Method for fixing rice heterosis by using OsZFPP gene

By combining the endogenous zinc finger protein gene OsZFPP of rice with the MiMe strategy, an apomictic reproduction system with a high fruit set rate was constructed, which solved the problem of the difficulty in simultaneously optimizing the fruit set rate and cloning efficiency in the rice apomictic reproduction system and achieved the permanent fixation of rice hybrid vigor.

CN120608098AActive Publication Date: 2025-09-09SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1

Patent Information

Application Number
CN202511121649.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-09-09
Estimated Expiration
2045-08-12

AI Technical Summary

Technical Problem

The existing rice apomixis system has the problem of difficulty in simultaneously optimizing the fruit set rate and cloning efficiency, and the existing technology is difficult to meet commercial needs.

Method used

The endogenous zinc finger protein gene OsZFPP of rice is combined with the MiMe strategy. The expression of OsZFPP is driven by an egg cell-specific promoter, and the MiMe strategy is integrated (synchronously knocking down the PAIR1, OSD1, and REC8 genes to achieve the transition from meiosis to mitosis) to construct an apomixis system with a high fruit set rate.

Benefits of technology

The successful fixation of rice hybrid vigor and the realization of an apomixis system with high fruit set rate provide a new solution for fixing hybrid vigor through rice apomixis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608098A_ABST
    Figure CN120608098A_ABST
Patent Text Reader

Abstract

The invention relates to the field of plant breeding, and particularly provides a method for fixing rice heterosis by using an OsZFPP gene. The method comprises the following steps: firstly, constructing an OsZFPP1 gene or OsZFPP2 gene expression cassette driven by an OsECA1 promoter; then, an expression box of rice with three target points of OsPAIR1, OsREC8 and OsOSD1 being knocked out of CRISPR / Cas9 is constructed; integrating the expression cassette into the same vector to transform hybrid rice; screening three-gene homozygous mutation and OsZFPP positive plants, and identifying diploid cloned offspring through flow cytometry and genome sequencing. According to the method, the rice OsZFPP gene is combined with MiMe to provide a novel method for fixing the heterosis of the rice through apomixis, the heterosis of the rice can be successfully fixed through the method, an apomixis system with the high maturing rate can be obtained, and a novel solution is provided for fixing the heterosis of the rice through the apomixis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the fields of biotechnology and plant breeding, and relates to a method for fixing rice heterosis by utilizing the OsZFPP gene. Background Art

[0002] In the field of plant reproductive biology, apomixis, a reproductive mechanism that allows clonal reproduction through seeds without the fusion of male and female gametes, has long been a revolutionary research direction in agricultural breeding. For staple crops like rice, the core value of apomixis lies in its ability to permanently maintain heterosis. Traditional hybrid rice, which segregates traits due to genetic recombination in offspring, forces farmers to repurchase new seeds annually. Apomixis, on the other hand, enables "single-line" breeding, ensuring highly consistent genotypes in hybrid offspring, significantly reducing production costs and unleashing the potential for sustained heterosis.

[0003] However, current artificially constructed apomixis systems still have significant limitations, making it difficult to simultaneously optimize seed set and cloning efficiency. The first-generation Fix system, established in 2019, achieved clonal seed production in rice for the first time, but both seed set and cloning efficiency (<5%) were far below the application threshold. The optimized Fix2 system, developed in 2023, boosted seed set to 80.9%–86.1% (close to wild-type levels) by incorporating the endogenous gene OsBBM4 into the MiMe strategy (converting meiosis to mitosis), but cloning efficiency remained insufficient. The Fix3 system, reported in 2024, utilizes an egg-specific promoter to drive the OsWUS gene. While maintaining a normal seed set rate and a cloning efficiency of 21.7%, it still falls short of commercialization requirements.

[0004] Faced with these challenges, identifying highly efficient endogenous regulatory genes in rice has become an inevitable option for overcoming technical bottlenecks. Compared to exogenous genes, endogenous developmental factors (such as OsBBM4) possess natural compatibility and can maximize the maintenance of normal plant physiological conditions. Based on this, the present invention proposes a novel solution centered around the endogenous rice zinc finger protein gene OsZFPP (Oryza sativa Zinc Finger Protein Parthenogenesis). This gene belongs to a family of plant-specific developmental regulatory transcription factors, and previous studies have confirmed its critical role in rice endosperm development and cell differentiation. By precisely driving OsZFPP expression through an egg cell-specific promoter and integrating the MiMe strategy (simultaneously knocking down PAIR1, OSD1, and REC8 genes to achieve meiotic to mitotic transition), the present inventors successfully constructed an apomictic system with high seed set. This result provides a new technical path for the permanent maintenance of heterosis in rice and establishes a general paradigm for apomictic breeding in other crops. Summary of the Invention

