluorescence quantitative PCR was used to analyze the expression of PnMYB8 in different parts of Panax notoginseng. Real-time fluorescence quantitative PCR primers (5'-3') include:

[0146] PnMYB8-RT-F: 5'-TTACATCGCTCAACACGG-3' (SEQ ID. No. 12);

[0147] PnMYB8-RT-R: 5'-ATCAGTTCTCCTGGCAAGT-3' (SEQ ID. No. 13).

[0148] from Figure 8 The results show that the PnMYB8 gene is expressed in the roots, stems and leaves of Panax notoginseng, with the highest expression level in the roots and the lowest expression level in the leaves, which is consistent with the tissue-specific expression trend of notoginseng, suggesting that PnMYB8 may be involved in regulating the biosynthesis of notoginseng.

[0149] 3. Functional verification of PnMYB8 regulating notoginseng synthesis

[0150] 3.1 Construction of PnMYB8 gene silencing vector

[0151] A relatively conserved 200 bp sequence in the PnMYB8 gene was selected as the target sequence dsRNA. Then, according to the target sequence-specific primers (see Table 2), the target forward fragment was homologously recombined and inserted into the multiple cloning sites Xho I-Xho I (5'-3') in the interference vector pHELLSGATE2. The reverse fragment of the target was homologously recombined and inserted into the multiple cloning sites Xba I-Xba I (5'-3'). During the construction, the forward sequence was inserted first, and after sequencing was correct, the reverse sequence was inserted by homologous recombination. The results were verified by colony PCR (see Figure 9) and sequencing was correct, the pHELLSGATE2-PnMYB8 gene silencing vector was successfully constructed, and then transformed into Agrobacterium EHA105 competent cells.

[0152] Table 2 Primer sequences for PnMYB8 ligation to the gene silencing vector pHELLSGATE2

[0153]

[0154] 3.2 Construction of gene overexpression vector and Agrobacterium transformation

[0155] According to the PnMYB8 gene sequence and the pCAMBIA1300-35S-3XFlag overexpression vector sequence, two restriction enzyme sites, Kpn I and Sal I, were selected. Then, the full-length PnMYB8 gene sequence was amplified by PCR using primers with restriction enzyme sites. The recovered product was double-digested with the pCAMBIA1300-35S-3XFlag vector and then ligated. After transformation, a single clone was picked and colony PCR was performed using universal primers for the pCAMBIA1300-35S-3XFlag vector. The expected band appeared at around 1200 bp (see Figure 10 ); positive clones were selected for sequencing and plasmid extraction to obtain the pCAMBIA1300-35S-3XFlag-PnMYB8 recombinant vector. The successfully constructed recombinant plasmid was transformed into Agrobacterium EHA105 competent cells.

[0156] Among them, primers with Kpn I and Sal I restriction sites (5'-3') include:

[0157] PnMYB8-KpnI-F:

[0158] CACGGGGGACGAGCTC GGTACC ATGGATGTAGTTAAAGGTGAAGC (SEQ ID. No. 18);

[0159] PnMYB8-SalI-R:CAACTTTTTGCTCCAT GTCGAC AATATTGTTGCTGAATTGCTGCTG (SEQ ID. No. 19).

[0160] PCAMBIA1300-35S-3XFlag universal primers (5'-3') include:

[0161] 35s-3XFLag-F:CTATCCTTCGCAAGACCCTTC(SEQ ID.No.20);

[0162] 35s-3XFLag-R: GCAATGAAACTG ATGCATTG (SEQ ID. No. 21).

[0163] 3.3 Transformation of Panax notoginseng leaves with gene silencing vector

[0164] Agrobacterium containing pHELLSGATE2, pHELLSGATE2-PnMYB8 and pGD-p19 vectors were added to LB liquid culture medium, and appropriate amounts of spectinomycin and rifampicin were used to inhibit the growth of bacteria. The culture was maintained at 28°C and shaken at 200 rpm for a certain period of time until the OD 600 is 0.6~0.8. Then press pHELLSGATE2 / pHELLSGATE2-PnMYB8OD 600 Value: pGD-p19 OD 600 The bacterial solution was aspirated at a ratio of 0.5:0.3 and added to a 50 mL centrifuge tube. After centrifugation, sedimentation and suspension, Panax notoginseng leaves with uniform size and good growth were selected for injection. 96 h after injection, the Panax notoginseng leaves were collected and the relative expression level of PnMYB8 was determined by real-time fluorescence quantitative PCR to determine whether the gene was successfully silenced.

[0165] Figure 11 The results in Figure A show that the relative gene expression levels of the three strains pHELLSGATE2-PnMYB8 were 35.3%, 26.7%, and 41.4% of the control group (CK), respectively, indicating that the PnMYB8 gene was successfully silenced.

[0166] Then, the HPLC method was used to determine the content of notoginseng in the three strains where gene silencing was successful. Figure 11 The results in Figure B (center) show that the levels of notoginseng in the three silenced strains were 41.6%, 30.8%, and 49.5% of that in the CK strain, respectively. This result indicates that silencing the PnMYB8 gene significantly reduced notoginseng levels, suggesting that the PnMYB8 gene positively regulates notoginseng levels.

