A SNP molecular genetic marker for the NFE2L1 gene associated with chicken feed conversion ratio and its application
Genome-wide association analysis revealed the NFE2L1 gene SNP site on chromosome 27 of yellow-feathered broiler chickens. Primers and kits were designed to screen chickens with low feed conversion ratios, solving the problem of difficulty in screening relevant SNP markers in existing technologies, and achieving the effect of reducing feed consumption and improving economic benefits.
Patent Information
- Application Number
- CN202511111426.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2045-08-08
AI Technical Summary
Existing technologies are insufficient to effectively screen out SNP molecular genetic markers related to chicken feed conversion rate, making it difficult for genetic breeding to significantly improve feed conversion rate and affecting farming efficiency.
Genome-wide association analysis revealed the SNP locus rs731344472 (chr27-6493284) of the NFE2L1 gene on chromosome 27 of yellow-feathered broilers. Specific primers and kits were designed to detect this SNP molecular genetic marker, and yellow-feathered broilers with low feed conversion ratios were screened out.
It effectively reduces feed consumption during production, improves the economic benefits and competitiveness of enterprises, and enables early selection and accelerated genetic breeding of traits with low feed conversion rates.
Smart Images

Figure CN120648819B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a SNP molecular genetic marker of the NFE2L1 gene related to chicken feed conversion rate and its application. Background Technology
[0002] Feed conversion ratio (FCR), a core indicator for measuring feed utilization efficiency in poultry, is defined as the ratio of total feed consumed by an animal to total product output (such as meat and eggs). In poultry production, feed costs account for 60%-70% of total breeding costs, directly determining the level of profitability. Studies show that for every 0.1 point improvement in FCR, each broiler chicken can reduce feed consumption by approximately 0.8-1.2 kg. This not only significantly reduces production costs but also reduces nitrogen and phosphorus emissions, achieving a dual improvement in economic and environmental benefits. From a genetic perspective, FCR is a trait with moderate heritability (h). 2 (≈0.3-0.4), indicating that stable genetic progression can be achieved through genetic selection.
[0003] Reducing feed conversion ratio is crucial for improving economic efficiency; therefore, identifying and utilizing new genes related to feed conversion ratio in yellow-feathered broilers is of great significance for chicken genetic breeding. Genome-wide association study (GWAS) is a method that locates loci associated with complex traits by scanning large-scale genomic variations. Its core principle is based on linkage disequilibrium (LD), which involves comparing the genotype frequency differences between extreme individuals of a target trait in a population to screen for SNP loci significantly associated with the trait.
[0004] With poultry breeding entering the genomic era, integrating GWAS technology with SNP marker-assisted selection has become a key pathway to overcome the bottleneck of FCR genetic improvement. High-throughput sequencing technology can reveal the genetic regulatory mechanisms of feed conversion ratio traits, select potential molecular markers for specific phenotypes, improve the accuracy of trait genetic prediction, and provide a powerful tool for early trait selection and accelerating the genetic breeding process. How to screen for SNP molecular genetic markers related to feed conversion ratio is one of the keys to accelerating the breeding of yellow-feathered broilers with low feed conversion ratios and improving farming efficiency. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a SNP molecular genetic marker for the NFE2L1 gene, which is related to chicken feed conversion rate, and its application.
[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:
[0007] In a first aspect, the present invention provides an SNP molecular genetic marker for the NFE2L1 gene associated with chicken feed conversion ratio. The SNP molecular genetic marker is located at position 6493284 on chromosome 27, with sequence number rs731344472, and the position is a G>T mutation.
[0008] The beneficial effects of this invention are as follows: Addressing the differences in feed conversion ratio among different genotypes of yellow-feathered broilers, this invention, through association analysis of feed conversion ratio and genome-wide SNP genetic markers, screened out the SNP molecular genetic marker chr27-6493284 affecting yellow-feathered broilers. Applying this marker to the screening of yellow-feathered broilers can yield yellow-feathered broilers with low feed conversion ratios, effectively reducing feed consumption during production and improving the economic benefits and competitiveness of enterprises. The involved genetic marker chr27-6493284 is the mutation site with SNP number chr27-6493284, which can be found in the NCBI Chicken Genome Database (bGalGal1.mat.broiler.GRCg6a).
