HPV (human papillomavirus) detection kit

Abstract

The invention discloses an HPV (human papillomavirus) detection kit, which solves the problems that the traditional HPV detection needs expensive instruments, is complex to operate and has long detection time by adopting an LAMP (loop-mediated isothermal amplification) technology and a visual detection design. The kit comprises a freeze-drying tube, a liquid reaction tube and a sample cracking tube, wherein an LAMP primer group in the freeze-drying tube is combined with Bst DNA polymerase to realize isothermal amplification; the MOPS buffer microspheres in the liquid reaction tube release components to maintain the reaction environment when the pH changes, the color development accuracy and stability of the neutral red are protected, and the neutral red as an indicator visually presents the result through the color (orange-yellow negative and red positive); during detection, a sample and a lysis solution are mixed and heated and then are added into a reaction system, the constant temperature of 60 DEG C is kept for 30 min, then interpretation can be performed with naked eyes, equipment such as a thermal cycler is not needed, the cost is low, portability is high, and popularization and application of HPV screening in basic medical institutions are effectively promoted.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to an HPV virus detection kit. Background Art

[0002] Human papillomavirus (HμMan Papillomavirus, HPV) belongs to the genus Papillomavirus A of the family Papovaviridae. It can cause a variety of benign papillomas or warts in human skin and mucous membrane tissues, lead to abnormal tissue proliferation, and infection with certain subtypes is potentially carcinogenic. Molecular epidemiological studies have shown that persistent HPV infection is a necessary condition for causing cervical cancer and oropharyngeal cancer. Currently, more than 200 papillomavirus subtypes have been isolated and sequenced, of which 15 are considered carcinogenic or high-risk. Most oropharyngeal and cervical cancer patients are caused by HPV16 or HPV18 subtypes.

[0003] Globally, cervical cancer is the most common gynecological cancer and the fourth most common malignant tumor in terms of morbidity and mortality. In 2018, there were an estimated 570,000 cases of cervical cancer and 311,000 deaths worldwide. In addition, cervical cancer is the leading cause of cancer death in 42 countries. However, the incidence and mortality of cervical cancer have declined significantly over the past 80 years, mainly due to effective screening and treatment of precancerous lesions, which also highlights the importance of more widespread adoption of effective screening methods. The incidence of oropharyngeal squamous cell carcinoma (OPSCC) caused by HPV is steadily increasing and recently surpassed cervical cancer to become the most common HPV-related cancer in the United States, of which HPV16 subtype accounts for approximately 87% of oropharyngeal cancers. Due to the importance of HPV in the pathogenesis of these cancers, increasing HPV The accuracy of the test is critical for effectively screening people at risk for cancer, rapidly diagnosing cancer, and monitoring patients receiving active treatment. A variety of HPV detection methods have been developed, including nucleic acid hybridization assays, signal amplification assays, nucleic acid amplification-based assays, and fluorescence in situ hybridization. For patients with newly diagnosed oropharyngeal cancer, p16 expression is detected by immunohistochemistry as a surrogate marker of HPV infection. However, these methods require a lot of resources, including testing costs, sophisticated equipment, trained personnel, and specialized reagents, which may be difficult to expand for a wider range of HPV testing, including screening and monitoring treatment response. Loop-mediated isothermal amplification (LAMP) is a robust technology that can rapidly and highly specifically amplify DNA. LAMP technology relies on specific primers and Bst DNA polymerase large fragment, a DNA polymerase that can self-circulate and displace chains. The workflow of LAMP technology is suitable for clinical settings and can quickly, easily, and economically detect HPV DNA, especially the two most common high-risk subtypes HPV16.

[0004] Currently, HPV detection methods mainly include: cytology, immunology, molecular biology, and PCR technology. These methods require a thermal cycler, are complex to operate, and are expensive, making them unsuitable for primary care. Hybridization capture technology, however, often requires expensive instruments, complex procedures, and long detection times, limiting their application in primary care settings and resource-limited areas. Furthermore, some existing rapid detection methods lack sensitivity, specificity, or stability, making them difficult to meet clinical needs. Therefore, developing an HPV virus detection kit that is simple to operate, rapid, accurate, and suitable for on-site testing is of great significance.