[0167] 3.4 PnMYB8 gene silencing leads to decreased expression of PnAAE1 and PnBAHD1 genes

[0168] In order to analyze the effect of PnMYB8 gene silencing on the key enzymes of notoginseng biosynthesis, real-time fluorescence quantitative PCR was used to detect the changes in the expression levels of the key enzymes of notoginseng biosynthesis PnAAE1 and PnBAHD1 in the PnMYB8 gene silencing lines. The results are shown in Figure 2. Figure 12 shown.

[0169] from Figure 12As can be seen from the data, in the three PnMYB8 gene-silenced lines, the expression levels of the PnAAE1 gene were 41.5%, 42.2%, and 29.9% of those in the CK line, respectively; and the expression levels of the PnBAHD1 gene were 50.8%, 60.3%, and 46.8% of those in the CK line, respectively. This indicates that silencing the PnMYB8 gene significantly reduced the expression levels of the PnAAE1 and PnBAHD1 genes.

[0170] 3.5 Transformation of Panax notoginseng Leaves with Gene Overexpression Vectors

[0171] Agrobacterium containing pCAMBIA1300-35S-3XFlag, pCAMBIA1300-35S-3XFlag-PnMYB8 and pGD-p19 vectors were added to LB liquid culture medium, and appropriate amounts of kanamycin and rifampicin were used to inhibit the growth of bacteria. The culture was maintained at 28°C and shaken at 200 rpm for a certain period of time until the OD 600 0.6~0.8; then pCAMBIA1300-35S-3XFlag / pCAMBIA 1300-35S-3XFlag-PnMYB8OD 600 Value: pGD-p19 OD 600 The bacterial solution was aspirated at a ratio of 0.5:0.3 and added to a 50 mL centrifuge tube; after centrifugation, sedimentation and suspension of the bacterial solution, Panax notoginseng leaves of uniform size and good growth were selected for injection; 72 hours after injection, Panax notoginseng leaves were collected and the relative expression level of PnMYB8 was determined by real-time fluorescence quantitative PCR to determine whether the gene was successfully overexpressed.

[0172] Figure 13 The results in Figure A show that the relative expression levels of the PnMYB8 gene in the three strains of pCAMBIA1300-35S-3XFlag-PnMYB8 were 1.42, 1.66, and 1.87 times that of the control group (CK), respectively. It can be seen that the gene expression level of the gene overexpression strain was significantly higher than that of the CK strain, indicating that the PnMYB8 gene was successfully overexpressed.

[0173] HPLC was further used to determine the content of notoginseng in the three strains with successful gene overexpression. Figure 13 The results in Figure B show that the levels of notoginseng in the three PnMYB8 overexpression lines were 1.33, 1.40, and 1.62 times higher than those in the CK line, respectively. This indicates that overexpression of the PnMYB8 gene significantly increased notoginseng content, suggesting that PnMYB8 can positively regulate notoginseng biosynthesis.

[0174] 3.6 Overexpression of the PnMYB8 gene leads to increased expression of the PnAAE1 and PnBAHD1 genes

[0175] In order to analyze the effect of PnMYB8 gene overexpression on the key enzymes of notoginseng biosynthesis, real-time fluorescence quantitative PCR was used to detect the changes in the expression levels of PnAAE1 and PnBAHD1 genes. Figure 14 .

[0176] from Figure 14 As can be seen from the data, in the three PnMYB8 overexpression lines, the expression levels of the PnAAE1 gene were 1.98, 1.68, and 2.09 times that of the CK line, respectively, and the expression levels of the PnBAHD1 gene were 1.33, 1.30, and 1.47 times that of the CK line, respectively. This indicates that overexpression of the PnMYB8 gene can increase the expression levels of the PnAAE1 and PnBAHD1 genes.

[0177] Example 2 Analysis of the regulatory effect of PnMYB8 on the expression of key enzymes in the biosynthesis of notoginseng

[0178] 1. Materials and instruments

[0179] The experimental materials, vectors and strains, experimental reagents, experimental instruments, and data processing software used in this example are as follows:

[0180] 1.1 Experimental Materials

[0181] Two-year-old Panax notoginseng was purchased from Wenshan, Yunnan. After three days of adaptive cultivation in Beijing, its roots, stems, and leaves were collected and washed with pure water. Part of the roots was stored in a -80°C refrigerator for RNA extraction, and part was dried in a 60°C oven for later use.

[0182] 1.2 Experimental Reagents

[0183] Chromatographically grade acetonitrile and methanol (MERCK, Germany) were purchased from Zhejiang Huifeng Biotechnology Co., Ltd. Phosphoric acid (Wuxi Jiani Chemical Co., Ltd.) and tetrabutylammonium hydroxide (CAS No. 147741-30-8, MacLean) were purchased from Zhejiang Hongda Biotechnology Co., Ltd. Panax notoginseng reference substance (CAS No. 5302-45-4, HPLC ≥98%, Shanghai Yuanye) was purchased from Hangzhou Shuilu Biotechnology Co., Ltd. TRNzol Universal Total RNA Extraction Reagent (DP424) and RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Probes and primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd. Agarose, TBE electrophoresis buffer, plasmid extraction kit, LB medium, Amp, HindIII / XhoI endonucleases, and other enzymes were purchased from Beijing Biode Biotechnology Co., Ltd.

