Fungus strain for promoting germination of tulipa edulis seeds and application thereof

By using a combination of Aspergillus niger strains and the germination matrix of the old crow petal seeds, the problem of low germination rate of the old crow petal seeds was solved, the seed germination rate was improved and the germination time was shortened, supporting the large-scale cultivation of the old crow petal.

CN120665722AActive Publication Date: 2025-09-19WEST ANHUI UNIV
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510707135.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-09-19
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

The germination rate of old crow petals is low and the growth cycle is long. The existing artificial cultivation mainly relies on asexual reproduction of bulbs, which has a low reproduction coefficient and is difficult to meet market demand, thus limiting its large-scale expansion.

Method used

Aspergillus niger AN01 was used as a companion strain, which was combined with the seed germination matrix to form a fungus-containing matrix, and the matrix was kept moist to promote the germination of the seeds of Crow Ban.

Benefits of technology

The germination rate of the seeds of the old crow petal was significantly improved and the germination time was shortened, laying the foundation for the protection and large-scale planting of the old crow petal resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665722A_ABST
    Figure CN120665722A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, and provides a bacterial strain capable of accelerating and promoting germination of tulipa seeds and application of the bacterial strain, the bacterial strain is obtained by being separated from soil of tulipa germinating seedlings, the bacterial strain is identified as aspergillus niger through ITS sequence sequencing after being purified, the taxonomic name is Aspergillus niger, and the preservation number of the bacterial strain is CCTCC NO: M 2025709. Through an associated germination test of the strain and tulipa plant seeds, the result shows that the strain can obviously accelerate the germination of the tulipa seeds and improve the germination rate of the tulipa seeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a strain for promoting germination of jatropha seeds and an application thereof. Background Art

[0002] Tulipa edulis (Miq.) Baker is a member of the genus Tulipa in the Liliaceae family. Its dried bulbs, after the bark is removed, are the traditional Chinese medicinal herb "Guangcigu." Tulipa edulis is quite particular about its growing environment, primarily found in sunny, well-drained areas such as hillside meadows, roadsides, and forest edges. However, the ongoing deterioration of the ecological environment and the significant human disturbance of its native habitat have hindered Tulipa edulis's natural growth in the wild. Furthermore, the recent development of its anti-cancer properties in medicine has led to a sharp decline in its wild resources. Expanding production through artificial cultivation has become an effective way to meet market demand. Tulipa edulis possesses significant medicinal value, with its bulb being the primary medicinal part. Modern medical research has shown that Tulipa edulis possesses anti-tumor and antibacterial activities, posing a significant potential for its use in the medical field. Consequently, it has attracted considerable attention and holds significant scientific and economic value.

[0003] Due to the unique structure of its seeds, germination naturally requires specific environmental conditions and biological factors, resulting in a typically low germination rate, slow growth, and a long growth cycle. Currently, artificial cultivation of this plant relies primarily on asexual propagation of bulbs, but this method has a low reproduction coefficient, limiting its scalability and making it difficult to meet the growing market demand for its medicinal material. This, in turn, contributes to the high price of the herb. Therefore, sexual propagation has become a potential method for expanding production.

[0004] In summary, screening out the key factors that can effectively promote the germination of old crow petals seeds or developing applicable technical means are of great significance to significantly improve its seed germination rate, which will lay a solid foundation for the rational protection of old crow petals resources and subsequent large-scale artificial cultivation. Summary of the Invention

[0005] The present invention mainly aims at the above technical problems, provides a strain for promoting the germination of old crow petals seeds, and provides a specific application method of the strain in promoting the germination of old crow petals seeds.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a companion strain for promoting seed germination of Liliaceae plants, characterized in that the ITS sequence of the strain comprises a sequence having more than 99% identity with the sequence shown in SEQ ID NO.1.

[0008] In a preferred embodiment, the ITS sequence of the strain comprises the sequence shown in SEQ ID NO.1.