[0009] Furthermore, G>T mutation represents different mutated alleles at a single site, where G is a high-frequency allele and T is a low-frequency allele, and the symbol > indicates the frequency of the allele.
[0010] Furthermore, the mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where R is the mutation site, and when R is T, it indicates a chicken with low feed conversion ratio.
[0011] SEQ ID NO.1:
[0012] 5'-ACTGTCCCGTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATC
[0013] TGTGCCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGCGATAAAGAGGGTGGCTGATGATTGCAGGGCAACTGCAACACCCTCAGGACCCCAGCCCAGGCATGGGGCCAGCAGGCAGCCAACGCTCACCTGARGGCTGGGCTCCACCACGATGCCCCAATCG ATCTCATTGTCCTGGGCTTCCCCGCCTGCAGCAGCGCTGTCAATGTCACCCCCACCAATGGGCTCCAGCGTGAAGTCACCCCAGTCGATCTGCAGCGAAAAGGGCAATGGGACCTCTGAGACCTGAAGGACACGAGCTCCCCTCCAGCTGCAGCAAACACCCACAGCCCCA-3'.
[0014] Furthermore, a method for determining the above-mentioned SNP molecular genetic markers is provided, the specific steps of which are as follows:
[0015] (1) Cultivate healthy yellow-feathered broiler individuals, and select yellow-feathered broilers with the lowest and highest feed conversion rates to collect and preserve blood;
[0016] (2) Extract DNA and perform DNA quality determination;
[0017] (3) Determine the SNP molecular genetic markers associated with the feed conversion rate trait in yellow-feathered broilers.
[0018] In a second aspect, the present invention provides primers for detecting the above-mentioned SNP molecular genetic markers, wherein the forward primer sequence is shown in SEQ ID NO.2 and the reverse primer sequence is shown in SEQ ID NO.3;
[0019] SEQ ID NO.2: 5'-CCTCAGAGCCATCCTCCAAC-3';
[0020] SEQ ID NO. 3: 5'-GTCTCAGAGGTCCCATTGCC-3'.
[0021] A third aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular genetic markers, comprising the above-mentioned primers.
[0022] Furthermore, the kit also includes 2×Taq Master Mix.
[0023] In a fourth aspect, the present invention provides the application of the above-mentioned SNP molecular genetic markers or primers or kits in screening chicken individuals or parents with low feed conversion ratios.
[0024] In a fifth aspect, the present invention provides a method for screening chickens with low feed conversion ratio, wherein the SNP molecular markers of the individuals to be screened are amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular marker genotype TT are selected as chickens with low feed conversion ratio.
[0025] Furthermore, the method for screening chickens with low feed conversion ratio based on the above-mentioned kit for detecting SNP molecular genetic markers includes the following steps:
[0026] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.
[0027] (2) The kit contains 2×Taq Master Mix, forward and reverse primers;
[0028] (3) The PCR products were sequenced using the Sanger sequencing method;
[0029] (4) Select homozygous individuals with the TT genotype at position 6493284 on chromosome 7.
[0030] Furthermore, the PCR system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to 20 μL.
[0031] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0032] The present invention has the following beneficial effects:
[0033] (1) This invention provides an SNP molecular genetic marker chr27-6493284. Experimental verification shows that this molecular genetic marker is significantly associated with the feed conversion rate trait of yellow-feathered broilers. It can be applied to the breeding of yellow-feathered broilers with low feed conversion rate, which can effectively reduce the amount of feed consumed in the production process and improve the economic benefits and competitiveness of enterprises.