[0184] 1.3 Vectors and strains

[0185] pET28a, pABAi, pGADT7, pGBKT7, pCAMBIA1300-35S-GFP, pGreenII62-SK, and pGreenII0800-LUC vectors were purchased from Wuhan Biotransduction Laboratory Co., Ltd. Transetta (DE3) competent cells and Trans T1 competent cells were purchased from Beijing Quanshijin Technology Co., Ltd. Yeast Y1H Gold, Yeast Y2H Gold competent cells, and Agrobacterium EHA105 competent cells were purchased from Wuhan Biotransduction Laboratory Co., Ltd.

[0186] 1.4 Experimental Instruments

[0187] Table 3 Experimental instruments

[0188]

[0189]

[0190] 1.5 Data processing software

[0191] The software used for data processing are: GraphpadPrism 8, Microsoft Excel Software 2021, SPSS21.0. The data are presented in the form of It indicates that the ANOVA method was used for single-factor test. When P < 0.05, it was considered that there was a significant difference, and when P < 0.01, it was considered that there was an extremely significant difference.

[0192] 2. Amplification of PnAAE1 and PnBAHD1 Promoters and Analysis of Cis-acting Elements

[0193] 2.1 DNA extraction

[0194] The roots of Panax notoginseng were ground in liquid nitrogen, and then total DNA was extracted using the Novozymes Plant DNA Extraction Kit (DC104). Figure 15 Agarose gel electrophoresis analysis showed that a high-brightness DNA main band appeared in the area adjacent to the sample well, and no obvious degradation diffuse bands were observed, indicating that the genomic DNA was in good integrity. Nucleic acid quantification and purity analysis (NanoDrop One system) showed that the DNA concentration ranged from 35.8 to 105.5 ng·μL-1, and A 260 / A 280 The absorbance ratio values ​​ranged from 1.7 to 2.0, confirming that the purity of the genomic DNA met the standards of molecular biology experiments (protein / organic contamination was controllable).

[0195] 2.2 PnAAE1 and PnBAHD1 promoter cloning

[0196] Specific primers were designed based on the PnAAE1 and PnBAHD1 promoter sequences (see Table 4), and amplification was performed using Panax notoginseng DNA as the template. The reaction system and procedures are shown in Tables 5 and 6, respectively. When amplifying the PnAAE1 promoter, an annealing temperature of 55.9°C was used, and when amplifying the PnBAHD1 promoter, an annealing temperature of 52.0°C was used.

[0197] Table 4 Primer sequences required for amplification of PnAAE1 promoter and PnBAHD1 promoter

[0198]

[0199] Table 5 PCR reaction system (50 μL)

[0200]

[0201] Table 6 PCR reaction program

[0202]

[0203] Figure 16 Agarose gel electrophoresis analysis showed that the PnAAE1 and PnBAHD1 promoters had obvious electrophoretic bands.

[0204] The amplified PnAAE1 promoter (PnAAE1-Promoter) was 848 bp long (SEQ ID No. 22), and the PnBAHD1 promoter (PnBAHD1-Promoter) was 1698 bp long (SEQ ID No. 23). The PCR products were purified and constructed into the pMD19-T vector. Positive clones were selected for colony PCR. The correctly sequenced plasmids were the pMD19-T-PnAAE1-Promoter and pMD19-T-PnAAE1-Promoter-T recombinant plasmids.

[0205] PnAAE1 promoter sequence (5'-3'):

[0206] TCTCTTTCTAAATTTTGTATCCCTCTCTCTAAAACTTTTATAACACAATCTCTTTATTTATTTTTTTACTATATTCGATTGAAATTTAAATTTTTTATGTATTTGACAAGAATGAATCGCAAGCAGTGTTTTACCTCTCTAAAATTTACCAGTCCCTGTAGGGTTGTGTGTTGCATTTATGTTTGATTTGGTATACTTAAGTATGTATTAAATGACATTGAACAACATGCATGCATAATGTATCAACCCAACAGCCTCCATATATTTTTATTTTCTCTGTCAACGACAATAATAAAAGAAGGAAGTAGTTAGTATGAAATTTATTTTTGGATAAATTGGTCAATTAATCAATAGAATATATAAATAAAATTCTATATATGTTAATATTCTATTAATTAATTGACTAATTTACCAAAAAATAATTTTCATACTTATTGGATGTATAAAAGAGGTATACTGCTGAGCTGACGTCTCAACACATTGAAAGGTGGAGGAAGGAAGGGAGAAAAAAACAGAAAGTCGAGGAGAAAGAGGAGGGAGGCACACTTCCCCTCATCTTCAAACTTTTCTTAATTTGCCACGTGCTTAACCTCCCCCAAATCTCGCCTTCCTTCCCAATCCACCCGCCCAGCCCAACCCAACCCAAGCCAACCCAACCCAAATCCATCTTTATTTTCATTCATTACGATTCAGCCCGCCACGTCTATATCTATATTTATATCTATATATATAAAACCACTTATTCCTATATGCTCCGTATCTGCATCGTTTCTTTATTGTCTATTTTTTTAGTCTAAATTATCTTGTGTTCTTAATCGGCTCGGAATTCCATATACTTCTAACGAGAA。

[0207] PnBAHD1 promoter sequence (5'-3'):

[0208]

[0209] 2.3 Analysis of cis-acting elements in the PnAAE1 and PnBAHD1 promoters

[0210] The binding sites on the PnAAE1 and PnBAHD1 promoters were predicted using the PlantCare online website, and the results are shown in Tables 7 and 8.