[0005] The present invention primarily addresses the shortcomings of existing technologies by providing a method for fixing heterosis in rice using OsZFPP1 or OsZFPP2, members of the OsZFPP gene family. This method can achieve permanent fixation of heterosis in rice. To achieve this objective, the present invention comprises the following steps: Step 1: First, the OsECA1 promoter and the OsZFPP1 gene coding sequence or the OsZFPP2 gene coding sequence are connected to construct expression cassette A1 or expression cassette A2, respectively. The sequences of the OsECA1 promoter, the OsZFPP1 gene coding sequence, and the OsZFPP2 gene coding sequence are shown in SEQ ID NOs. 1-3; then, an expression cassette B for CRISPR / Cas9 knockout of three target sites of rice OsPAIR1, OsREC8, and OsOSD1 is constructed. The coding sequences of the three genes of OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NOs. 4-6; the target sequences of the three genes of OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NOs. 7-9; Step 2: Integrate the expression cassette A1 and the expression cassette B into the same expression vector to obtain expression cassette C1, integrate the expression cassette A2 and the expression cassette B into the same expression vector to obtain expression cassette C2, and transform the expression cassette C1 or expression cassette C2 into hybrid rice through Agrobacterium-mediated transformation to obtain T0 generation plants with the expression cassette C1 or expression cassette C2 integrated into their genome; Step 3: Screen T0 generation plants that have homozygous knockout of the three genes OsPAIR1, OsREC8, and OsOSD1, and successfully ectopically express the OsZFPP1 gene or the OsZFPP2 gene, and obtain seeds through self-pollination; Step 4: Germinate the seeds obtained by self-pollination in step 3, and use flow cytometry and genome sequencing technology to detect plants with homozygous knockout of the three genes OsPAIR1, OsREC8, and OsOSD1 to screen plants with fixed hybrid vigor.

[0006] Furthermore, in step 1, the specific method for obtaining the expression cassette A1 is as follows: 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene. PCR amplification was performed using rice genomic DNA as a template to obtain product 1-1. The sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NOs. 10-11. 2) Primers OsZFPP1-F and OsZFPP1-R were designed based on the coding region sequence of the OsZFPP1 gene. PCR amplification was performed using rice leaf cDNA as a template to obtain product 2-1. The sequences of OsZFPP1-F and OsZFPP1-R are shown in SEQ ID NOs. 12-13. 3) Homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R were designed for amplified product 1-1. Using amplified product 1-1 as a template, PCR amplification was performed to obtain amplified product 3-1. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NOs. 14-15. 4) Designing homologous recombination linker primers OsZFPP1-fusion-F and OsZFPP1-fusion-R for amplified product 2-1, and performing PCR amplification using amplified product 2-1 as a template to obtain amplified product 4-1; the sequences of OsZFPP1-fusion-F and OsZFPP1-fusion-R are shown in SEQ ID NOs. 16-17; 5) Using homologous recombination, the amplified products 3-1 and 4-1 were connected to the expression vector to obtain expression cassette A1.

[0007] Furthermore, in step 1, the specific method for obtaining the expression cassette A2 is as follows: 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene. PCR amplification was performed using rice genomic DNA as a template to obtain amplification products 1-2. The sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NOs. 10-11. 2) Primers OsZFPP2-F and OsZFPP2-R were designed based on the coding region sequence of the OsZFPP2 gene. PCR amplification was performed using rice leaf cDNA as a template to obtain product 2-2. The sequences of OsZFPP2-F and OsZFPP2-R are shown in SEQ ID NOs. 18-19. 3) Homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R were designed for amplified product 1-2. Using amplified product 1-2 as a template, PCR amplification was performed to obtain amplified product 3-2. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NOs. 14-15. 4) Designing homologous recombination linker primers OsZFPP2-fusion-F and OsZFPP2-fusion-R for amplified product 2-2, and performing PCR amplification using amplified product 2-2 as a template to obtain amplified product 4-2; the sequences of OsZFPP2-fusion-F and OsZFPP2-fusion-R are shown in SEQ ID NOs. 20-21; 5) Using homologous recombination, the amplified products 3-2 and 4-2 were ligated into the expression vector to obtain expression cassette A2.

[0008] Furthermore, in step 1, the specific method for obtaining the expression cassette B is as follows: 1) Design target sequences based on the coding region sequences of the three genes OsPAIR1, OsREC8, and OsOSD1; 2) Integrate the target sequence into the SK-gRNA vector to obtain three intermediate vectors SG1, SG2, and SG3; 3) Use enzyme ligation to connect the three intermediate vectors SG1, SG2, and SG3 to the backbone vector pC1300-Cas9 containing the CRISPR / Cas9 expression element to obtain expression cassette B.

[0009] Furthermore, in step 2, the expression cassette A1 and the expression cassette B are integrated into the same expression vector to obtain the expression cassette C1. The specific steps are as follows: 1) Expression cassette A1 was amplified using the primers OsECA1-PC-F and OsZFPP1-PC-R with adapters designed for expression cassette A1 to obtain amplification product 5-1; the sequences of OsECA1-PC-F and OsZFPP1-PC-R are shown in SEQ ID NOs. 22-23; 2) Cut the expression cassette B with restriction endonucleases Kpn I and Bam HI. 3) Expression cassette A1 and expression cassette B are constructed into an expression vector by homologous recombination to obtain expression cassette C1; 4) Genetic transformation was performed using Agrobacterium tumefaciens EHA105-mediated genetic transformation method, and the transformation background was the indica-japonica hybrid rice variety Chunyou 84.