[0009] In a preferred embodiment, the companion strain that promotes seed germination of Liliaceae plants is Aspergillus niger AN01, which was deposited in the China Center for Type Culture Collection, Wuhan City, Hubei Province on April 7, 2025. The deposit address is China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the strain deposit number is CCTCC NO: M 2025709.

[0010] In another aspect, the present invention provides a seed soaking solution, seed soaking powder or microbial agent comprising the strain, which can promote germination of Liliaceae plant seeds.

[0011] Furthermore, the plant is a plant of the genus Corvina.

[0012] In another aspect, the present invention provides a use of any of the aforementioned strains in promoting plant seed germination.

[0013] Furthermore, the plant is a plant of the Liliaceae family.

[0014] Furthermore, the plant is a plant of the genus Corvina.

[0015] Furthermore, the strain is used to shorten the germination time of plant seeds and / or increase the germination rate of plant seeds.

[0016] In another aspect, the present invention provides a use of any one of the aforementioned strains in promoting protocorm formation from plant seeds.

[0017] Furthermore, the plant is a plant of the Liliaceae family.

[0018] Furthermore, the plant is a plant of the genus Corvina.

[0019] In another aspect, the present invention provides a method for promoting plant seed germination, comprising the steps of:

[0020] 1) combining a bacterial substrate containing any one of the aforementioned strains and / or its metabolites with a seed germination substrate to form a bacterial substrate;

[0021] 2) contacting the seeds with the bacterial substrate;

[0022] 3) Keep the substrate moist.

[0023] In a preferred embodiment, the bacterial medium contains only bacterial strains.

[0024] Furthermore, the combination of the bacterial material and the seed germination matrix is ​​to mix the bacterial material into the matrix or place the bacterial material on the surface of the matrix to form a bacterial-containing matrix.

[0025] Furthermore, the step of contacting the seeds with the bacteria-containing matrix is ​​to sow the seeds into the matrix.

[0026] Furthermore, the maintaining the substrate in a moist state is to spray water to maintain the substrate in a moist state.

[0027] Furthermore, the plant is a plant of the Liliaceae family.

[0028] Furthermore, the plant is a plant of the genus Corvina.

[0029] In another aspect, the present invention provides a method for promoting the formation of protocorms from plant seeds, comprising the following steps:

[0030] 1) combining a bacterial substrate containing any one of the aforementioned strains and / or its metabolites with a seed germination substrate to form a bacterial substrate;

[0031] 2) contacting the seeds with the bacterial substrate;

[0032] 3) Keep the substrate moist.

[0033] In a preferred embodiment, the bacterial medium contains only bacterial strains.

[0034] Furthermore, the combination of the fungus material and the seed germination matrix is ​​to mix the fungus material into the matrix to form a fungus-containing matrix.

[0035] Furthermore, the step of contacting the seeds with the bacteria-containing matrix is ​​to sow the seeds into the matrix.

[0036] Furthermore, the maintaining the substrate in a moist state is to spray water to maintain the substrate in a moist state.

[0037] Furthermore, the plant is a plant of the Liliaceae family.

[0038] Furthermore, the plant is a plant of the genus Corvina.

[0039] In another aspect, the present invention provides a DNA barcode for identifying Aspergillus niger, wherein the DNA barcode comprises the sequence as set forth in SEQ ID NO.1, or a sequence that is reverse complementary to the sequence as set forth in SEQ ID NO.1.

[0040] Furthermore, the Aspergillus niger is a fungus deposited on April 7, 2025 in the China Type Culture Collection Center in Wuhan City, Hubei Province, with the deposit address being China Type Culture Collection Center of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the strain deposit number being CCTCC NO: M 2025709.

[0041] In another aspect, the present invention provides a use of the aforementioned DNA barcode in identifying Aspergillus niger.