[0005] The prior art CN103898241B discloses a kit for detecting HPV, which is mainly based on NASBA technology (relying on RNA reverse transcriptase, RNA polymerase, etc.) and chip capillary electrophoresis, and requires complex instruments to analyze the electrophoresis results. The experimental results are not analyzed visually and the samples are extracted after lysis. Summary of the Invention

[0006] In view of the shortcomings of HPV detection requiring expensive instruments, complex operating procedures and long detection time, which limit its application in primary medical institutions and resource-limited areas, the present application provides an HPV virus detection kit, which achieves low-cost, rapid, portable and highly sensitive detection through the following technological innovations. Through constant temperature amplification, visual detection and integrated design, it solves the high requirements of traditional HPV detection on equipment, operation and time, making the popularization of HPV screening in primary medical institutions possible. As a tool for early detection, monitoring treatment response and evaluating cancer recurrence, loop-mediated isothermal amplification (LAMP) is a simple and powerful technology that can detect and amplify DNA using Bst chain displacement DNA polymerase in a single test tube. A method using LAMP technology has been developed for detection of oral epithelial cell samples by lysis-free DNA extraction.

[0007] On the one hand, the present application provides an HPV virus detection kit, which includes a lyophilized tube, a liquid reaction tube and a sample lysis tube: wherein the lyophilized tube contains a LAMP primer set, Bst DNA polymerase and a trehalose-sorbitol complex protective agent; the liquid reaction tube contains MOPS buffer microspheres, dNTP and neutral red; the sample lysis tube contains a sample lysis solution.

[0008] Preferably, the mass ratio of the trehalose-sorbitol composite protective agent in the freeze-drying tube is 2-4:1, and the final concentration in the freeze-drying system is 5%-10% w / v.

[0009] Preferably, the Bst DNA polymerase activity unit in the lyophilized tube is 5-10 U / μL, and the HPV16 LAMP primer set comprises inner primers (F3, B3), outer primers (FIP, BIP) and loop primers (LF, LB) designed for the conserved region of HPV virus, and the molar ratio of the inner primers, outer primers and loop primers is 1:7.5:1, wherein the HPV16-F3 primer is shown in SEQ ID 1; the HPV16-B3 primer is shown in SEQ ID 2; the HPV16-FIP primer is shown in SEQ ID 3; the HPV16-BIP primer is shown in SEQ ID 4; and the HPV16-LF primer is shown in SEQ ID 5;

[0010] HPV16-LB primer is shown in SEQ ID 6:

[0011] SEQ ID 1: ATGCACCAAAAGAGAACTG

[0012] SEQ ID 2: AGCATATGGATTCCCATCTC

[0013] SEQ ID 3: GCAGCTCTGTGCATAACTGTTTTTCAATGTTTCAGGACCCACA

[0014] SEQ ID 4: AGAATGTGTGTACTGCAAGCAATTTTTCCCGAAAAGCAAAGTCAT

[0015] SEQ ID 5: GGTAACTTTCTGGGTCGCTCC

[0016] SEQ ID 6: CAGTTACTGCGACGTGAGGT

[0017] Preferably, the MOPS microsphere buffer system in the liquid reaction tube is composed of PLGA-coated MOPS buffer salt, the microsphere particle size is 5-20 μm, and it ruptures to release the buffer component at pH 6.8±0.2. The surface of the microsphere is coated with a pH-sensitive polymer poly(β-amino ester).

[0018] Preferably, the liquid reaction tube further contains an enzyme reaction solution.

[0019] Preferably, the concentration of the neutral red pH indicator in the liquid reaction tube is 0.05-0.2 mM, and it is orange-yellow at pH 8.0-8.5 and red at pH 6.8±0.2.