[0010] Furthermore, in step 2, the expression cassette A2 and the expression cassette B are integrated into the same expression vector to obtain the expression cassette C2. The specific steps are as follows: 1) Expression cassette A2 was amplified using the primers OsECA1-PC-F and OsZFPP2-PC-R with adapters designed for expression cassette A2 to obtain amplification product 5-2; the sequences of OsECA1-PC-F and OsZFPP2-PC-R are shown in SEQ ID NO. 22 and SEQ ID NO. 24; 2) Cut the expression cassette B with restriction endonucleases Kpn I and Bam HI. 3) Expression cassette A2 and expression cassette B are constructed into an expression vector by homologous recombination to obtain expression cassette C2; 4) Genetic transformation was performed using Agrobacterium tumefaciens EHA105-mediated genetic transformation method, and the transformation background was the indica-japonica hybrid rice variety Chunyou 84.

[0011] Furthermore, in step 3, the screening of T0 generation plants in which the three genes OsPAIR1, OsREC8 and OsOSD1 are homozygous knocked out and the OsZFPP1 gene or the OsZFPP2 gene is successfully ectopically expressed is carried out in the following specific steps: 1) Based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1, Hi-TOM detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, and OSD1-Hi-F, OSD1-Hi-R were designed. T0 generation transgenic plants were amplified to screen for transgenic plants with homozygous mutations in all three genes. The sequences of PAIR1-Hi-F and PAIR1-Hi-R are shown in SEQ ID NOs. 25-26, the sequences of REC8-Hi-F and REC8-Hi-R are shown in SEQ ID NOs. 27-28, and the sequences of OSD1-Hi-F and OSD1-Hi-R are shown in SEQ ID NOs. 29-30. 2) HYG-F and HYG-R primers were designed based on the gene sequence of the hygromycin resistance gene, and the T0 generation transgenic plants were amplified. Positive transgenic plants that successfully amplified the expression cassette A were screened; the sequences of HYG-F and HYG-R are shown in SEQ ID NOs. 31-32.

[0012] Furthermore, in step 4, the plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 are homozygous knocked out are detected using flow cytometry and genome sequencing technology to screen plants with fixed heterosis. The specific steps are as follows: 1) Flow cytometry was used to measure the ploidy of the offspring of plants homozygous for knockout of all three genes: OsPAIR1, OsREC8, and OsOSD1. Plants with diploid ploidy were selected. 2) The diploid plants are tested using genome sequencing technology to select plants with fixed genotypes.

[0013] Beneficial effects of the present invention: Existing rice apomixis systems all have certain defects. The method of the present invention provides a new method for fixing rice heterosis through apomixis by combining the rice endogenous gene OsZFPP with MiMe. This method can successfully fix the heterosis of rice and obtain an apomixis system with a high fruit set rate, providing a new solution for fixing heterosis through rice apomixis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is the vector map; Figure 2 Positive detection for transgenic plants; Figure 3 To detect mutation types in transgenic plants; Figure 4 The data are the seed setting rate and cloning efficiency of transgenic plants; Figure 5 is the phenotype of transgenic T0 plants; Figure 6 screening for diploids for flow cytometry; Figure 7 for genome sequencing data; Figure 8 This is the phenotype diagram of the cloned plants. DETAILED DESCRIPTION

[0015] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0016] Example 1: Rice apomixis system composed of OsZFPP1 and MiMe system 1. Vector Construction 1.1 Construction of expression cassette A A rice egg cell-specific expression vector (expression cassette A) was constructed by ligating the OsECA1 promoter and the OsZFPP1 gene coding sequence into the expression vector pUB09. The sequences of the OsECA1 promoter and the OsZFPP1 gene coding sequence are shown in SEQ ID NOs. 1-2. The specific construction method is as follows: (1) The relevant sequences were cloned in rice. The primers are as follows: OsECA1pro-F (SEQ ID NO. 10): TATACATGGGAGTCTAGTGC; OsECA1pro-R (SEQ ID NO. 11): GGTTTTTCTTTCTAGCTTTG; OsZFPP1-F (SEQ ID NO.12): ATGAGTGGGTGTAGCTGGCT; OsZFPP1-R (SEQ ID NO. 13): CTATTCCTGTTTCTGGAGCCT.

[0017] The products were purified using a recovery kit to obtain amplified products 1 and 2, respectively.

[0018] (2) Add a homologous recombination linker to the two sequences. The primers are as follows: OsECA1pro-fusion-F (SEQ ID NO. 14): tctagccaatacgcgagctcaagctTATACATGGGAGTCTAGTGC; OsECA1pro-fusion-R (SEQ ID NO.15): ACCCACTCATGGTTTTTCTTTCTAG; OsZFPP1-fusion-F (SEQ ID NO. 16): AAGAAAAACCATGAGTGGGTGTAGC; OsZFPP1-fusion-R (SEQ ID NO. 17):gatcggggaaattcgagctggtcacCTATTCCTGTTCTGGAGCCT.

[0019] The products were purified using a recovery kit to obtain amplified products 3 and 4, respectively.

[0020] (3) Enzyme digestion of the backbone vector pUB09: COMPONENT 50 µl REACTION pUB09 1 µg 10X rCutSmart Buffer 5 µl (1X) HindIII-HF 20 units BamHI-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit.