[0211] Table 7 Prediction of PnAAE1 promoter binding sites

[0212]

[0213] Table 8 Prediction of PnBAHD1 promoter binding sites

[0214]

[0215] It can be seen that the PnAAE1 promoter has binding sites for MYB transcription factors, W-box transcription factors, and STRE transcription factors, while the PnBAHD1 promoter has binding sites for MYB transcription factors, STRE transcription factors, W-box, and MYC transcription factors. The sequences on the PnAAE1 and PnBAHD1 promoters contain one and two MYB transcription factor binding sites, respectively. Therefore, further research is needed to investigate the binding of PnMYB8 to the PnAAE1 and PnBAHD1 promoters.

[0216] 3. Yeast one-hybrid assay analysis of PnMYB8 binding to PnAAE1 and PnBAHD1 promoters

[0217] 3.1 Construction of bait vectors expressing PnAAE1 and PnBAHD1 promoters

[0218] The PnAAE1-Promoter-F2 / R2 and PnBAHD1-Promoter-F2 / R2 primer combinations (see Table 9) were used to perform high-fidelity PCR amplification of the PnAAE1 and PnBAHD1 promoter regions, respectively.

[0219] Table 9 Primer sequences for yeast one-hybrid bait vector construction

[0220]

[0221] The target PCR product and the pABAi vector were digested with the HindIII / Xho I restriction endonuclease system (20 U / μL) at 37°C for 1 hour to establish a PnAAE1 promoter directional cloning and ligation system, constructing the pABAi-PnAAE1-Promoter recombinant vector. The PnBAHD1 promoter amplification product and the pABAi vector were simultaneously treated with the Sac I / Kpn I double enzyme digestion system (20 U / μL) and digested at 37°C for 1 hour before ligation. Colony PCR was performed using universal primers for the pABAi vector.

[0222] pABAi vector universal primers (5'-3') include:

[0223] pABAI-F: CAATCTAAGTC TGTGCTCCT (SEQ ID No. 28);

[0224] pABAI-R: CCATCTCGAAAAAGGGTTTGCC (SEQ ID No. 29).

[0225] Colony PCR verification of pABAi-PnAAE1-Promoter and pABAi-PnBAHD1-Promoter recombinant plasmids can be found in Figure 17 It can be seen that bright bands appear at around 1000 bp for pABAi-PnAAE1-Promoter and around 1800 bp for pABAi-PnBAHD1-Promoter. After gel excision and recovery, sequencing shows that the promoter sequences of PnAAE1 and PnBAHD1 are correct and can be used for subsequent experiments.

[0226] 3.2 Construction of bait strains

[0227] Referring to the enzyme digestion reaction system in Table 10, recombinant plasmids pABAi-PnAAE1-Promoter and pABAi-PnBAHD1-Promoter were linearized using BstBI endonuclease. Plasmid samples were placed in a thermostatic metal bath and subjected to a 15-minute thermostabilization treatment under strict temperature control (65.0 ± 0.5°C) to achieve specific DNA double-strand breaks and obtain linearized vector products.

[0228] Table 10 Linearization reaction system (50 μL)

[0229]

[0230] The linearized recombinant vector (pABAi-PnAAE1-Promoter / pABAi-PnBAHD1-Promoter) was gel-recovered and subsequently introduced into Y1H Gold yeast one-hybrid competent cells via LiAc / ssDNA / PEG chemical transformation. Colony PCR amplification was used to verify the integration of the recombinant vector into the yeast system. Amplification with specific primers revealed that positive clones successfully harbored the PnAAE1 / PnBAHD1 promoter-vector complex, allowing the identification of a bait strain library that met the genetic screening criteria.

[0231] 3.3 Screening of the minimum AbA inhibitory concentration of bait strains

[0232] In the yeast one-hybrid system, a specific DNA sequence (such as the promoter region of a gene) is usually fused to a reporter gene. lacZ is one of the most common reporter genes. The expression or non-expression of the lacZ reporter gene can be used as a marker to detect whether the protein interacts with the DNA. When the target DNA sequence interacts with the transcription activator, the transcription and expression of the reporter gene are initiated. AbA (Aureobasidin A) is an antibiotic that is toxic to yeast cells. In the yeast one-hybrid system, a gene related to AbA resistance is also used together with the reporter gene, which serves as a screening marker. If a specific interaction between the target protein and DNA occurs in the yeast cell, activating the expression of the reporter gene, the screening marker gene related to the reporter gene may also be activated and expressed, making the yeast cell resistant to AbA.

[0233] Therefore, in this example, the pABAi-PnAAE1-Promoter and pABAi-PnBAHD1-Promoter recombinant yeast suspensions were first diluted with physiological saline (0.9% NaCl, w / v) and calibrated to OD 600 =0.002 (±0.0005) standardized cell concentration; then accurately pipette 100 μL of homogenized bacterial suspension and inoculate it into a series of AbA concentrations (100-600 ng·mL -1 After culturing at 30°C for 48 to 72 hours, the minimum inhibitory concentration (MIC) was determined by colony forming units (CFU) and the antibiotic sensitivity profile of the bait strain was established.