[0020] Preferably, after the trehalose-sorbitol composite protective agent in the liquid reaction tube and the freeze-drying tube is mixed, the final concentration in the reaction system is 3%-8% w / v.

[0021] Preferably, the sample lysis solution in the sample lysis tube contains: 0.3%-1% TritonX-100 or SDS, 2%-6% Tween 20, 1-5mM Tris, 1-5mM EDTA, wherein the pH is 8.0-9.0.

[0022] On the other hand, the present application provides a method for detecting HPV virus, characterized in that the method comprises the following steps:

[0023] (1) Use a sterile cotton swab to scrape the oral epithelium back and forth 4-6 times. Place the cotton swab with oral epithelial cells in the lysis solution, mix it upside down for 10-20 seconds, and heat it at 65°C for 5 minutes.

[0024] (2) Add 50 μL of the lysate to a liquid reaction tube, then add the contents of the freeze-dried tube, shake gently for 10 seconds, and then incubate at 60°C for 30-45 minutes;

[0025] (3) Observe the color chart with the naked eye: orange indicates HPV negative, and red indicates HPV positive.

[0026] Preferably, during the reaction of step (2), as the LAMP reaction proceeds, when the pH drops to 7.0±0.2, the MOPS microspheres in the liquid reaction tube rupture and release the buffer component.

[0027] The beneficial effects of the embodiments of the present application are:

[0028] (1) Easy to operate, no need for complex equipment: Using LAMP constant temperature amplification technology, only 30 minutes of constant temperature reaction at 60°C is required. No expensive instruments such as thermal cyclers (PCR instruments) and electrophoresis equipment are required, which lowers the detection threshold. Neutral red pH indicator is used to enable visual interpretation (orange-yellow negative / red-positive). No professional equipment analysis is required, making it suitable for use in primary medical institutions.

[0029] (2) Rapid detection and improved screening efficiency: Traditional HPV testing usually takes 2-4 hours, while this kit can be completed in just 30 minutes, significantly shortening the detection time. It is suitable for large-scale screening. Sample processing is simple and only requires lysis before being directly added to the reaction system, reducing the number of operating steps and improving detection throughput.

[0030] (3) Low cost and easy to promote: freeze-drying technology (trehalose-sorbitol composite protective agent) is used to stabilize the enzyme and primers, extend the shelf life, reduce transportation and storage costs, and the integrated design of the test kit reduces the use of consumables. The overall cost is only 1 / 3 of the traditional PCR test, which is suitable for promotion in resource-limited areas.

[0031] (4) MOPS buffer microspheres dynamically regulate pH to avoid false positives / false negatives and improve detection accuracy.

[0032] (5) Strong stability and adaptability to different environments: The composite protective agent (trehalose-sorbitol) in the freeze-dried tube can maintain enzyme activity for a long time. The kit can be stably stored at 4-25°C for more than 6 months. The lysis solution (containing Triton X-100 and Tween 20) can effectively release viral DNA, reduce sample processing errors, and amplify through the extraction-free DNA lysis method, which greatly shortens the extraction time and reduces complex operations.

[0033] (6) It is applicable to oral epithelial cells and can be used for HPV infection screening, efficacy monitoring and epidemiological surveys. It is highly portable and suitable for community hospitals, remote areas and home self-examination scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The experimental display diagrams of Group 1 and Group 2 of Example 5 of the present application;

[0035] Figure 2 These are experimental diagrams of Group 3 and Group 4 of Example 5 of this application;

[0036] Figure 3 This is a diagram showing the negative result of Example 7 of the present application;

[0037] Figure 4 This is a graph showing the HPV16 positive sample experiment in Example 7 of the present application;

[0038] Figure 5 Schematic diagram of the pH response kinetics test experiment of MOPS buffer microspheres in Example 8 of the present application. DETAILED DESCRIPTION

[0039] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0040] The reagents and equipment used in the examples of this disclosure are conventional and commercially available.

