Soybean efficient nitrogen fixation bradyrhizobium Bott59 and application thereof

Abstract

The invention discloses a soybean efficient nitrogen-fixing bradyrhizobium Bott59 and application thereof, and relates to the technical field of soybean planting, the key points of the technical scheme are that the efficient nitrogen-fixing bradyrhizobium is extracted from Ahonor black soil of Inner Mongolia, the strain can generate a good symbiotic relationship with soybeans, and the growth and development of soybean plants are remarkably promoted. The bradyrhizobium Bott59 can reduce the dependence of soybeans on nitrogen, effectively alleviates the problem of nitrogen balance, and is of great significance to development of green and sustainable agriculture and increase of soybean yield.

Description

Technical Field

[0001] The present invention relates to the technical field of soybean planting, and more particularly to a soybean high-efficiency nitrogen-fixing Bradyrhizobium Bott59 and applications thereof. Background Art

[0002] Nitrogen is an essential element for plant growth and a key component of proteins, nucleic acids, lecithin, chlorophyll, plant hormones, and vitamins in plants. In recent years, the decline in soil fertility caused by overcultivation and the excess fertility caused by overfertilization have become urgent issues that need to be addressed in the development of green agriculture. In agricultural ecological environments, approximately 78% of biological nitrogen fixation is due to symbiotic nitrogen fixation (SNF) between rhizobia in the soil and legumes. This symbiotic relationship can convert inorganic nitrogen in the environment into organic nitrogen and incorporate organic nitrogen into the metabolism of the host plant, providing nitrogen nutrition for the legumes. Symbiotic nitrogen fixation between legumes and rhizobia reduces the host plant's dependence on nitrogen in the soil, reduces nitrogen pollution in the air, and effectively alleviates the problem of nitrogen balance. This is of great significance for the development of green and sustainable agriculture and the increase of crop yields.

[0003] As one of the most important food crops in the legume family, soybeans rely on their symbiotic nitrogen-fixing ability with rhizobia to determine their timely nitrogen supplementation, thus impacting soybean yield. Soybean and rhizobium nodulation and nitrogen fixation can reduce the use of nitrogen fertilizers. Soybean varieties have specific recognition abilities for different rhizobia, resulting in varying nodulation efficiencies when infected with different rhizobia. Furthermore, the indigenous rhizobia in the soils of my country's major soybean-producing regions vary. Therefore, extracting indigenous rhizobia from major soybean-producing regions, screening for efficient nitrogen-fixing rhizobia, and applying them in production are crucial for boosting the soybean industry. Summary of the Invention

[0004] The present invention aims to provide a soybean efficient nitrogen-fixing Bradyrhizobium Bott59 and its application, which can reduce soybean's dependence on nitrogen, effectively alleviate the problem of nitrogen balance, and is of great significance to the development of green and sustainable agriculture and the increase of soybean yield.

[0005] The above technical objectives of the present invention are achieved through the following technical solutions: a soybean efficient nitrogen-fixing bradyrhizobium Bott59, the nitrogen-fixing bradyrhizobium Bott59 is isolated from soybeans in the black soil soybean planting area of ​​Arong Banner, Inner Mongolia, and is classified and named: Bradyrhizobium ottawaense. The nitrogen-fixing bradyrhizobium Bott59 has a preservation number of CGMCC No.34036 and is preserved in the General Microbiology Center of the China Culture Collection Administration.

[0006] The present invention also provides a bacterial agent containing soybean high-efficiency nitrogen-fixing Bradyrhizobium Bott59, wherein the bacterial agent uses Bradyrhizobium Bott59 as an active ingredient.

[0007] The present invention also provides a biological fertilizer containing soybean high-efficiency nitrogen-fixing Bradyrhizobium Bott59. The biological fertilizer comprises Bradyrhizobium Bott59 and a fertilizer carrier.

[0008] The present invention also provides the soybean efficient nitrogen-fixing Bradyrhizobium Bott59 bacterial solution, which is prepared by adding Bradyrhizobium Bott59 to a plant nutrient solution and mixing until the bacterial solution concentration OD600 is 0.1.

[0009] Furthermore, the plant nutrient solution is a nitrogen-free nutrient solution.

[0010] The present invention also provides an application of a soybean high-efficiency nitrogen-fixing bradyrhizobium Bott59. When the bradyrhizobium Bott59 is inoculated into soybean roots or soybean rhizosphere soil, the stress tolerance of soybean can be improved, soybean nodulation and nitrogen fixation can be promoted, the growth and development of soybean plants can be promoted, and soybean yield can be increased.

[0011] In summary, the present invention has the following beneficial effects: the present invention extracts a highly efficient nitrogen-fixing bradyrhizobium from the black soil of Arong Banner, Inner Mongolia. The strain can produce a good symbiotic relationship with soybeans and significantly promote the growth and development of soybean plants. After inoculating different soybean materials with Bott59, the plant height, petiole number, chlorophyll content and other indicators of the soybean plants can be significantly improved compared with those without inoculation, and it has potential application value in increasing soybean yield and reducing nitrogen fertilizer application. The application of the bradyrhizobium Bott59 of the present invention can reduce soybean's dependence on nitrogen, effectively alleviate the problem of nitrogen balance, and is of great significance to the development of green and sustainable agriculture and the increase of soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the phenotype of the Wm82 soybean plant after Bott59 infects the soybean plant in the embodiment of the present invention;

[0013] Figure 2 It is the identification of phenotypic traits of soybean plants after inoculation with Bott59 in the embodiment of the present invention;

[0014] Figure 3 This is the colony morphology of the Bott59 strain on YMB medium in the embodiment of the present invention;

[0015] Figure 4 16S rDNA phylogenetic tree of the Bott59 strain in the examples of the present invention. DETAILED DESCRIPTION

[0016] The following is combined with Figure 1-4 The present invention is described in further detail.

