Method for improving high temperature tolerance and L-tryptophan production capacity of corynebacterium glutamicum
By inhibiting the expression of the osrR gene of Corynebacterium glutamicum and editing it using CRISPR-Cas9 technology, the high temperature tolerance and L-tryptophan production capacity of the recombinant Corynebacterium glutamicum were improved, solving the problem of biomass and yield inhibition under high temperature conditions and achieving efficient high-temperature fermentation production of L-tryptophan.
Patent Information
- Application Number
- CN202510711867.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-09-19
AI Technical Summary
The biomass growth of wild-type Corynebacterium glutamicum is inhibited under high temperature conditions, affecting its high-temperature fermentation production capacity, especially the production of L-tryptophan.
By inhibiting the expression of the osrR gene, the CRISPR-Cas9 technology was used to edit the Corynebacterium glutamicum genome, the expression level of the osrR gene was regulated, and the high temperature tolerance and L-tryptophan production capacity of the recombinant Corynebacterium glutamicum were improved.
The biomass accumulation and L-tryptophan production of recombinant Corynebacterium glutamicum under high temperature conditions were significantly improved, thereby enhancing the efficiency and economy of high temperature fermentation production.
Smart Images
Figure FT_1 
Figure FT_2
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for improving the high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum. Background Art
[0002] Temperature is an important parameter in the microbial fermentation process. It not only affects the expression and activity of enzymes in the product synthesis pathway, but is also closely related to cell growth and metabolism. Increasing the temperature of the fermentation process can not only significantly increase the fermentation rate, but also reduce the cooling cost of the industrial fermentation process, avoid the risk of contamination by mesophilic bacteria, and thus significantly improve the economy of the production process. However, high temperature conditions often destroy the cell membrane structure, interfere with the normal function of biological macromolecules, and have an adverse effect on cell viability and production capacity. Wild-type Corynebacterium glutamicum exhibits the best growth rate at 30°C, but when the temperature is increased to 40°C, its biomass growth is usually significantly inhibited. Therefore, improving the high temperature tolerance of Corynebacterium glutamicum is an important direction to improve its industrial robustness and promote the high-temperature fermentation production of target compounds. Summary of the Invention
[0003] The present invention aims to provide a method for improving the high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum, in particular to provide a novel high temperature tolerance-related gene in Corynebacterium glutamicum, and by regulating its expression level, significantly improving the growth metabolic capacity and L-tryptophan production of recombinant Corynebacterium glutamicum under high temperature conditions.
[0004] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides an engineered bacterium of Corynebacterium glutamicum, which is obtained by inhibiting Corynebacterium glutamicum ( Corynebacterium glutamicum ) osrR Gene expression constructs were obtained.
[0005] In the present invention, the Corynebacterium glutamicum-derived osrR The gene is a gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b) A protein derived from (a) with equivalent function, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 1.
[0006] The starting strain of the engineered bacteria is Corynebacterium glutamicum having the ability to produce tryptophan, for example, recombinant Corynebacterium glutamicum TR26 (Synthetic and Systems Biotechnology 10 (2025) 511–522).
[0007] In the second aspect, the present invention provides a method for constructing the engineered bacteria, using gene editing technology to inhibit Corynebacterium glutamicum osrR Gene.
[0008] Preferably, the gene editing technology can be selected from CRISPR, TALEN and ZFN, etc.
[0009] In one embodiment of the present invention, CRISPR gene editing technology is used to inhibit Corynebacterium glutamicum osrR Gene: Corynebacterium glutamicum osrR The gene is used as the target, an sgRNA sequence based on CRISPR-Cas9 is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR-Cas9, Corynebacterium glutamicum is transformed, and positive transformants are screened.
[0010] Preferably, the nucleotide sequence of the sgRNA action site is 5'-CGGTGGAATCCACGCTGTCT-3'.
[0011] In a third aspect, the present invention provides the use of the engineered bacteria in the fermentation production of L-tryptophan.
[0012] In a fourth aspect, the present invention provides a method for improving the high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum, comprising: a) culturing the engineered bacteria to obtain a microbial culture; b) collecting the produced L-tryptophan from the culture obtained in step a).
[0013] Furthermore, the biomass accumulation of the engineered bacteria under high temperature (>30°C, preferably 40°C) culture conditions is improved, and the L-tryptophan production under 33.5°C culture conditions is improved.