[0021] (4) Using the multi-fragment homologous recombination kit (Novozyme C113), obtain expression cassette A: COMPONENT 20 µl REACTION pUB09 digested with enzymes (100 ng) Amplification product 3 20ng Amplification product 4 10ng 5 × CE MultiS Buffer 4 µl Exnase MultiS 2 µl Nuclease-free Water to 20 µl Incubate at 37°C for 30 min; then cool to 4°C or immediately place on ice.

[0022] (5) Transformation of recombinant products: Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto a plate containing the desired resistance. Incubate in an inverted position at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using the sequencing primer NOS-R (SEQ ID NO. 33): agtaacatagatgacaccgc.

[0023] 1.2 Construction of expression cassette B A vector (expression cassette B) for knocking out three endogenous genes, OsPAIR1, OsREC8, and OsOSD1, was constructed. The target sites of the three endogenous genes were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain expression cassette B. The specific construction method is as follows: (1) Target sequences were designed based on the coding region sequences of the three genes OsPAIR1, OsREC8, and OsOSD1. The primers are as follows: OsPAIR1++ (SEQ ID NO.34):GGCAAAGCAACCCAGTGCACCGC; OsPAIR1--(SEQ ID NO.35):AAACGCGGTGCACTGGGTTGCTT; OsREC8++ (SEQ ID NO.36):GGCACGGAGAGCCTTAGTGCCAT; OsREC8--(SEQ ID NO.37):AAACATGGCACTAAGGCTCTCCG; OsOSD1++ (SEQ ID NO.38):GGCACTGCCGCCGACGAGCAACA; OsOSD1--(SEQ ID NO. 39):AAACTGTTGCTCGTCGGCGGCAG.

[0024] (2) Enzyme digestion of the backbone vector SK-gRNA: COMPONENT 50 µl REACTION SK-gRNA 2 µg 10 x Buffer Aar I 5 µl Aar I 1 µl 50 x oligonucleotide 1 µl Nuclease-free Water to 50 µl The enzyme digestion was performed at 37°C for 5 h, and the product was purified using a recovery kit to obtain SK-gRNA.

[0025] (3) Primers anneal to form double strands The synthesized primers (g++ and g --) were diluted with water to a concentration of 100 μM. 20 μL each of g++ and --g were mixed together and incubated at 100°C for 5 minutes. After removal, the mixture was allowed to cool naturally at room temperature.

[0026] (4) Integrate the target sequence into the SK-gRNA vector to obtain three intermediate vectors SG1, SG2, and SG3: COMPONENT 10 µl REACTION SK-gRNA 30 ng 10 x T4 ligase Buffer 1 µl T4 ligase 0.5 µl 7 µl of primer annealing product Nuclease-free Water to 10 µl Ligate at 25°C for 1 hr to allow transformation.

[0027] (5) Transformation of recombinant products: Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto a plate containing the desired resistance. Incubate in an inverted position at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using primer T3: ATTAACCCTCACTAAAGGGA (SEQ ID NO. 40).

[0028] (6) Enzyme digestion of the three intermediate vectors SG1, SG2, and SG3: COMPONENT 50 µl REACTION SK1 1 µg 10X rCutSmart Buffer 5 µl (1X) KpnI-HF 20 units SalI-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SK1 fragment.

[0029] COMPONENT 50 µl REACTION SK2 1 µg 10X rCutSmart Buffer 5 µl (1X) XhoI-HF 20 units NheI-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SK2 fragment.

[0030] COMPONENT 50 µl REACTION SK3 1 µg 10X rCutSmart Buffer 5 µl (1X) XbaI-HF 20 units BglII-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SK3 fragment.

[0031] (7) Enzyme digestion of the vector backbone pC1300-Cas9: COMPONENT 50 µl REACTION pC1300-Cas9 1 µg 10X rCutSmart Buffer 5 µl (1X) KpnI-HF 20 units BamHI-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was performed at 37°C for 5 h, and the product was purified using a recovery kit to obtain pC1300-Cas9.

[0032] (8) Construction of expression cassette B: COMPONENT 10 µl REACTION pC1300-Cas9 cut 100 ng SK1 cut 8 ng SK2 cut 8 ng SK3 cut 8 ng 10 x T4 ligase Buffer 1 µl T4 ligase 0.5 µl Nuclease-free Water to 50 µl Ligate at 25°C for 1 hr to allow transformation.

[0033] (9) Transformation of recombinant products: Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto a plate containing the desired resistance. Incubate the tube inverted at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using the sequencing primer pC1300-F: acactttatgcttccggctc (SEQ ID NO. 41).

[0034] 1.3 Construction of expression cassette C The expression cassette A and the expression cassette B are integrated into the same expression vector to obtain the expression cassette C. The specific construction method is: (1) Expression cassette A was amplified using primers OsECA1-PC-F and OsZFPP1-PC-R with linkers designed for expression cassette A to obtain amplified product 5. The primers are as follows: OsECA1-PC-F (SEQ ID NO. 22): atatcctgtcaaacactgatagtttTATACATGGGAGTCT; OsZFPP1-PC-R (SEQ ID NO. 23): gattgtcgtttcccgccttcagtttcccgatctagtaaca.

[0035] (2) Enzyme digestion of expression cassette B: COMPONENT 50 µl REACTION Expression cassette B 1 µg 10X rCutSmart Buffer 5 µl (1X) KpnI-HF 20 units BamHI-HF 20 units Nuclease-free Water to 50 µl The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain the expression cassette B.