[0017] Example: The bradyrhizobium of the present invention was isolated from soybeans grown in the black soil soybean area of ​​Arong Banner, Inner Mongolia. The separation and purification method was as follows:

[0018] Nodule collection and cleaning: Fresh nodules were obtained from the soybean root system and rinsed repeatedly with sterile water for 5 times to remove surface soil impurities.

[0019] Surface disinfection: Immerse the nodules in 70% ethanol solution (v / v) and let it sit for 1 minute. Then transfer them to 4% sodium hypochlorite solution (v / v) and soak for 3 minutes to completely inactivate surface microorganisms.

[0020] Final cleaning: Rinse again with sterile water 5 times to remove residual disinfectant.

[0021] Nodule crushing and bacterial isolation: Under sterile conditions, use blunt-tipped forceps to gently crush the nodules until they are broken. Use an inoculating loop to collect the sap from the nodules and streak the solution evenly onto Yeast-Mannitol Medium (YMB).

[0022] Culture and Observation: Place the inoculated plate in a 28°C incubator and observe every 24 hours. Once a single, transparent colony appears on the surface of the culture medium, select the colony for purification and subsequent identification.

[0023] Identification of Rhizobium genus, identified by 16sRDNA_F / R:

[0024] F: 5'--3': AGAGTTTGATCCTGGCTCAG;

[0025] R: 5'--3': AAGGAGGTGATCCAGCC.

[0026] use PCR amplification was performed using Flash Master Mix High-Fidelity PCR Kit (Novagen).

[0027] The PCR reaction conditions were as follows: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 72°C for 15 s, for a total of 35 cycles; final extension at 72°C for 5 min;

[0028] The PCR amplification system was: 2× FlashMasterMix 7.5 μL, F 0.5 μL, R 0.5 μL, DNA template 1 μL, and ddH2O 5.5 μL.

[0029] Sanger sequencing was used to obtain the sequence information of the target fragment, and the NCBI database was used for Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) to determine the bacterial genus.

[0030] A total of 51 strains of soybean rhizobia were isolated from soybean cultivation areas in Northeast China. These strains were then inoculated into different soybean varieties. Twenty-one days after inoculation, the number of nodules, aboveground fresh weight, belowground fresh weight, aboveground dry weight, and belowground dry weight of the plants were assessed. Principal component analysis was used to comprehensively evaluate the effects of the different strains on soybean plant growth.

[0031] Table 1 Comprehensive evaluation of 151 rhizobia

[0032]

[0033]

[0034] We found that strain 59 received the highest comprehensive evaluation score, suggesting that it can form a favorable symbiosis with soybeans and promote soybean growth. Key morphological and biological characteristics of strain 59 include white colonies with smooth, raised edges on YMB plates. It can grow at 28°C on plates containing mannitol, yeast extract, glucose, and lactose as carbon sources, with an optimal pH range of pH 6-9. It is resistant to trimethoprim, ampicillin, kanamycin, and chloramphenicol. Based on its morphological characteristics, phylogenetic tree analysis of its 16S rDNA gene sequence, and genome sequencing, strain 59 was identified as belonging to the genus Bradyrhizobium ottawaense and was therefore named Bott59.

[0035] This specific embodiment is merely an explanation of the present invention and is not intended to limit the present invention. After reading this specification, those skilled in the art may make non-creative modifications to this embodiment as needed. However, as long as such modifications are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A soybean high-efficiency nitrogen-fixing Bradyrhizobium strain Bott59, characterized by: The nitrogen-fixing Bradyrhizobium Bott59 is deposited under the CGMCC No. 34036.

2. A bacterial agent containing the soybean efficient nitrogen-fixing Bradyrhizobium Bott59 according to claim 1, characterized in that: The bacterial agent uses Bradyrhizobium Bott59 as an active ingredient.

3. A biological fertilizer containing the soybean efficient nitrogen-fixing Bradyrhizobium Bott59 according to claim 1, characterized in that: The biological fertilizer comprises Bradyrhizobium Bott59 and a fertilizer carrier.

4. The soybean efficient nitrogen-fixing Bradyrhizobium Bott59 bacterial solution according to claim 1, characterized in that: The Bradyrhizobium Bott59 bacterial solution is prepared by adding Bradyrhizobium Bott59 into a plant nutrient solution and mixing the mixture until the bacterial solution concentration OD600 is 0.

1.

5. The soybean efficient nitrogen-fixing Bradyrhizobium Bott59 bacterial solution according to claim 4, characterized in that: The plant nutrient solution is a nitrogen-free nutrient solution.

6. The use of a soybean efficient nitrogen-fixing Bradyrhizobium Bott59 according to claim 1, characterized in that: Inoculating the bradyrhizobium Bott59 into soybean roots or soybean rhizosphere soil can improve soybean stress tolerance, promote soybean nodulation and nitrogen fixation, promote the growth and development of soybean plants, and increase soybean yield.

Images