[0041] Preparation Example

[0042] Preparation of lysate stock solution

[0043] (1) Preparation of 1 M Tris-HCl buffer (pH 8.5): Weigh 121.1 g of Tris (molecular weight 121.14), dissolve in 800 mL of deionized water, adjust the pH to 8.5 with concentrated HCl, make up to 1 L, sterilize by autoclaving at 126°C for 15 min, and store at room temperature.

[0044] (2) 0.5 M EDTA solution (pH 8.0): Weigh 186.1 g of EDTA disodium salt (molecular weight 372.24) and dissolve it in 800 mL of deionized water. Adjust the pH to 8.0 with NaOH (EDTA is insoluble below pH 8.0), make up to 1 L, sterilize by autoclaving, and store at room temperature.

[0045] (3) 50% Triton X-100 stock solution: Measure 50 mL of Triton X-100 stock solution, add 50 mL of deionized water, stir magnetically until completely dissolved, filter through a 0.22 μm filter membrane for sterilization, and store at 4°C in the dark.

[0046] (4) 50% Tween 20 stock solution: Measure 50 mL of Tween 20 stock solution, add 50 mL of deionized water, mix well, filter and sterilize, and store at 4°C.

[0047] (5) Preparation of 10% SDS stock solution: Weigh 10 g of SDS powder and slowly add the SDS powder to 80 mL of deionized water preheated to 60°C (heating can accelerate dissolution). Stir magnetically (300 rpm) until completely dissolved (15-20 min). Avoid vigorous stirring to produce foam. After the solution cools to room temperature, add deionized water to 100 mL and mix gently.

[0048] (6) Preparation of MOPS buffered microspheres: Weigh 100 mg of PLGA and 20 mg of MOPS buffer salt, add 2 mL of dichloromethane, and ultrasonically dissolve them at a power of 100 W for 5 minutes until they are completely dissolved. The obtained PLGA-MOPS organic phase is slowly added dropwise to 100 mL of 1% PVA aqueous solution, and emulsified at a high speed of 1000 rpm for 10 minutes. Continue magnetic stirring at 300 rpm for 2 hours to volatilize the dichloromethane and solidify the microspheres. Centrifuge (3000 rpm, 5 minutes), discard the supernatant, and wash three times with 10 mL of deionized water to prepare a 1% poly (β-amino ester) solution: weigh 10 mg of polymer and dissolve it in 1 mL of deionized water. Resuspend the microspheres in the modification solution and shake gently at 25°C (50 rpm) for 30 minutes. Freeze and dry them. Prefreeze: -80°C for 2 hours, freeze-dry: 24 hours to obtain a white loose powder. Weigh 100 mg of freeze-dried microspheres and add 10 mL PBS buffer (pH 6.8) was vortexed for 1 min and briefly sonicated (40 kHz, 10 s) to assist dissolution. The particle size was measured using a laser particle size analyzer: D50: 10±2 μm, particle distribution index (PDI) <0.3.

[0049] (7) Preparation of trehalose-sorbitol composite protective agent: Weigh 16 g of trehalose and 4 g of sorbitol, add 80 mL of deionized water preheated at 60 °C into a beaker, add sorbitol first, stir magnetically (300 rpm) until completely dissolved (5 min), then add trehalose, continue stirring until completely transparent (15 min), cool to room temperature, add deionized water to 100 mL, mix well, filter through a 0.22 μm sterile filter membrane, and collect in a sterilized container. Its pH value is 6.5-7.5, and its osmotic pressure is 1105 mOsm / kg.

[0050] Example 1

[0051] Low concentration lysis buffer formula

[0052] The formula composition is shown in Table 1:

[0053] Table 1 Low concentration lysis solution formula (prepared 1mL)

[0054] Final concentration Use concentration Volume (μL) EDTA 1mM 0.5M 2 Tris 1mM 1M 1 Twain 20 2％ 50％ 40 TritonX-100 0.3％ 50％ 6 Deionized water / / 951

[0055] Example 2

[0056] Intermediate concentration lysis buffer formula

[0057] The formula composition is shown in Table 2:

[0058] Table 2 Intermediate concentration lysis solution formula (prepared 1mL)