[0014] In a fifth aspect, the present invention provides osrR Application of gene suppression in improving high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum.
[0015] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention provides a new target for high temperature tolerance-related genes of Corynebacterium glutamicum osrR By regulating its expression level, the authors significantly increased biomass accumulation of Corynebacterium glutamicum under high-temperature conditions and improved L-tryptophan fermentation yield of recombinant Corynebacterium glutamicum under high-temperature conditions. Specifically, by reducing its expression level, biomass accumulation of recombinant Corynebacterium glutamicum at 40°C and L-tryptophan yield at 33.5°C were significantly increased. This invention provides support for high-temperature fermentation production of L-tryptophan and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is a shake flask culture test at 40°C in a preferred embodiment of the present invention. MB001-NC, MB001 strain containing a non-targeting sgRNA plasmid; MB001-osrR, gene osrR MB001 strain with suppressed expression.
[0017] Figure 2 The L-tryptophan production of the recombinant strain at 33.5°C in a preferred embodiment of the present invention is shown. TR26-NC represents a TR26 strain containing a non-targeting sgRNA plasmid, and TR26-osrR represents a TR26 strain containing a targeting sgRNA plasmid. osrR TR26 strain containing the gene sgRNA plasmid. DETAILED DESCRIPTION
[0018] The present invention mainly provides a novel high-temperature tolerance-associated gene in Corynebacterium glutamicum, and develops a method for improving the high-temperature tolerance of recombinant microorganisms and the L-tryptophan fermentation yield by regulating the expression level of the gene.
[0019] The present invention realizes the improvement of high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum by the following method: osrR The expression level of recombinant Corynebacterium glutamicum was increased to improve the high temperature tolerance and L-tryptophan production capacity. The main methods include: (1) inhibiting the expression of the new high temperature tolerance gene target of wild-type Corynebacterium glutamicum and evaluating its high temperature tolerance through shake flask culture at different temperatures; (2) fermenting the recombinant Corynebacterium glutamicum with high L-tryptophan production in shake flasks at different temperatures to detect L-tryptophan production.
[0020] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0021] The recombinant strain TR26 of Corynebacterium glutamicum used in the following examples was provided by Associate Professor Chen Zhen of the Department of Chemical Engineering at Tsinghua University. Wild-type strain MB001 of Corynebacterium glutamicum (Synthetic and Systems Biotechnology 10(2025) 511–522) was purchased from Addgene. The pD9SG plasmid was also purchased from Addgene.
[0022] Example 1 Shake flask culture of a novel strain with suppressed expression of genes associated with high temperature tolerance Suppression of genes in wild-type strain MB001 of Corynebacterium glutamicum osrR(amino acid and nucleic acid sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively) to obtain strain MB001-osrR, and strain MB001-NC containing a non-targeting sgRNA plasmid was used as a control. The above recombinant strains were cultured in shake flasks to evaluate the gene osrR The expression inhibition improves the high temperature tolerance of Corynebacterium glutamicum.
[0023] Construction method of strain MB001-osrR: connect the targeting osrR The pD9SG-osrR plasmid containing the gene sgRNA sequence was electroporated into the competent cells of Corynebacterium glutamicum MB001 and the cells were cultured on LBHIS plates containing 25 mg / L kanamycin (LBHIS-kan25). osrR The pD9SG plasmid is an Escherichia coli-Corynebacterium glutamicum shuttle plasmid (Yu et al., Metab Eng, 75, 192-204, 2023), which contains the dCas9 coding sequence and sgRNA cassette on its backbone.
[0024] Construction method of strain MB001-NC: The pD9SG-NC plasmid connected with the non-targeting sgRNA sequence was electroporated into the competent cells of Corynebacterium glutamicum MB001 and cultured on LBHIS plates containing 25 mg / L kanamycin (LBHIS-kan25). osrR Recombinant strains with transcriptional repression.