[0036] (3) Construction of expression cassette C: COMPONENT 20 µl REACTION Expression cassette B cut 100ng Amplification product 5 20ng 5 × CE MultiS Buffer 4 µl Exnase MultiS 2 µl Nuclease-free Water to 20 µl Incubate at 37°C for 30 min; then cool to 4°C or immediately place on ice.

[0037] (4) Transformation of recombinant products: Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto a plate containing the desired resistance. Incubate the tube inverted at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using the sequencing primer RB-R: cccttttaaatatccgttat (SEQ ID NO. 42).

[0038] 2. Genetic Transformation The cloned vector was sequenced correctly, and the next step was to transform the indica-japonica hybrid rice variety Chunyou 84 (CY84) using Agrobacterium tumefaciens strain EHA105-mediated genetic transformation to obtain transgenic material. The seeds were dehulled and disinfected with 75% ethanol for 1 minute. The ethanol was then discarded and disinfected with 2% sodium hypochlorite solution for 20 minutes, while being placed on a shaker. The sodium hypochlorite solution was discarded in a clean bench, and the seeds were rinsed 4-5 times with sterile water. The seeds were then placed on sterilized filter paper and dried. The seeds were then plated onto N6 mature embryo callus induction medium and cultured in the dark at 28°C for approximately one month. Embryonic calli in good condition were selected for subculture 2-3 times, and embryonic calli 3-5 days after the second subculture were selected for transformation.

[0039] Embryogenic calli are immersed in activated Agrobacterium tumefaciens EHA105 culture (containing acetosyringone) carrying the target plasmid for 30 minutes. The calli are then rinsed several times with sterile water, dried in a laminar flow hood, and incubated at 19°C for 2-3 days. The calli are then transferred to a selection medium supplemented with a selection marker antibiotic for selection. Each selection process lasts for 2 weeks, and after 2-3 rounds of selection, newly grown calli are obtained. The newly grown calli are then transferred to a predifferentiation medium and cultured for 7 days. Then, they are transferred to a differentiation medium and cultured at 25°C under a light intensity of 16 hours per day for approximately 10 days. Green spots appear, and regenerated plants are obtained. The roots of the differentiated transgenic seedlings are removed and placed on rooting medium for 2-3 weeks. The parafilm is then removed, and the seedlings are hardened with water for 1 week before being transplanted.

[0040] 3. Detection of mutation and ectopic expression in transgenic T0 plants The method for screening T0 generation plants with homozygous mutations in the three genes OsPAIR1, OsREC8 and OsOSD1 and positive transgenes is as follows: (1) Hi-TOM detection primers were designed based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1. The primer sequences are as follows: PAIR1-Hi-F (SEQ ID NO. 25): ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc; PAIR1-Hi-R (SEQ ID NO. 26): gagttggatgctgagtggggagatgtagtgcgtgggtcttg; REC8-Hi-F (SEQ ID NO. 27): ggagtgagtacggtgtgcttgggttagtgaggagat; REC8-Hi-R (SEQ ID NO. 28):gagttggatgctgagtggtgcgatcggaactatggagac; OSD1-Hi-F (SEQ ID NO. 29): ggagtgagtacggtgtgctatcaggaggacgacgtcgccg; OSD1-Hi-R (SEQ ID NO. 30):gagttggatgctgagtggctcctcctcttgggtgtagc.

[0041] The three pairs of primers were used to perform PCR amplification on T0 generation transgenic plants, and the mutation types of the three genes in all plants were detected using the Hi-TOM system to screen transgenic plants with homozygous mutations in all three genes.

[0042] (2) Design HYG-F and HYG-R primers based on the hygromycin gene sequence. The primer sequences are as follows: HYG-F (SEQ ID NO. 31): gaactcaccgcgacgtctgtcgag; HYG-R (SEQ ID NO. 32): gctgttatgcggccattgtccgtc.

[0043] The above primers were used to amplify the T0 generation transgenic plants that were detected as homozygous mutations in the three genes OsPAIR1, OsREC8 and OsOSD1 in (1) above, and positive transgenic plants that successfully amplified expression cassette A were screened. The positive triple-mutant plants were used as subsequent experimental materials.

[0044] 4. Plant ploidy and genotype identification: Flow cytometry and genome sequencing technologies were used to detect the progeny of T0 positive triple mutant materials and screen plants with fixed heterosis, specifically: (1) Flow cytometry was used to identify the ploidy of the offspring plants of the positive triple-mutant material. The specific experimental procedures were as follows: Cut fresh, 10-day-old rice leaves, 4-5 cm long, into a glass dish. Add 1 ml of Plant Lysis Buffer LB01 and mince the tissue quickly with a razor blade. Aspirate the lysate from the dish and filter through a 50 µm nylon mesh into a centrifuge tube. Label the tube cap with the sample. Centrifuge at 1,200 rpm for 5 minutes at 4°C in a benchtop refrigerated centrifuge. Gently remove the tube, slowly aspirate the supernatant, and add 450 µl of LB01, 25 µl of pre-chilled PI, and 25 µl of RNase A. Stain at 4°C in the dark for 10 minutes. Detect on a BD Accuri C6. If the cell is diploid, the peak should be consistent with that of the wild-type cell.