[0059] Final concentration Use concentration Volume (μL) EDTA 3mM 0.5M 6 Tris 3mM 1M 3 Twain 20 4％ 50％ 80 TritonX-100 0.5％ 50％ 10 Deionized water / / 901

[0060] Example 3

[0061] High concentration lysis buffer formula

[0062] The formula composition is shown in Table 3:

[0063] Table 3 High concentration lysis solution formula (prepared 1mL)

[0064] Final concentration Use concentration Volume (μL) EDTA 5mM 0.5M 10 Tris 5mM 1M 5 Twain 20 6％ 50％ 120 TritonX-100 1％ 50％ 20 Deionized water / / 845

[0065] Example 4

[0066] SDS instead of Triton X-100 lysis buffer formula

[0067] The formula composition is shown in Table 4:

[0068] Table 4 SDS replaces Triton X-100 lysis buffer formula (preparation 1mL)

[0069] Final concentration Use concentration Volume (μL) EDTA 3mM 0.5M 6 Tris 3mM 1M 3 Twain 20 4％ 50％ 80 SDS 0.5％ 10％ 50 Deionized water / / 861

[0070] Example 5

[0071] Lysate validation experiments

[0072] (1) Experimental materials:

[0073] 1) β-actin was used as an internal reference gene and amplified using the primer sequences shown in Table 5 (sequence source: [Facile and direct detection of hμMan papillomavirus (HPV) DNA in cells using loop-mediated isothermal amplification (LAMP)]). The primers were synthesized by Shanghai Bioengineering to verify the validity of the cell lysate.

[0074] Table 5 β-actin internal reference primer sequences

[0075] name Primer sequences ACTB-F3 GCTCAGGGCTTCTTGTCC ACTB-B3 TCGGGAGCCACACGCA ACTB-FIP TTGCTCTGGGCCTCGTCGCTTTTTTTCCTTCCCAGGGCGT ACTB-BIP AGAGGCATCCTCACCCTGAAGTTTTTTGTGGTGCCAGATTTTCTCCA ACTB-LF TGACCCATGCCCACCATC ACTB-LB CCATCGAGCACGGCATCGT

[0076] 2) Lysis solution prepared in Examples 1-4, sterile oral sampling cotton swabs, and 5 healthy volunteers (who signed informed consent).

[0077] (2) Experimental method: The buccal mucosa of the volunteers was scraped 4-6 times with a sterile cotton swab, and the cotton swab was immediately immersed in 1 mL of lysis buffer of different concentrations: Group 1: low-concentration lysis buffer of Example 1; Group 2: intermediate-concentration lysis buffer of Example 2; Group 3: high-concentration lysis buffer of Example 3; Group 4: SDS lysis buffer of Example 4; heated at 65°C for 5 min, vortexed twice during the heating, and detected using Bst II DNA Polymerase Large Fragment (Novizen, P702). The detection amplification system is shown in Table 6:

[0078] Table 6 Amplification system (20 μL)

[0079]

[0080]

[0081] Place in a 60℃ constant temperature water bath for 30 minutes.

[0082] (3) Experimental results: After amplification, the observed colors are all red, Group 1 and Group 2 are as follows Figure 1 As shown (left: group 1, right: group 2), group 3 and group 4 are as shown Figure 2 As shown (left: Group 3, right: Group 4); the amplification primer is an internal control, indicating that all samples release DNA and bind to DNA. The results verify that the lysis buffer is effective and samples can be detected without extracting DNA.