[0025] Construction method of pD9SG-osrR plasmid: by gene osrR The complementary single-stranded oligonucleotide primers R1 (TGTGGCGGTGGAATCCACGCTGTCTG) and R2 (AAAACAGACAGCGTGGATTCCACCGC) containing the BsaI sticky end sequence were synthesized based on the sgRNA sequence (CGGTGGAATCCACGCTGTCT). The primers R1 and R2 were annealed to obtain a double-stranded oligonucleotide containing the BsaI sticky end, which was then ligated to the pD9SG plasmid digested with BsaI endonuclease using T4 ligase to obtain a plasmid that can achieve gene expression. osrR Transcription repressor pD9SG-osrR plasmid.
[0026] Method for constructing the pD9SG-NC plasmid: Complementary single-stranded oligonucleotide primers N1 (TGTGG CACTGTATTAATTTACGCATG) and N2 (AAAACATGCTAAATTAATACAGTGC) containing BsaI sticky end sequences were synthesized according to the non-targeting sgRNA sequence (CACTGTATTAATTTACGCAT). Primers N1 and N2 were annealed to obtain a double-stranded oligonucleotide containing BsaI sticky ends, which was ligated to the pD9SG plasmid digested with BsaI endonuclease using T4 ligase to obtain the pD9SG-NC plasmid with no gene transcription inhibition.
[0027] The shake flask culture steps of the recombinant strain are as follows: (1) Activation of bacterial strains: Streak the C. glutamicum strain stored at -70°C onto LB-kan25 (LB medium containing 25 mg / L kanamycin) plates and place them in a 30°C incubator for activation culture for 14-16 h.
[0028] (2) Seed culture: Use a 250 mL baffled shake flask with a 20 mL liquid volume. Pick a loop of freshly activated bacteria with an inoculating loop and inoculate it into fresh LBHIS medium. Incubate at 30°C and 200 rpm for 14-16 hours. The composition of LBHIS medium is: sodium chloride 5 g / L, peptone 5 g / L, yeast extract 2.5 g / L, brain heart extract 18.5 g / L, and sorbitol 91 g / L.
[0029] (3) Fermentation culture: Use a 500 mL baffled shake flask with a liquid volume of 30 mL, inoculate the cultured seed liquid into fresh LBHIS medium, and control the OD after inoculation. 600 =0.03, cultured at 40°C and 200 rpm for 24 h.
[0030] The results of shake flask culture were as follows Figure 1 As shown, at 40℃, osrR The expression inhibition strain showed obvious growth advantage, and its early growth rate was higher than that of the control group (MB001-NC). 600 The value increased by 26.7% compared with the control group, indicating that osrR The expression inhibition of glutamicum can significantly improve the high temperature tolerance of Corynebacterium glutamicum.
[0031] Example 2 High-efficiency production of L-tryptophan by recombinant Corynebacterium glutamicum under high temperature conditions Suppression of novel high-temperature tolerance-related genes in the L-tryptophan-high-producing recombinant Corynebacterium glutamicum TR26 (Synthetic and Systems Biotechnology 10 (2025) 511–522)osrR The strain TR26-osrR was obtained by expressing the gene α-tryptophan. The growth, metabolism, and product production of this strain at temperatures above the optimal fermentation temperature were investigated, and its potential for high-temperature fermentation of L-tryptophan was evaluated.
[0032] Construction method of strain TR26-osrR: The pD9SG-osrR plasmid was electroporated into competent cells of Corynebacterium glutamicum TR26 and cultured on LBHIS plates containing 25 mg / L kanamycin (LBHIS-kan25). osrR The recombinant strain with transcriptional inhibition, wherein the construction method of the pD9SG-osrR plasmid is the same as that in Example 1.
[0033] Construction of strain TR26-NC: The pD9SG-NC plasmid was electroporated into competent cells of Corynebacterium glutamicum TR26. A control strain with no gene transcription inhibition was obtained on LBHIS plates containing 25 mg / L kanamycin (LBHIS-kan25). The pD9SG-NC plasmid was constructed using the same method as in Example 1.
[0034] The following process is used for direct fermentation production of L-tryptophan by recombinant Corynebacterium glutamicum: (1) Activation of strains: Streak the Corynebacterium glutamicum strain stored at -70°C onto an LB-kan25 plate and place it in a 30°C incubator for activation culture for 14-16 hours.