[0042] In another aspect, the present invention provides a method for identifying Aspergillus niger, the method comprising:

[0043] (1) Extracting DNA from the fungal genome to be tested,

[0044] (2) PCR was performed using primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3',

[0045] (3) Sequencing of PCR products,

[0046] (4) Determine the specific species of the fungus based on the sequencing results. When the sequencing results are consistent with the aforementioned DNA barcode sequence, it is determined that the fungus to be detected is the same fungus as the strain deposited in the China Center for Type Culture Collection, Wuhan City, Hubei Province on April 7, 2025, with the deposit address being the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the strain deposit number being CCTCC NO: M 2025709.

[0047] Compared with the prior art, the present invention has the following advantages:

[0048] 1) The present invention provides a new strain that can significantly promote the germination of Corynebacterium seeds.

[0049] 2) The method of the present invention can promote the germination of Corynebacterium seeds, increase the germination rate of Corynebacterium seeds and shorten the germination days of Corynebacterium seeds, thereby laying a foundation for the rational protection of its resources and large-scale planting. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The beneficial effects of the present invention are described in detail below with reference to the accompanying drawings and specific embodiments.

[0051] Figure 1 The bacterial strain isolated by the present invention (deposit number is CCTCC NO: M 2025709) is cultured on a PDA plate to form colonies, which have visible colony morphological characteristics, including Figure 1 A is a frontal photo of the flat plate bacteria. Figure 1 B is a photo of the reverse side of the bacterial plate.

[0052] Figure 2 The strain of the present invention is used to accompany the old crow petal seeds ( Figure 2 A) Photo of germination at 95 days and the uninfected old crow petals seeds ( Figure 2B) Photograph of germination at 120 days. DETAILED DESCRIPTION

[0053] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0054] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0055] Example

[0056] Example 1: Isolation, purification, and identification of strains

[0057] Isolation and purification of the strain: The humus soil under the wild old crow petal tuber was collected in the medicinal plant garden of Wanxi College, Yu'an District, Lu'an City, Anhui Province. Most of the impurities in the soil were selected and separated and removed. The soil was inoculated into the prepared potato dextrose agar medium (PDA) in the clean bench. Three plates were inoculated at the same time as the primary culture medium. The inoculated plates were placed in a 28°C constant temperature incubator for dark culture. Every three days was the time limit. According to the different morphology and size of the new colonies, different colonies (including the solid culture medium in the corresponding area) were cut out with different sterile surgical blades and placed in new culture medium. Purification culture was carried out in turn, and this was repeated until pure culture colonies were obtained through purification and separation. The isolated strain was named AN01. The isolation culture medium was PDA culture medium purchased from Guangdong Huankai Microbiology Technology Co., Ltd. and prepared by adding 1L of deionized water to every 40.1g according to its instructions.

[0058] Identification of strains:

[0059] 1. Morphological observation (see Figure 1 ): On potato dextrose agar (PDA), Aspergillus niger colonies are usually white at the beginning and gradually turn black or dark brown as they grow. The texture of the colony is generally velvety or flocculent, with radial wrinkles on the surface and neat or irregular edges. The colony grows quickly and can cover a large area in a short period of time. The mycelium of Aspergillus niger is composed of many branched hyphae. The hyphae are colorless or light-colored, have transverse septa, and are multicellular hyphae. There are two types of hyphae, one is the vegetative hyphae, which creeps on the surface of the culture medium and is responsible for absorbing nutrients; the other is the aerial hyphae, which grows vertically from the vegetative hyphae into the air and can further differentiate to produce structures such as conidiophores.

[0060] 2. Molecular identification:

[0061] (1) Fungal genomic DNA extraction: The strain DNA was extracted using the SoLarbio Fungal Genomic DNA Extraction Kit, and the concentration and purity of the DNA were detected using a multifunctional microplate reader.

[0062] (2) Primer design: The ITS sequence of ribosomal DNA was designed and synthesized by General Biotechnology (Anhui) Co., Ltd. The primer sequences were ITS1 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4 5'-TCCTCCGCTTATTGATATGC-3'.