[0234] from Figure 18 As can be seen from the figure, both PnAAE1 and PnBAHD1 promoters can grow normally on the normal SD / -Ura nutrient-deficient medium. With the increase of AbA concentration, the growth ability of PnAAE1 and PnBAHD1 promoters gradually weakened. Finally, when the AbA concentration reached 600 ng·mL-1 The growth of the PnAAE1 promoter bait strain was inhibited when the AbA concentration reached 200 ng·mL -1 Therefore, in the subsequent yeast one-hybrid experiment, we used SD / -Ura (600 ng·mL -1 ) and SD / -Ura (200 ng·mL -1 ) culture medium was used for research. 3.4 Construction of PnMYB8 prey vector

[0235] The primer pair (5′-3′) based on the Kpn I / BamH I restriction site modification (PnMYB8-pGADT7-F: CGGGGTACCA TGGATGTAGTTAAAGGTGAAGCTG, SEQ ID No. 30; PnMYB8-pGADT7-R: CGCG GATCC The full-length coding sequence of the PnMYB8 gene was amplified by high-fidelity PCR (SEQ ID No. 31). The purified PCR product and the pGADT7 prey vector were simultaneously digested (37°C / 1 hour) with the restriction endonuclease system (Kpn I (10 U / μL) and BamH I (15 U / μL) to construct the pGADT7-PnMYB8 recombinant vector. After ligation transformation, positive clone screening, and plasmid extraction, the sequence-verified recombinant plasmid pGADT7-PnMYB8 was obtained.

[0236] Colony PCR was performed using universal primers (5'-3') of the pGADT7 vector (pGADT7-F: TAATACGACTCACTAT AGGG, SEQ ID No. 32; pGADT7-R: CGATGCACAGTTGAAGTGAA, SEQ ID No. 33).

[0237] from Figure 19 It can be seen from the results that the target band appears at around 1000bp. After sequencing and alignment with the PnMYB8 gene sequence, subsequent experiments were carried out.

[0238] 3.5 Transformation of prey vector into competent cells of bait strain

[0239] Take the pABAi-PnAAE1-Promoter / pABAi-PnBAHD1-Promoter bait strain frozen at -80℃, streak it on the surface of YPDA solid medium for activation, and culture it at 30℃ for 48-72 hours. Pick a typical single colony and inoculate it into 5mL YPDA liquid medium, and culture it at 30℃ with shaking until the logarithmic growth phase (OD 600=0.6-0.8). Bacteria were enriched by centrifugation at 3000×g for 5 min at room temperature (25°C), and the pellet was gently resuspended in 10 mL of TE / LiAc buffer (pH 7.5). After a second centrifugation (3000×g / 10 min) with the same parameters, the bacterial pellet was resuspended in 1 mL of TE / LiAc solution and aliquoted into 100 μL tubes for later use. The prey vector (pGADT7-PnMYB8) and control plasmid were introduced into competent cells of the bait strain using chemical transformation. Positive transformants were obtained by colony PCR, confirming the successful integration of PnMYB8 into the pABAi-PnAAE1-Promoter / pABAi-PnBAHD1-Promoter system. Five μL of the positive bacterial culture was inoculated onto SD / -Leu genetic selection marker medium containing the minimum AbA inhibitory concentration. After constant incubation at 30°C for 48-72 hours, the strength of the promoter-transcription factor interaction was assessed by colony growth density.

[0240] from Figure 20 As can be seen, pGADT7+pABAi-PnAAE1-Promoter and pGADT7+pABAi-PnBAHD1-Promoter can grow normally in SD / -Leu medium. -1 AbA and 200 ng·mL -1 pGADT7-PnMYB8+pABAi-PnAAE1-Promoter and pGADT7-PnMYB8+pABAi-PnBAHD1-Promoter can grow normally on SD / -Leu medium. pGADT7-PnMYB8+pABAi-PnAAE1-Promoter can grow normally on SD / -Leu medium. -1 It can still grow normally on AbA medium. pGADT7-PnMYB8+pABAi-PnBAHD1-Promoter can grow normally at 200 ng·mL -1 The above results indicate that PnMYB8 can bind to the promoters of PnAAE1 and PnBAHD1.

[0241] 4 Dual luciferase system analysis verifies that PnMYB8 activates transcription of PnAAE1 and PnBAHD1 promoters

[0242] 4.1 Construction of dual-luciferase vectors expressing PnMYB8, PnAAE1, and PnBAHD1 promoters and transformation of Agrobacterium