[0034] (2) This invention provides primers and kits for the identification of SNP molecular genetic marker chr27-6493284, which can be applied to efficiently screen individuals or parents of yellow-feathered broilers with excellent feed conversion ratio. Attached Figure Description
[0035] Figure 1 Manhattan plot of SNP molecular genetic markers;
[0036] Figure 2 This is a sequencing diagram of SNP molecular genetic marker genotypes. Detailed Implementation
[0037] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0038] Example 1: Screening of SNP molecular genetic markers
[0039] The screening process for SNP molecular genetic markers includes the following steps:
[0040] 1872 healthy yellow-feathered broiler chickens were selected and fed to their maximum capacity for 49 days. The daily feed intake, initial body weight, and final body weight of each chicken were recorded. The feed conversion ratio was calculated using the following formula:
[0041] ;
[0042] In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.
[0043] A lower FCR value, indicating a lower feed conversion ratio, means less feed is consumed for the same production capacity, thus saving feed. DNA was extracted from each sample, and the DNA samples underwent quality testing. DNA concentration was measured using a Qubit Fluorometer, and DNA fragment size and degradation were measured using agarose gel electrophoresis. The results showed that 99 samples were substandard, and the 1773 qualified DNA samples from yellow-feathered chicken breeder chickens were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput yield measurement technology. Sequencing data underwent quality control and filtering to remove low-quality sequencing reads and potential false positive BNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows:
[0044] y=Xb+Zu+m+e
[0045] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ)2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α σ 2 ε represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.
[0046] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This marker is located in the NFE2L1 gene on chromosome 27 of yellow-feathered broilers, specifically at locus 6493284 of the rs731344472 sequence on chromosome 27, named chr27-6493284. Figure 1 The Manhattan diagram shows the mutation site of this SNP molecular genetic marker and the upstream and downstream primer sequences as shown in SEQ ID NO.1.
[0047] SEQ ID NO.1:
[0048] 5'-ACTGTCCCGTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATC
[0049] TGTGCCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGCGATAAAGAGGGTGGCTGATGATTGCAGGGCAACTGCAACACCCTCAGGACCCCAGCCCAGGCATGGGGCCAGCAGGCAGCCAACGCTCACCTGARGGCTGGGCTCCACCACGATGCCCCAATCG ATCTCATTGTCCTGGGCTTCCCCGCCTGCAGCAGCGCTGTCAATGTCACCCCCACCAATGGGCTCCAGCGTGAAGTCACCCCAGTCGATCTGCAGCGAAAAGGGCAATGGGACCTCTGAGACCTGAAGGACACGAGCTCCCCTCCAGCTGCAGCAAACACCCACAGCCCCA-3'.
[0050] Where R is the T>G mutation site, and when R is T, chickens have a lower feed conversion rate; 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.
[0051] Example 2: Validation of SNP molecular genetic markers
[0052] I. Validation method for SNP molecular genetic marker chr27-6493284, specifically including the following steps:
[0053] (1) The SNP molecular genetic marker chr27-6493284 was validated in another yellow-feathered broiler population. A total of 1773 healthy yellow-feathered broiler individuals were fed to the maximum for 49 days. The daily feed intake, initial weight and final weight of each chicken were recorded. The feed conversion rate was calculated. 150 individuals with low feed conversion rate (negative value) and 150 individuals with high feed conversion rate (positive value) were selected, and blood was taken for DNA extraction.
[0054] (2) Using the DNA extracted in step (1) as a template, perform PCR reaction using the primers shown in SEQ ID NO.2-3.
[0055] SEQ ID NO.2: 5'-CCTCAGAGCCATCCTCCAAC-3';
[0056] SEQ ID NO. 3: 5'-GTCTCAGAGGTCCCATTGCC-3'.
[0057] The PCR reaction system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to 20 μL.
[0058] The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0059] (3) The PCR products were sequenced using the Sanger sequencing method.