[0063] (3) PCR amplification system:

[0064] Reagents <![CDATA[Volume( μL )]]> DNA 2 <![CDATA[Enzyme (2x Taq Plus Master Mixll )]]> 10 Primer F 0.5 Primer R 0.5 Double distilled water 7

[0065] (4) PCR cycling conditions:

[0066]

[0067] (5) Sequencing results: Molecular sequencing and strain identification were performed by General Biotechnology (Anhui) Co., Ltd. The ITS sequences of the sequencing results were compared with NCBI using BLAST for homology. The comparison results were compared with a similarity of more than 99% as the standard for molecular identification of the strain, and the identification result was Aspergillus niger.

[0068] The strain isolated in this example was deposited on April 7, 2025 in the China Center for Type Culture Collection, Wuhan City, Hubei Province. The deposit address is China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The strain deposit number is CCTCC NO: M 2025709.

[0069] 5'-GGCTCGAGTGCGGGTCTTTGGGCCCACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCG

[0070] GCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGT

[0071] CTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAA

[0072] TGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGG

[0073] GGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGG

[0074] GCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCG

[0075] CCTGCCGACGTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAA

[0076] AGTCCCGGAGGAACG-3'(SEQ ID NO.1)

[0077] Example 2 Aspergillus niger AN01 strain promotes germination of old crow petals seeds

[0078] In order to verify that the Aspergillus niger strain isolated in the present invention has the effect of promoting the germination of old crow petals, a comparative test on promoting seed germination was conducted between the strains AN01 obtained in the present invention and the strains without inoculation. The strain was AN01 (obtained in the present invention).

[0079] 2.1 Materials

[0080] Potato dextrose agar (PDA), Solanum lycopersicum seeds, and Aspergillus niger AN01 strain.

[0081] 2.2 Methods

[0082] 2.2.1 Prepare a slant medium for culturing the AN01 strain: Use potato dextrose agar (PDA, 5 g / L potato extract, 15 g / L agar, 20 g / L glucose, 0.1 g / L chloramphenicol, pH 5.8-6.2). Sterilize the prepared medium at 121°C for 20 minutes before use.

[0083] 2.2.2 Soaking of old crow petal seeds and isolation and preparation of bacterial suspension of Aspergillus niger: soak the old crow petal seeds in a KMnO4 solution with a mass percentage concentration of 0.3% as a disinfectant for 5 minutes, rinse thoroughly after soaking, and then soak in water for 12-36 hours. After soaking, take out and set aside; inoculate the strain into the slant culture medium to form spores, inject 3-5 ml of sterile water under sterile conditions, and gently scrape off the bacterial moss with an inoculation loop or spatula to make a bacterial suspension.

[0084] 2.2.3 Grouping: Prepare two groups of sterilized river sand, one as a control group and the other as an experimental group. Inoculate the experimental group's river sand with Aspergillus niger, while the control group's river sand remains uninoculated (use a sterile pipette to pipette the bacterial solution into the sand until it is completely saturated).

[0085] 2.2.4 Sowing and cultivation: Mix the soaked seeds with fine river sand evenly, and make 3 replicates for each group. Each replicate contains 30 mature seeds and an equal amount of river sand. Place them in the dark at 20℃ for 50 days; then place them in the dark at 4℃ for 30 days; and then cultivate them in the dark at 15℃.

[0086] 2.2.5 Cultivation and Observation: Two groups of cultivation devices with seeds buried in wet sand were placed under the same and suitable environmental conditions for cultivation and observation. After cultivation in the dark at 15°C, the seed germination was observed every three days, and the number of days required for germination (calculated by the first seed seedling breaking through the seed coat and the sand) and the number of germinations at different germination stages were recorded and counted (the seedling breaking through the seed coat and the sand was used as a sign of seed germination, and the observation was continued until no new seeds germinated for 10 consecutive days). It was observed that after cultivation in the dark at 15°C, the sterile seeds germinated in 9-16 days, and the sterile seeds germinated in 36-40 days. The statistical results of 3 repeated groups in the treatment group and the control group are shown in Tables 1 and 2.