[0035] (2) Seed culture: Use a 250 mL baffled shake flask with a 20 mL liquid volume. Pick a loop of newly activated bacteria with an inoculating loop and inoculate it into the shake flask. Incubate at 30°C and 200 rpm for 14-16 h. The composition of the seed culture medium is as follows: sucrose 50 g / L, corn steep liquor 10 g / L, ammonium sulfate 8.3 g / L, potassium dihydrogen phosphate 2 g / L, urea 1 g / L, magnesium sulfate heptahydrate 0.83 g / L, ferrous sulfate heptahydrate 10 mg / L, zinc sulfate heptahydrate 10 mg / L, copper sulfate pentahydrate 1 mg / L, β-alanine 10 mg / L, thiamine hydrochloride 1.5 mg / L, niacin 5 mg / L, D-biotin 0.5 mg / L, calcium carbonate 30 g / L, pH = 7.2.
[0036] (3) Fermentation culture: Use a 500 mL baffled shake flask with a liquid volume of 30 mL. Inoculate the cultured seed liquid into the fermentation medium at an inoculum volume of 5% (v / v). Cultivate at 33.5°C and 200 rpm for 72 h. The composition of the fermentation medium is as follows: glucose 100 g / L, corn steep liquor 10 g / L, ammonium sulfate 45 g / L, potassium dihydrogen phosphate 0.5 g / L, urea 4.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, ferrous sulfate heptahydrate 10 mg / L, manganese sulfate tetrahydrate 1 mg / L, β-alanine 10 mg / L, thiamine hydrochloride 5 mg / L, nicotinic acid 5 mg / L, D-biotin 0.3 mg / L, calcium carbonate 30 g / L, pH = 7.2.
[0037] (4) Product Analysis: The fermentation sample was centrifuged at 12,000 rpm for 5 min. The supernatant was diluted with high-purity water to a concentration of 0.1-1.0 g / L, and filtered through a 0.22 μm filter. L-tryptophan concentration was determined using the 2,4-dinitrofluorobenzene derivatization method and detected using a diamonsil AAA column. The actual concentration of each component was calculated based on the standard curve.
[0038] The shake flask fermentation results were as follows Figure 2 As shown in the figure, when the fermentation temperature was higher than the optimal condition for cell growth (30℃), such as 33.5℃, the L-tryptophan production of strain TR26-osrR increased by 34.5% compared with the control group TR26-NC, reaching 18.2 g / L, indicating that osrR The inhibition of gene expression can effectively improve the L-tryptophan production capacity of the recombinant strain TR26 at 33.5°C, which has important application value for the high-temperature fermentation production of L-tryptophan.
[0039] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. An engineered bacterium of Corynebacterium glutamicum, characterized in that It is achieved by inhibiting Corynebacterium glutamicum ( Corynebacterium glutamicum ) osrR Gene expression construct obtained; Corynebacterium glutamicum osrR The gene is a gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b) A protein derived from (a) with equivalent function, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:
1.
2. The engineered bacteria according to claim 1, characterized in that The starting strain of the engineering bacteria is Corynebacterium glutamicum which has the ability to produce tryptophan.
3. The method for constructing the engineered bacteria according to claim 1 or 2, characterized in that: Using gene editing technology to inhibit Corynebacterium glutamicum osrR Gene.
4. The method according to claim 3, characterized in that The gene editing technology is selected from CRISPR, TALEN and ZFN.
5. The method according to claim 4, characterized in that Corynebacterium glutamicum osrR The gene is used as the target, an sgRNA sequence based on CRISPR-Cas9 is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR-Cas9, Corynebacterium glutamicum is transformed, and positive transformants are screened.
6. The method according to claim 5, characterized in that The nucleotide sequence of the sgRNA action site is 5'-CGGTGGAATCCACGCTGTCT -3'.
7. Use of the engineered bacteria according to claim 1 or 2 in L-tryptophan fermentation production.
8. A method for improving the high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum, characterized in that: include: a) culturing the engineered bacteria according to claim 1 or 2 to obtain a microbial culture; b) collecting the produced L-tryptophan from the culture obtained in step a).
9. The method according to claim 8, characterized in that The biomass accumulation of the engineered bacteria under high temperature culture conditions is improved, and the L-tryptophan production under 33.5°C culture conditions is improved; The high temperature is >30°C, preferably 40°C.
10. osrR Application of gene suppression in improving high temperature tolerance and L-tryptophan production capacity of Corynebacterium glutamicum; Corynebacterium glutamicum osrR The gene is the same as that described in claim 1.