[0045] The specific reagent formula is: Lysis buffer LB01: Tris 363.4 mg, Na2EDTA 148.9 mg, Sperminetetrahydrochloride 34.8 mg, KCl 1.193 g, NaCl 233.8 mg, Triton X-100 200 µl. Dose to 200 mL. Adjust the pH to 7.5 with 1 M HCl. Add 220 µl of β-mercaptoethanol in a fume hood. Sterilize by filtration using a 0.22 µm filter in a laminar flow hood, aliquot, and store at -20°C.

[0046] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of powder and dissolve it in 50 mL of ddH2O. Sterilize the solution by filtration using a 0.22 μm filter in a clean bench and aliquot the solution. Store at -20°C.

[0047] RNase stock solution (1 mg / ml): Weigh 25 mg of RNase (IIA Sigma) and dissolve in 25 ml of ddH2O. Sterilize by filtration through a 0.22 µm filter in a laminar flow hood and aliquot. Heat at 90°C for 15 min to inactivate the DNase. Store at -20°C.

[0048] (2) Use genome sequencing technology to detect the genotype of diploid plants, specifically: For the diploid plants identified above, DNA was extracted and libraries were constructed. Paired-end sequencing was performed using the Illumina Hiseq2500 sequencing platform, with an average sequencing depth of 10-15x for each sample. The raw data was first filtered using NGSQCtoolkit v2.3.3. The filtered data was then aligned to the reference genome to obtain single-nucleotide polymorphism (SNP) data. Finally, the SNP data was aligned to the wild-type Chunyou 84 genome to determine the genotype of the diploid plants. If the diploid plant exhibits fixed heterosis, its genome would theoretically be a heterozygous genotype consistent with Chunyou 84.

[0049] 5. Test results: A total of 14 positive lines were obtained through genetic transformation ( Figure 2 ), using Hi-TOM detection technology, the mutation types of three genes PAIR1, REC8 and OSD1 in the MiMe system were detected. The results showed that these three genes in the three strains Apo-ZF1-6, Apo-ZF1-10 and Apo-ZF1-11 all had homozygous mutations ( Figure 3 The growth and development of these three strains were consistent with the wild type, and the fruit set rate was high (53.21-82.78%) ( Figure 4 , Figure 5 After the seeds matured, the seeds of the three strains were harvested and germinated for diploid identification. Flow cytometry was used to identify their ploidy, and it was found that all three strains had diploid offspring, with a cloning efficiency of 0.85-0.95% ( Figure 6 Subsequently, the diploid plant genotypes were tested using genome sequencing technology, and the results showed that all diploid genotypes were consistent with the Chunyou 84 genotype ( Figure 7 ), are all apomictic clones, and their growth and development are consistent with the wild type ( Figure 8 ).

[0050] Example 2: Rice apomixis system composed of OsZFPP2 and MiMe system 1. Vector Construction 1.1 Construction of expression cassette A A rice egg cell-specific expression vector for the OsZFPP2 gene (expression cassette A) was constructed by ligating the OsECA1 promoter and the OsZFPP2 gene coding sequence into the expression vector pUB09. The OsZFPP2 gene coding sequence is shown in SEQ ID NO. 3. The specific construction method is similar to that in Example 1. The relevant primers are as follows: OsECA1pro-F (SEQ ID NO. 10): TATACATGGGAGTCTAGTGC; OsECA1pro-R (SEQ ID NO. 11): GGTTTTTCTTTCTAGCTTTG; OsZFPP2-F (SEQ ID NO. 18): atggccggtcaggtgttcgt; OsZFPP2-R (SEQ ID NO. 19): ttaattcttaggctcctcat; OsECA1pro-fusion-F (SEQ ID NO. 14): tctagccaatacgcgagctcaagctTATACATGGGAGTCTAGTGC; OsECA1pro-fusion-R (SEQ ID NO.15): gaccggccatGGTTTTTCTTtctag; OsZFPP2-fusion-F (SEQ ID NO. 20): AAGAAAAACCatggccggtcaggtg; OsZFPP2-fusion-R (SEQ ID NO. 21):gatcggggaaattcgagctggtcacttaattcttaggctcctcat.

[0051] 1.2 Construction of expression cassette B A vector (expression cassette B) for knocking out three endogenous genes, OsPAIR1, OsREC8, and OsOSD1, was constructed. The target sites of the three endogenous genes were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain expression cassette B. The specific construction method is described in Example 1.

[0052] 1.3 Construction of expression cassette C The expression cassette A and the expression cassette B were integrated into the same expression vector to obtain the expression cassette C. The specific construction was referred to Example 1, and the relevant primers were as follows: OsECA1-PC-F (SEQ ID NO.22): atatcctgtcaaacactgatagtttTATACATGGGAGTCT OsZFPP2-PC-R (SEQ ID NO.24): gattgtcgtttcccgccttcagtttcccgatctagtaaca 2. Genetic Transformation The cloning vector was sequenced correctly, and the next step was to conduct Agrobacterium transformation experiments, using the genetic transformation method mediated by Agrobacterium EHA105 strain to transform the indica-japonica hybrid rice variety Chunyou 84 (CY84) to obtain transgenic material. The specific method is shown in Example 1.