[0087] Table 1 Statistics of seed germination days

[0088]

[0089] Table 2 Seed germination rate statistics

[0090] Treatment group Germination rate Baohua Old Crow Petals (with fungus) 33.30% Baohua Old Crow Petals (with fungus) 36.70% Baohua Old Crow Petals (with fungus) 40% Baohua old crow petals (sterile) 10% Baohua old crow petals (sterile) 6.70% Baohua old crow petals (sterile) 13.3%

[0091] As can be seen from the above, the seed germination rate in wet sand containing the black mold of the present invention is significantly higher than that in wet sand without bacteria, and the number of days required for seed germination in wet sand containing the black mold of the present invention is significantly lower than that in wet sand without bacteria. It can be seen that the black Aspergillus isolated and obtained by the present invention can promote the early germination of old crow petal seeds and increase the germination rate.

[0092] Based on the disclosure and teachings of the above description, those skilled in the art may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and any modifications and variations of the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although certain specific terms are used in this description, these terms are only for convenience of description and do not constitute any limitation to the present invention.

Claims

1. A strain for promoting seed germination of lily plants, characterized in that: The ITS sequence of the strain comprises the sequence of SEQ ID NO.

1.

2. A strain for promoting seed germination of lily plants according to claim 1, characterized in that: The strain is Aspergillus niger, which was deposited in the China Type Culture Collection Center in Wuhan City, Hubei Province on April 7, 2025. The storage address is China Type Culture Collection Center of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The strain collection number is CCTCCNO: M 2025709.

3. A seed soaking solution or seed soaking powder or bacterial agent, comprising the strain according to any one of claims 1-2.

4. Use of the strain according to any one of claims 1 to 2 in promoting seed germination of lily plants.

5. The use according to claim 4, characterized in that The Liliaceae plant is a plant of the genus Coriolus.

6. The use according to claim 4, characterized in that The strain is used for shortening the germination time of plant seeds and / or increasing the germination rate of plant seeds.

7. A method for promoting seed germination of lily plants, characterized in that: The following steps are involved: 1) combining a bacterial substrate containing the strain according to any one of claims 1 to 2 and / or its metabolites with a seed germination substrate to form a bacterial substrate; 2) contacting the seeds with the bacterial substrate; 3) Keep the substrate moist.

8. A DNA barcode for identifying Aspergillus niger, characterized in that: The DNA barcode comprises the sequence as set forth in SEQ ID NO.1, or a sequence that is reverse complementary to the sequence as set forth in SEQ ID NO.

1.

9. Use of the DNA barcode according to claim 8 in identifying Aspergillus niger.

10. A method for identifying Aspergillus niger, characterized in that: The method comprises, (1) Extracting DNA from the fungal genome to be tested, (2) PCR was performed using primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3', (3) Sequencing of PCR products, (4) Determine the specific species of the fungus based on the sequencing results. When the sequencing results are consistent with the DNA barcode sequence described in claim 8, the fungus to be detected is determined to be the same fungus as the strain described in claim 1 or 2.

Citation Information

Patent Citations

  • Aspergillus niger strain having highly-resistant activity to carbendazol and uses thereof

    CN101182469A

  • Method for promoting germination of seeds of Tulipa edulis (Miq.) Baker

    CN102792803A

  • Method for breaking hard seed dormancy in astragalus seeds

    CN102870524A

  • Phosphorus-dissolving fungi and method for preparing biological phosphate fertilizer through fermenting edible fungi residues by phosphorus-dissolving fungi

    CN103695318A

  • Method for improving seedling cultivating quality

    CN106105488A