[0083] Example 6

[0084] Kit preparation method

[0085] (1) Preparation of lyophilized tubes (10 μL / tube):

[0086] 1) A LAMP primer mixture was prepared by mixing HPV16 primers (F3 (SEQ ID 1), B3 (SEQ ID 2), FIP (SEQ ID 3), BIP (SEQ ID 4), LF (SEQ ID 5), and LB (SEQ ID 6)) at a molar ratio of 1:7.5:1 (inner primer (F3 / B3): outer primer (FIP / BIP): loop primer (LF / LB). The primers were synthesized by Shanghai Bioengineering and the sequences are as follows (sequence source: [Facile and direct detection of hμMan papillomavirus (HPV) DNA in cells using loop-mediated isothermal amplification (LAMP)]):

[0087] SEQ ID 1: ATGCACCAAAAGAGAACTG

[0088] SEQ ID 2: AGCATATGGATTCCCATCTC

[0089] SEQ ID 3: GCAGCTCTGTGCATAACTGTTTTTCAATGTTTCAGGACCCACA

[0090] SEQ ID 4: AGAATGTGTGTACTGCAAGCAATTTTTCCCGAAAAGCAAAGTCAT

[0091] SEQ ID 5: GGTAACTTTCTGGGTCGCTCC

[0092] SEQ ID 6: CAGTTACTGCGACGTGAGGT;

[0093] 2) Prepare the premix (taking 1 mL as an example, it can be dispensed into 100 tubes). The formula is shown in Table 7:

[0094] Table 7 Preparation of 1 mL lyophilized tube premix

[0095]

[0096] 3) Aliquoting and lyophilization: Aliquot 10 μL / tube into 0.5 mL lyophilization tubes. Lyophilization procedure: pre-freezing: -80°C for 2 h, primary drying: -40°C, 0.1 mbar, for 24 h, secondary drying: 25°C, 0.01 mbar, for 6 h.

[0097] (2) Preparation of liquid reaction tubes (9 μL / tube): Taking a total volume of 1 mL as an example, 100 tubes can be prepared. The formula is shown in Table 8:

[0098] Table 8 1mL liquid reaction tube preparation

[0099] Element Storage solution concentration Addition volume (μL) Final concentration of liquid reaction tube MOPS microsphere suspension 10 mg / mL 190 1.9 mg / mL dNTP 10mM 190 1.9mM Neutral red 1mM 190 0.19mM 10×Isothermal buffer 10× 90 0.9× Deionized water / 240 /

[0100] Use a pipette to dispense 9 μL into 0.2 mL centrifuge tubes.

[0101] (3) Sample lysis tube preparation: 1 mL of the formula in Example 2.

[0102] Example 7

[0103] Kit performance verification experiment

[0104] (1) Experimental materials: 6 test kit components (lyophilized tube, liquid reaction tube, sample lysis tube), HPV16 positive sample, known concentration gradient: 10 1 , 10 2 , 10 3 , 10 4 copies / μL; HPV16-positive samples were purchased from Jingliang Technology (GW-IPF030), HPV-negative oral samples from healthy volunteers (5 cases), and control reagent: commercial HPV PCR detection kit.

[0105] (2) Sample processing: Use a sterile cotton swab to scrape oral epithelial cells from healthy volunteers (4-6 times), immerse in 1 mL of the lysis solution of Example 2, heat at 65°C for 5 min, and vortex mix twice during the process; LAMP reaction: Take 1 μL of the lysis product and add it to a 9 μL liquid reaction tube, add 10 μL of the freeze-dried tube components, shake gently to mix, and place in a constant temperature water bath at 60°C for 30 min. Observe the color change and interpret the result: orange-yellow: negative (oral sample from a healthy volunteer) Figure 3 As shown; red: positive (HPV16 positive sample) Figure 4 shown.

[0106] (3) Sensitivity test: HPV16 positive standard (quantified by digital PCR) was diluted to 10 1 , 10 2 , 10 3 , 10 4 copies / μL, each concentration was tested 5 times, the results showed: 101 5 copies / μL were detected positive (red), with a detection rate of 100%, 10 0 Copies / μL: No detection was found after 5 replicates (appears orange-yellow). The minimum detection limit of this kit is 10 copies / μL, which is comparable to the commercial HPV qPCR (Qiagen, The LOD (10 copies / μL) of the HPV16RG PCR Kit was consistent with that of the HPV16RG PCR Kit, and there was no significant difference in sensitivity between the two.