[0243] The PnMYB8 gene ORF region was amplified with high fidelity using a BamHI / PstI site-specific primer pair (PnMYB8-pGreenII62-SK-F / R, see Table 11). The purified product and the pGreenII62-SK vector were co-treated with the BamHI (15 U / μL) and PstI (10 U / μL) restriction enzyme systems (37°C / 1 hour) to construct the recombinant plasmid pGreenII62-SK-PnMYB8. The recombinant plasmid was verified by sequencing. The promoter sequence was amplified using a PstI / NotI modified primer pair (PnAAE1-Promoter-F3 / R3, see Table 11). The promoter sequence was then digested with the pGreen0800-LUC reporter vector using PstI (10 U / μL) and NotI (12 U / μL) enzymes (37°C / 1 hour). The recombinant vector pGreen0800-LUC-PnAAE1-Promoter was constructed using a directional ligation. Based on the HindIII / PstI site primers (PnBAHD1-Promoter-F3 / R3, see Table 11), the product was amplified and digested with the pGreen0800-LUC vector by HindIII (15U / μL) and Pst I (10U / μL). The pGreen0800-LUC-PnBAHD1-Promoter recombinant plasmid was assembled according to the standard process. All recombinant vectors were obtained by ligation transformation → positive screening → plasmid extraction. Colony PCR primers were used with pGreenII62-SK vector universal primers (62SK-F / 62SK-R, see Table 11) and pGreen0800-LUC (0800LUC-F / 0800LUC-R, see Table 11) vector universal primers. Positive clones were verified by Sanger sequencing to verify the correctness of the inserted sequence (see Figure 21 ).

[0244] Table 11 Primer sequences and colony PCR sequences of dual luciferase vector

[0245]

[0246] Mix 1-2 μg of recombinant plasmid (pGreenII62-SK-PnMYB8, pGreen0800-LUC-PnAAE1-Promoter, or pGreen0800-LUC-PnBAHD1-Promoter) with 100 μL of EHA105 (pSOUP) competent Agrobacterium suspension and equilibrate on ice for 5 minutes. Perform the following steps: quick-freeze in liquid nitrogen for 5 minutes, heat shock in a 37°C water bath for 5 minutes, and renature on ice for 5 minutes to achieve cell membrane permeability. Add 1 mL of LB liquid medium (pH 7.0) and incubate at 28°C with shaking (200 rpm) for 4 hours to promote plasmid replication and expression. Centrifuge at 4000 × g for 30 seconds to collect cells, spread evenly on LB agar plates containing the appropriate antibiotic, and incubate inverted at 28°C for 48-72 hours. The successful transformation of the target vector (pGreenII62-SK / pGreen0800-LUC) into the EHA105 (pSOUP) Agrobacterium genome was verified by colony PCR amplification (specific primers are shown in Table 11).

[0247] 4.2 Dual luciferase reporter system analysis of PnMYB8-enhanced transcriptional activity of PnAAE1 and PnBAHD1 promoters

[0248] (1) Strain recovery and amplification

[0249] Take pGreenII62-SK-PnMYB8, pGreen0800-LUC-PnAAE1-Promoter, pGreen0800-LUC-PnBAHD1-Promoter and pGD-p19 auxiliary plasmid engineering bacteria frozen at -80℃, thaw on ice and streak to isolate single colonies. Pick a typical colony and inoculate it into 5mL LB liquid medium, shake culture at 28℃ (200rpm) until the logarithmic growth phase (OD 600 =0.6~0.8).

[0250] (2) Optimization of co-infection system

[0251] According to the OD of transcription factor: promoter: helper plasmid = 0.5:0.5:0.3 600 Mix the bacterial suspension in a suitable proportion, centrifuge at 5000 rpm for 10 minutes to enrich the cells, gently resuspend in 10 mL of Agrobacterium resuspension buffer (10 mM MES pH 5.6, 10 mM MgCl2, 150 μM AS), and incubate at 28°C for 4 hours for activation. Select healthy tobacco plants, 4-8 weeks old, for leaf injection.

[0252] (3) Dual luciferase activity assay

[0253] 48 hours after injection, six leaf discs of uniform diameter (Φ = 1 cm) were collected and vortexed with 100 μL of 1× PLB lysis buffer. The samples were snap-frozen in liquid nitrogen and then crushed using a tissue grinder. The samples were incubated in a 25°C water bath for 30 minutes, centrifuged at 12,000 rpm for 1 minute, and the supernatant was collected as the test sample (90 μL / well).

[0254] (4) Fluorescence signal detection

[0255] Promega Dual-Luciferase Reporter Assay System (Cat. E1910) was used for detection.

[0256] Firefly luciferase (LUC) assay: Add 40 μL of Luciferase Assay Buffer II to each well, mix well, incubate at room temperature in the dark for 10 min, and measure fluorescence intensity at a wavelength of 560 nm.

[0257] Renilla luciferase (REN) assay: Add 40 μL Stop&Glo Reagent to terminate the reaction. After incubation under the same conditions, measure the background signal at 480 nm.

[0258] The relative luciferase activity was calculated by the LUC / REN signal ratio.

[0259] from Figure 22 The results show that PnMYB8 can significantly increase the transcriptional activity of PnAAE1 and PnBAHD1 promoters. Among them, the activity of PnAAE1 promoter is 2.38 times higher than that of CK, and the activity of PnBAHD1 promoter is 2.09 times higher than that of CK.