[0060] II. Results Analysis
[0061] The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample (e.g., Figure 2 In the sequencing data of the TT genotype, only one peak appears at the corresponding locus, indicating that the alleles are the same (T). In the sequencing data of the TG genotype, two peaks appear at the corresponding locus, indicating that the alleles are different (one is G and the other is T). In the sequencing data of the GG genotype, only one peak appears at the corresponding locus, indicating that the alleles are the same (G). One-way ANOVA using SPSS 26.0 was used to analyze the relationship between the genotypes and alleles of the SNP molecular markers and feed conversion ratio. The results are shown in Tables 1 and 2.
[0062] Table 1. Statistical table of distribution differences of SNP molecular genetic marker genotypes between low and high feed conversion ratios.
[0063]
[0064] Table 2. Statistical table of distribution differences of SNP molecular genetic marker alleles between low and high feed conversion ratios.
[0065]
[0066] As shown in the table, the genotype and allele frequencies of the SNP molecular genetic marker chr27-6493284 showed highly significant differences between the low and high feed conversion ratio groups (P < 0.01). In the low feed conversion ratio group, the frequency of the T allele was higher than that of the G allele, and the frequency of the TT genotype was higher than that of the GG genotype, indicating that individuals with the TT genotype at position 201 had a better feed conversion ratio phenotype than individuals with the GG genotype. This further demonstrates that the polymorphism of the screened molecular markers is significantly associated with the feed conversion ratio trait, and these are SNP loci associated with the feed conversion ratio trait, which can be used for breeding yellow-feathered broilers with low feed conversion ratio traits.
[0067] Example 3: Assisted molecular breeding method for feed conversion ratio trait in yellow-feathered broilers using SNP molecular genetic markers
[0068] This invention provides a kit for detecting the SNP molecular genetic marker chr7-22401119, the kit comprising 2×Taq Master Mix, forward and reverse primers as shown in SEQ ID NO.2-3, and ddH2O.
[0069] The specific method includes the following steps:
[0070] (1) Blood was collected from the wing vein of the yellow-feathered broiler individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.
[0071] (2) Perform PCR on the DNA extraction product from step (1). The PCR reaction system is a 20 μL system, including 10 μL of 2×TaqMaster Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions are: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0072] (3) The PCR products from step (2) were sequenced using the Sanger sequencing method.
[0073] (4) Genotyping is performed based on the sequencing results. Homozygous individuals with the SNP molecular genetic marker chr27-6493284 as the TT genotype are selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs. Individuals with this marker are selected to join the core breeding population, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.
[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The application of primers for detecting SNP molecular genetic markers related to chicken feed conversion ratio in the assisted screening of yellow-feathered broilers with low feed conversion ratio, characterized in that, The SNP molecular genetic marker is located at position 6493284 on chromosome 27 of chicken, with RS number rs731344472. This site is a G>T mutation. Homozygous individuals with the TT genotype of the SNP molecular genetic marker are selected as yellow-feathered broilers with low feed conversion ratio.
2. The application according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where R is the mutation site, and when R is T, it is a yellow-feathered broiler with low feed conversion ratio.
3. The application according to claim 1, characterized in that, The primers include a forward primer and a reverse primer, the sequence of which is shown in SEQ ID NO.2 and the sequence of which is shown in SEQ ID NO.
3.
4. A method for assisting in screening yellow-feathered broiler chickens with low feed conversion ratio, characterized in that, The SNP molecular genetic markers of the individuals to be screened are amplified and sequenced using PCR technology, and homozygous individuals with the TT genotype of the SNP molecular genetic markers are selected as yellow-feathered broilers with low feed conversion ratio.
Citation Information
Patent Citations
TMEM165 gene SNP (Single Nucleotide Polymorphism) molecular marker related to feed conversion rate of yellow feather broiler and application of TMEM165 gene SNP molecular marker
CN119162342A
CDK5RAP3 gene SNP molecular marker related to feed conversion rate of yellow feather broilers and application of CDK5RAP3 gene SNP molecular marker
CN119220703A