[0053] 3. Detection of mutation and ectopic expression in transgenic T0 plants The method for screening T0 generation plants that are homozygous for mutations in the three genes OsPAIR1, OsREC8 and OsOSD1 and are transgenic positive is as described in Example 1.

[0054] 4. Plant ploidy and genotype identification: The offspring of the T0 positive triple mutant material were detected using flow cytometry and genome sequencing technology to screen plants with fixed heterosis. The specific method is shown in Example 1.

[0055] 5. Test results: A total of 15 positive strains were obtained through genetic transformation. Using Hi-TOM detection technology, the mutation types of the three genes PAIR1, REC8, and OSD1 in the MiMe system were detected. The results showed that homozygous mutations occurred in all three genes in the three strains Apo-ZF2-6, Apo-ZF2-9, and Apo-ZF2-13. The growth and development of these three strains were consistent with the wild type, with a fruit set rate of 54.08-77.98% ( Figure 4 After the seeds matured, the seeds of the three strains were harvested and germinated for diploid identification. Flow cytometry was used to identify their ploidy, and it was found that all three strains had diploid offspring, with a cloning efficiency of 1.05-1.52% ( Figure 4 Subsequently, genome sequencing technology was used to detect the genotypes of the diploid plants. The results showed that all diploid genotypes were consistent with the genotype of Chunyou 84, all of which were apomictic clones, and their growth and development were consistent with the wild type.

Claims

1. A method for fixing heterosis in rice using OsZFPP1 or OsZFPP2, a member of the OsZFPP gene family, characterized in that: The following steps are involved: Step 1: First, the OsECA1 promoter and the OsZFPP1 gene coding sequence or the OsZFPP2 gene coding sequence are connected to construct expression cassette A1 or expression cassette A2, respectively. The sequences of the OsECA1 promoter, the OsZFPP1 gene coding sequence, and the OsZFPP2 gene coding sequence are shown in SEQ ID NOs. 1-3; then, an expression cassette B for CRISPR / Cas9 knockout of three target sites of rice OsPAIR1, OsREC8, and OsOSD1 is constructed. The coding sequences of the three genes of OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NOs. 4-6; the target sequences of the three genes of OsPAIR1, OsREC8, and OsOSD1 are shown in SEQ ID NOs. 7-9; Step 2: Integrate the expression cassette A1 and the expression cassette B into the same expression vector to obtain expression cassette C1, integrate the expression cassette A2 and the expression cassette B into the same expression vector to obtain expression cassette C2, and transform the expression cassette C1 or expression cassette C2 into hybrid rice through Agrobacterium-mediated transformation to obtain T0 generation plants with the expression cassette C1 or expression cassette C2 integrated into their genome; Step 3: Screen T0 generation plants that have homozygous knockout of the three genes OsPAIR1, OsREC8, and OsOSD1, and successfully ectopically express the OsZFPP1 gene or the OsZFPP2 gene, and obtain seeds through self-pollination; Step 4: Germinate the seeds obtained by self-pollination in step 3, and use flow cytometry and genome sequencing technology to detect plants with homozygous knockout of the three genes OsPAIR1, OsREC8, and OsOSD1 to screen plants with fixed hybrid vigor.

2. The method according to claim 1, characterized in that In step 1, the specific method for obtaining the expression cassette A1 is as follows: 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene, and PCR amplification was performed using rice genomic DNA as a template to obtain product 1-1. The sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NOs. 10-11. 2) Primers OsZFPP1-F and OsZFPP1-R were designed based on the coding region sequence of the OsZFPP1 gene. PCR amplification was performed using rice leaf cDNA as a template to obtain product 2-1. The sequences of OsZFPP1-F and OsZFPP1-R are shown in SEQ ID NOs. 12-13. 3) Homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R were designed for amplified product 1-1. Using amplified product 1-1 as a template, PCR amplification was performed to obtain amplified product 3-1. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NOs. 14-15. 4) Designing homologous recombination linker primers OsZFPP1-fusion-F and OsZFPP1-fusion-R for amplified product 2-1, and performing PCR amplification using amplified product 2-1 as a template to obtain amplified product 4-1; the sequences of OsZFPP1-fusion-F and OsZFPP1-fusion-R are shown in SEQ ID NOs. 16-17; 5) Using homologous recombination, the amplified products 3-1 and 4-1 were ligated into the expression vector to obtain expression cassette A1.

3. The method according to claim 1, characterized in that In step 1, the specific method for obtaining the expression cassette A2 is as follows: 1) Primers OsECA1pro-F and OsECA1pro-R were designed based on the promoter sequence of the OsECA1 gene, and PCR amplification was performed using rice genomic DNA as a template to obtain amplification products 1-2; the sequences of OsECA1pro-F and OsECA1pro-R are shown in SEQ ID NOs. 10-11; 2) Primers OsZFPP2-F and OsZFPP2-R were designed based on the coding region sequence of the OsZFPP2 gene. PCR amplification was performed using rice leaf cDNA as a template to obtain product 2-2. The sequences of OsZFPP2-F and OsZFPP2-R are shown in SEQ ID NOs. 18-19. 3) Homologous recombination adapter primers OsECA1pro-fusion-F and OsECA1pro-fusion-R were designed for amplified product 1-2. Using amplified product 1-2 as a template, PCR amplification was performed to obtain amplified product 3-2. The sequences of OsECA1pro-fusion-F and OsECA1pro-fusion-R are shown in SEQ ID NOs. 14-15. 4) Designing homologous recombination linker primers OsZFPP2-fusion-F and OsZFPP2-fusion-R for amplified product 2-2, and performing PCR amplification using amplified product 2-2 as a template to obtain amplified product 4-2; the sequences of OsZFPP2-fusion-F and OsZFPP2-fusion-R are shown in SEQ ID NOs. 20-21; 5) Using homologous recombination, the amplified products 3-2 and 4-2 were ligated into the expression vector to obtain expression cassette A2.