[0260] 5 Gel shift assay analysis of the binding of PnMYB8 to the promoters of PnAAE1 and PnBAHD1

[0261] 5.1 Preparation of biotin-labeled probes containing MYB binding site sequences

[0262] Prepare a 20 μL biotin end-labeling reaction system (containing 10 μM single-stranded DNA, TdT enzyme, and Biotin-11-dUTP) according to Table 12. Vortex to mix thoroughly, incubate at 37°C for 30 min, and then add 5 μL of probe labeling stop solution to terminate the modification reaction. Add 52.5 μL of a chloroform-isoamyl alcohol (24:1, v / v) mixture and vortex to extract unincorporated dNTPs and free enzyme. Centrifuge at 12,000 rpm for 2 min, then collect the aqueous phase to obtain the biotin-labeled single-stranded DNA probe. Prepare equimolar concentrations of sense and antisense labeled probes in 10× Annealing Buffer according to Table 13. Denature at 95°C for 5 min, then cool gradually to 25°C (0.1°C / s) (see Table 14 for the annealing reaction schedule). Quickly cool in an ice bath to obtain the double-stranded DNA probe complex and store at -20°C until needed.

[0263] Table 12 PnAAE1, PnBAHD1 promoter probe sequences

[0264]

[0265]

[0266] Table 13 Probe labeling reaction system (50 μL)

[0267]

[0268] Table 14 Annealing reaction program

[0269]

[0270] 5.2 Construction of prokaryotic expression vector and transformation of expression strain

[0271] The PnMYB8 gene open reading frame was amplified by high-fidelity PCR using a BamHI / SalHI restriction site-modified primer pair (PnMYB8-pET28a-F: CGCGGATCCATGGATGTAGTTAAAGGTG, SEQ ID No. 64; PnMYB8-pET28a-R: ACGCGTCGACCTAAATATTGTTGCTGAATTGC, SEQ ID No. 65). The purified product and the pET28a expression vector were simultaneously digested with the BamHI (15 U / μL) and SalHI (10 U / μL) restriction enzyme systems at 37°C for 1 hour. The recombinant vector was ligated, transformed, and verified for accuracy by colony PCR and sequencing. Colony PCR was performed using universal primers for the pET28a vector (pET28A-F: TAATACGACTCACTATAGGG, SEQ ID No. 66; pET28A-R: GCTAGTTATTG CTCAGCGG, SEQ ID No. 67). The correctness of the recombinant expression vector pET28a-PnMYB8 was verified by sequencing.

[0272] from Figure 23 It can be seen from the results that there is a single band at the expected band position of PnMYB8, and the sequence is correct after sequencing verification, indicating that the constructed vector can be used for subsequent experiments.

[0273] 5.3 Analysis of prokaryotic expression of PnMYB8 protein

[0274] The constructed pET28a-PnMYB8 recombinant plasmid was transformed into Transetta (DE3) competent E. coli. After purification according to the protein purification method, the prokaryotic expression of PnMYB8 protein was detected by SDS-PAGE. The predicted size of PnMYB8 protein is 38KDa. When fused to the pET28a vector, 6 His proteins were added. After purification by His column (nickel column), the protein size was about 44KDa. Figure 24 As can be seen from the figure, there is a main protein band at about 44KDa, so it is judged that the PnMYB8 protein is successfully expressed and can be used for subsequent experiments.

[0275] 5.4 Gel shift assay (EMSA) to study the binding of PnMYB8 to the PnAAE1 and PnBAHD1 promoters

[0276] Gel shift assays for PnMYB8 and PnAAE1 and PnBAHD1 promoter probes were performed using the Beyotime Chemiluminescent EMSA Kit (GS009). A 40% native polyacrylamide gel (acrylamide:methylene = 39:1) was prepared according to Table 15 and poured into a vertical electrophoresis mold (10×10 cm). Polymerization was performed for 30 min at room temperature. A 20 μL binding system was constructed according to Tables 16 and 17: a 100× molar excess of unlabeled competitor probe was added, preincubated at 25°C for 10 min, 20 fmol of biotin-labeled probe was added, and binding was allowed to proceed for 20 min at room temperature (25°C). Binding was terminated by adding 2 μL of 10× EMSA Loading Buffer. Electrophoresis was performed at 100 V for 30 min (controlled in a 4°C ice-water bath) using 0.5× TBE buffer. After sample loading, electrophoresis was performed at 80 V for 90 min (bromophenol blue migrated to the lower quarter of the gel). Transfer, blocking, HRP labeling, washing, and equilibration were then performed. Finally, the stripping method was used to observe the strip conditions.

[0277] Table 15 40% polyacrylamide gel formula (10 mL)

[0278]

[0279] Table 16 EMSA negative, sample and mutation probe reaction system (10 μL)

[0280]

[0281] Table 17 EMSA cold probe competition reaction system (10 μL)

[0282]

[0283] from Figure 25 It can be seen that PnMYB8 binds to the CAACAG site on the PnAAE1 promoter; Figure 26 It can be seen that PnMYB8 binds to the TGGTTA and CAGTTA sites of the PnBAHD1 promoter.

[0284] 6. Chromatin immunoprecipitation experiments

[0285] The pCAMBIA1300-35S-3XFlag and pCAMBIA1300-35S-3XFlag-PnMYB8 recombinant plasmids were transformed into Agrobacterium tumefaciens EHA105 competent cells, cultured in bacterial liquid, and the cells were suspended and infected with Panax notoginseng leaves. After transient overexpression for 3 days, the Panax notoginseng leaves were collected and the expression was detected by EpiQuik TM The Plant Microarray Kit (P-2014) was used to perform chromatin immunoprecipitation (ChIP) assays to analyze the interaction between target proteins and DNA.