[0107] (4) Specificity test: The experimental design is shown in Table 9:

[0108] Table 9 Specificity Experiment

[0109]

[0110]

[0111] Experimental results: Only the HPV16 sample showed red, with no cross-reaction. The primers for HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV6, and HPV11 showed no amplification and were orange-yellow.

[0112] (5) Repeatability test (10 3 copies / μL sample): the same HPV16 positive sample (10 3 The test was performed 10 times in a row (100 copies / μL), and the color development results and reaction time were recorded: number of tests: 1-10 times, display result: red, reaction time: 30±1min, color consistency: 10 / 10 times were all red (100% consistent), time consistency: CV (coefficient of variation) = 1.2% <5% (in line with industry standards).

[0113] Example 8

[0114] pH response kinetics of MOPS buffer microspheres

[0115] (1) Experimental materials: MOPS buffered microsphere suspension (1 mg / mL) (surface coated with poly-β-amino ester with pKa = 6.8, particle size 5-20 μm), pH regulators: 0.1 M HCl and 0.1 M NaOH, real-time pH monitor, laser confocal microscope.

[0116] (2) Experimental method: The microsphere suspension was placed in a 37°C thermostat and the pH was slowly adjusted to 6.8±0.2 with HCl. The pH change time and the microsphere rupture rate were recorded. The microsphere morphology was observed under a microscope every 10 seconds and the rupture rate was calculated (number of ruptured microspheres / total number of microspheres × 100%).

[0117] (3) Experimental results: As shown in Table 10, the pH response kinetics test of MOPS buffer microspheres is as follows: Figure 5 As shown:

[0118] Table 10 pH response kinetics test of MOPS buffer microspheres

[0119] pH Time(s) Rupture rate System pH changes 6.8±0.2 10 60％ Start releasing buffer salts 6.8±0.2 30 More than 95% Recall to 7.0±0.1 6.8±0.2 60 100% completely broken Stable at 7.0±0.1

[0120] The microspheres rupture rapidly at an acidic pH of 6.8±0.2 (rupture rate >95% within 30 seconds). After releasing the buffer salt, the pH of the system is adjusted back and stabilized at 7.0±0.1, maintaining the optimal activity environment of the Bst enzyme (pH7.0-7.5) while ensuring that neutral red is in the red color development range (pH6.8±0.2), avoiding false negative results due to pH rise.

[0121] Example 9

[0122] Stability testing under different storage conditions

[0123] (1) Experimental materials: kit components (lyophilized tubes, liquid reaction tubes, divided into 4 groups after batch preparation); Storage conditions: Group A: stored at 4°C in the dark; Group B: stored at room temperature at 25°C; Group C: stored at a constant temperature of 37°C; Group D: repeatedly frozen and thawed at 4°C to 25°C (freeze-thaw cycle once a day for 30 days).

[0124] (2) Experimental method: After 0 days, 7 days, 14 days, 30 days, 60 days, and 90 days of storage, HPV16 positive samples (10 3 Each group was repeated 3 times, the reaction color change was observed, and the positive detection rate was calculated.

[0125] (3) Experimental results: As shown in Table 11:

[0126] Table 11 Stability test experiment

[0127] Storage conditions Storage time Positive detection rate (mean) Color change stability Group A (4℃) 90 days 100％ Orange / red color rendering is clear Group B (25℃) 90 days 98.3％ Slightly faded (positive samples are lighter in red) Group C (37°C) 30 days 85％ After 60 days, the detection rate dropped to 50% Group D (freeze-thaw) 30 days 92％ Slightly reduced color contrast

[0128] The test kit can be stably stored at 4°C to 25°C for more than 6 months, and can maintain a high detection rate after repeated freezing and thawing for 30 days. It is suitable for room temperature transportation to primary medical institutions and storage for home testing.