4. The method according to claim 1, wherein In step 1, the specific method for obtaining the expression cassette B is as follows: 1) Design target sequences based on the coding region sequences of the three genes OsPAIR1, OsREC8, and OsOSD1; 2) Integrate the target sequence into the SK-gRNA vector to obtain three intermediate vectors SG1, SG2, and SG3; 3) Use enzyme ligation to connect the three intermediate vectors SG1, SG2, and SG3 to the backbone vector pC1300-Cas9 containing the CRISPR / Cas9 expression element to obtain expression cassette B.

5. The method according to claim 2, characterized in that In step 2, the expression cassette A1 and the expression cassette B are integrated into the same expression vector to obtain the expression cassette C1. The specific steps are as follows: 1) Expression cassette A1 was amplified using the primers OsECA1-PC-F and OsZFPP1-PC-R with adapters designed for expression cassette A1 to obtain amplification product 5-1; the sequences of OsECA1-PC-F and OsZFPP1-PC-R are shown in SEQ ID NOs. 22-23; 2) Cut the expression cassette B with restriction endonucleases Kpn I and Bam HI. 3) Expression cassette A1 and expression cassette B are constructed into an expression vector by homologous recombination to obtain expression cassette C1; 4) Genetic transformation was performed using Agrobacterium tumefaciens EHA105-mediated genetic transformation method, and the transformation background was the indica-japonica hybrid rice variety Chunyou 84.

6. The method according to claim 3, characterized in that In step 2, the expression cassette A2 and the expression cassette B are integrated into the same expression vector to obtain the expression cassette C2. The specific steps are as follows: 1) Expression cassette A2 was amplified using the primers OsECA1-PC-F and OsZFPP2-PC-R with adapters designed for expression cassette A2 to obtain amplification product 5-2; the sequences of OsECA1-PC-F and OsZFPP2-PC-R are shown in SEQ ID NO. 22 and SEQ ID NO. 24; 2) Cut the expression cassette B with restriction endonucleases Kpn I and Bam HI. 3) Expression cassette A2 and expression cassette B are constructed into an expression vector by homologous recombination to obtain expression cassette C2; 4) Genetic transformation was performed using Agrobacterium tumefaciens EHA105-mediated genetic transformation method, and the transformation background was the indica-japonica hybrid rice variety Chunyou 84.

7. The method according to claim 1, characterized in that In step 3, the screening of T0 generation plants in which the three genes OsPAIR1, OsREC8 and OsOSD1 are homozygous knocked out and the OsZFPP1 gene or the OsZFPP2 gene is successfully ectopically expressed is carried out in the following steps: 1) Based on the gene sequences of OsPAIR1, OsREC8, and OsOSD1, Hi-TOM detection primers (PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, OSD1-Hi-F, OSD1-Hi-R) were designed. T0 generation transgenic plants were amplified to screen for transgenic plants with homozygous mutations in all three genes. The sequences of PAIR1-Hi-F and PAIR1-Hi-R are shown in SEQ ID NOs. 25-26, the sequences of REC8-Hi-F and REC8-Hi-R are shown in SEQ ID NOs. 27-28, and the sequences of OSD1-Hi-F and OSD1-Hi-R are shown in SEQ ID NOs. 29-30. 2) HYG-F and HYG-R primers were designed based on the gene sequence of the hygromycin resistance gene, and the T0 generation transgenic plants were amplified. Positive transgenic plants that successfully amplified the expression cassette A were screened; the sequences of HYG-F and HYG-R are shown in SEQ ID NOs. 31-32.

8. The method according to claim 1, characterized in that In step 4, flow cytometry and genome sequencing are used to detect plants in which the three genes OsPAIR1, OsREC8, and OsOSD1 are homozygous knockout, and plants with fixed heterosis are screened. The specific steps are as follows: 1) Flow cytometry was used to measure the ploidy of the offspring of plants homozygous for knockout of all three genes: OsPAIR1, OsREC8, and OsOSD1. Plants with diploid ploidy were selected. 2) The diploid plants are tested using genome sequencing technology to select plants with fixed genotypes.

Citation Information

Patent Citations

  • Method for fixing rice heterosis by using apomixis system

    CN118360328A

  • Method for rapidly fixing rice heterosis

    CN118360329A

  • Method for inducing apomixis of plants through MODD gene and application of method in plant breeding

    CN118956945A

Cited By

  • Method for fixing rice heterosis by using OsMPF gene

    CN122038470A

  • Method for fixing heterosis of rice by using osmpf gene

    CN122038470B