[0286] The experimental process mainly includes: (1) Antibody immobilization: 3XFlag antibody is coated on the chip plate, incubated with CP2 buffer and then washed; (2) Sample processing: 1g of Panax notoginseng leaves are cross-linked with formaldehyde and then vacuum infiltrated; (3) Chromatin preparation: After glycine termination of cross-linking, cell nuclei are obtained by liquid nitrogen grinding and gradient centrifugation; (4) DNA fragmentation: After ultrasonic fragmentation, chromatin supernatant is obtained by centrifugation; (5) Immunoprecipitation: After antibody incubation, CP1 and TE buffer are washed; (6) DNA purification: After proteinase K cross-linking is removed, CP6 buffer is used for treatment, and the target DNA is washed with ethanol gradient and eluted with CP8 buffer. All key steps are completed at 4°C, and the incubation time and centrifugation parameters are strictly controlled. This experiment provides a reliable technical platform for subsequent analysis of protein-DNA interactions.

[0287] Design specific primers (5'-3') based on the PnAAE1 promoter binding site CAACAG:

[0288] PnAAE1-ChIP-RT-F: 5'-GTTGTTGCATTTATGTTTGATTTGG-3' (SEQ ID No. 68);

[0289] PnAAE1-ChIP-RT-R: 5'-CCTCTTTTATTATT GTCGTTGACAG-3' (SEQ ID No. 69);

[0290] Design specific primers (5'-3') based on the binding site TGGTTA of the PnBAHD1 promoter:

[0291] PnBAHD1-ChIP1-RT-F: 5'-TCGCCAACCTGAATGAGT-3' (SEQ ID No. 70);

[0292] PnBAHD1-ChIP1-RT-R: 5'-CA AACCTTGGGCTTAGGG-3' (SEQ ID No. 71);

[0293] Design specific primers (5'-3') based on the binding site CAGTTA of the PnBAHD1 promoter:

[0294] PnBAHD1-ChIP2-RT-F:5'-CTATGTTCTTTTTGTGCTATTG-3' (SEQ ID No. 72);

[0295] PnBAHD1-ChIP2-RT-R: 5'-GAATTAATACTAATACTAATGGCATG-3' (SEQ ID No. 73).

[0296] Then, the real-time fluorescence quantitative PCR (RT-qPCR) experiment was performed using the following procedure.

[0297] Table 18 RT-qPCR reaction system

[0298]

[0299] Table 19 RT-qPCR reaction procedure

[0300]

[0301] Figure 27 The CHIP-qPCR results showed that PnMYB8 can increase the activity of the CAACAG binding site of the PnAAE1 promoter by about 3.4 times, and also increase the activity of the TGGTTA and CAGTTA binding sites of PnBAHD1 by about 2.1 times and 2.4 times, respectively. This indicates that PnMYB8 can significantly promote the activity of the PnAAE1 and PnBAHD1 promoters.

Claims

1. PnMYB8 The application of transcription factors in regulating the biosynthesis of notoginseng is characterized in that: PnMYB8 The nucleotide sequence of the transcription factor is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that It includes the biosynthesis of notoginseng in the roots, stems or leaves of plants that spontaneously synthesize notoginseng.

3. The use according to claim 1, characterized in that Including the use of PnMYB8 The expression promoter promotes the biosynthesis of notoginseng.

4. The use according to claim 3, characterized in that The PnMYB8 The expression promoter includes Agrobacterium containing a PnMYB gene overexpression vector; The applications include PnMYB8 The expression promoter is injected into the roots, stems or leaves of the notoginseng synthesis plant.

5. The use according to claim 1, characterized in that Including the use of PnMYB8 Silencing agents inhibit the biosynthesis of notoginseng.

6. The use according to claim 5, characterized in that The PnMYB8 The silencing agent includes Agrobacterium containing the PnMYB gene silencing vector; The applications include PnMYB8 The silencing agent is injected into the roots, stems or leaves of plants that spontaneously synthesize notoginseng.

7. PnMYB8 The application of a transcription factor as an expression regulator of the key gene PnAAE1 for the biosynthesis of notoginseng is characterized in that: PnMYB8 The nucleotide sequence of the transcription factor is shown in SEQ ID No.

1.

8. The use according to claim 7, characterized in that Including the use of PnMYB8 The expression promoter up-regulated the expression of PnAAE1, a key gene in the biosynthesis of notoginseng; Alternatively, use PnMYB8 Silencing agents downregulated the expression of PnAAE1, a key gene in the biosynthesis of notoginseng.

9. PnMYB8 The application of a transcription factor as an expression regulator of the key gene PnBAHD1 for the biosynthesis of notoginseng is characterized in that: PnMYB8 The nucleotide sequence of the transcription factor is shown in SEQ ID No.

1.

10. The use according to claim 9, characterized in that Including the use of PnMYB8 The expression promoter up-regulated the expression of PnBAHD1, a key gene in the biosynthesis of notoginseng; Alternatively, use PnMYB8 Silencing agents downregulated the expression of PnBAHD1, a key gene in notoginseng biosynthesis.

Images