[0129] In summary, the HPV virus detection kit disclosed in this application, with the help of LAMP technology and visual detection design, effectively overcomes the problems of traditional detection requiring expensive instruments, complicated operations, and time-consuming. It contains a lyophilized tube, a liquid reaction tube and a sample lysis tube. The LAMP primer set and Bst DNA polymerase in the lyophilized tube can achieve constant temperature amplification. The MOPS buffer microspheres in the liquid reaction tube can maintain the reaction environment when the pH changes, ensuring the accuracy and stability of neutral red color development. The results can be visually judged by color changes (orange-yellow is negative, red is positive). During the test, the sample is mixed and heated with the lysate, and then added to the reaction system and kept at a constant temperature of 60°C for 30 minutes. No equipment such as a thermal cycler is required. It is low cost and highly portable. After performance verification, the kit has a sensitivity of 10 copies / μL and high specificity, which is consistent with the commercial HPV qPCR kit. It can be stably stored for more than 6 months at 4-25°C and is suitable for oral epithelial cells. It is of great significance to promote the popularization and application of HPV screening in primary medical institutions.

[0130] Although the embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A HPV virus detection kit, characterized in that: The kit includes a lyophilized tube, a liquid reaction tube and a sample lysis tube: wherein the lyophilized tube contains a LAMP primer set, Bst DNA polymerase and a trehalose-sorbitol composite protective agent; the liquid reaction tube contains MOPS buffer microspheres, dNTPs and neutral red; and the sample lysis tube contains a sample lysis solution.

2. The HPV virus detection kit according to claim 1, characterized in that: The mass ratio of the trehalose-sorbitol composite protective agent in the freeze-drying tube is 2-4:1, and the final concentration in the freeze-drying system is 5%-10% w / v.

3. The HPV virus detection kit according to claim 1, characterized in that: The Bst DNA polymerase activity unit in the freeze-dried tube is 5-10U / μL. The HPV16 LAMP primer set includes inner primers (F3, B3), outer primers (FIP, BIP) and loop primers (LF, LB) designed for the conserved region of the HPV virus. The molar ratio of the inner primers, outer primers and loop primers is 1:7.5:

1.

4. The HPV virus detection kit according to claim 1, characterized in that: The MOPS microsphere buffer system in the liquid reaction tube is composed of PLGA wrapped MOPS buffer salt. The microsphere particle size is 5-20 μm and ruptures to release buffer components at pH 6.8±0.

2. The surface of the microsphere is coated with pH-sensitive polymer poly(β-amino ester).

5. The HPV virus detection kit according to claim 1, characterized in that: The liquid reaction tube also contains enzyme reaction liquid.

6. The HPV virus detection kit according to claim 1, characterized in that: The neutral red pH indicator in the liquid reaction tube has a concentration of 0.05-0.2 mM, is orange-yellow at pH 8.0-8.5, and is red at pH 6.8±0.

2.

7. The HPV virus detection kit according to claim 1, characterized in that: After the trehalose-sorbitol composite protective agent in the liquid reaction tube and the freeze-drying tube is mixed, the final concentration in the reaction system is 3%-8% w / v.

8. The HPV virus detection kit according to claim 1, characterized in that: The sample lysis solution in the sample lysis tube contains: 0.3%-1% Triton X-100 or SDS, 2%-6% Tween 20, 1-5mM Tris, 1-5mM EDTA, wherein the pH is 8.0-9.

0.

9. A method for detecting HPV virus, characterized in that: The method comprises the following steps: (1) Use a sterile cotton swab to scrape the oral epithelium back and forth 4-6 times. Place the cotton swab with oral epithelial cells in the lysis solution, mix it upside down for 10-20 seconds, and heat it at 65°C for 5 minutes. (2) Add 50 μL of the lysate to a liquid reaction tube, then add the contents of the freeze-dried tube, shake gently for 10 seconds, and then incubate at 60°C for 30 minutes; (3) Observe the color chart with the naked eye: orange indicates HPV negative, and red indicates HPV positive.

10. The HPV virus detection method according to claim 9, characterized in that: During the reaction of step (2), as the LAMP reaction proceeds, when the pH drops to 6.8±0.2, the MOPS microspheres in the liquid reaction tube rupture and release the buffer components.

Images