Rice nitrogen efficient gene OsbZIP45 and application thereof
By identifying and cloning the new rice gene OsbZIP45 and using the CRISPR-Cas9 vector to regulate the nitrogen utilization efficiency of rice, the problem of reducing nitrogen fertilizer input and improving nitrogen utilization efficiency without reducing rice yield was solved, thereby achieving an increase in rice biomass and yield.
Patent Information
- Application Number
- CN202510942877.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-09
- Publication Date
- 2025-09-19
AI Technical Summary
How to reduce nitrogen fertilizer input without reducing rice yield, improve nitrogen utilization efficiency of rice, and solve the environmental pollution problem caused by excessive application of nitrogen fertilizer.
By identifying and cloning a new gene OsbZIP45 that regulates rice plant height, effective panicle number and yield, and using CRISPR-Cas9 vectors to knock out or overexpress the gene, the nitrogen utilization efficiency of rice was regulated.
Significantly improve the number of effective rice panicles, plant height and nitrogen utilization rate, enhance rice biomass and yield, solve the technical problems existing in the existing technology, and achieve the effectiveness and product of increasing rice biomass and yield. This part of the technical application includes increasing rice biomass and yield, solving the technical problems existing in the existing technology, and achieving efficient nitrogen utilization.
Smart Images

Figure CN120665900A_ABST
Abstract
Description
Technical Field
[0001] This invention, belonging to the field of biotechnology, relates to a gene that controls the number of effective panicles, plant height, yield, and nitrogen efficiency in rice, and its applications. The invention also relates to the nucleotide and polypeptide sequences encoded by the gene, as well as methods for obtaining high-yield, nitrogen-efficient rice varieties through gene editing. Background Art
[0002] Rice is one of the world's major staple crops, consumed by more than half of the world's population. However, with the continuous growth of population, the reduction of arable land, and the increase in pollution, food security has become a serious challenge. Therefore, increasing rice yields and ensuring food production security are top priorities.
[0003] Nitrogen, as a major plant nutrient, provides a crucial guarantee for food security. However, excessive nitrogen fertilizer input not only increases agricultural production costs but also causes large amounts of nitrogen fertilizer not absorbed by plants to escape into the air, soil, and water, leading to a series of environmental problems such as air pollution, soil acidification, and water eutrophication. Therefore, how to reduce nitrogen fertilizer application while improving rice NUE (nitrogen use efficiency) without reducing rice yield is an urgent issue that needs to be addressed.
[0004] To ensure rice yields remain high while reducing nitrogen fertilizer input, it's necessary to improve rice's nitrogen use efficiency. This requires both increasing rice biomass and, more importantly, promoting more grain formation. Therefore, increasing both rice biomass and yield is crucial for improving rice nitrogen use efficiency. Discovering new genes that improve rice nitrogen use efficiency and applying them to molecular breeding is a key technology for accelerating the development of nitrogen-efficient rice varieties. Summary of the Invention
[0005] In order to solve the above-mentioned technical problems existing in the existing technology, a new gene OsbZIP45 that regulates rice plant height, effective panicle number and yield was identified and cloned, and its application in controlling rice effective panicle number, plant height, yield and nitrogen high efficiency characteristics was provided.
[0006] The first object of the present invention is to provide an OsbZIP45 gene, wherein the OsbZIP45 gene has a coding region nucleotide sequence as shown in any one of A1) to A3):
[0007] A1) the nucleotide sequence of the OsbZIP45 coding region shown in SEQ ID NO: 1;
[0008] A2) the cDNA sequence shown in SEQ ID NO: 2;
[0009] A3) a genomic DNA molecule represented by SEQ ID NO: 3;
[0010] A4) a DNA molecule having more than 90% homology to the nucleotide sequence defined by SEQ ID NO: 1-3;
[0011] A5) A nucleotide sequence obtained by deletion and / or base mutation of the nucleotide sequence shown in SEQ ID NO: 1-3 and / or ligation / recombination of the nucleotide sequence with a vector sequence.
[0012] The second object of the present invention is to provide an OsbZIP45 protein, wherein the OsbZIP45 protein is a protein as shown in B1) and / or B2) below:
[0013] B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4;
[0014] B2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 4;
[0015] B3) A protein having more than 80% homology with the nucleotide sequence defined by SEQ ID NO: 4 and having the same function.
[0016] The third object of the present invention is to provide a knockout vector for the aforementioned OsbZIP45 gene.
[0017] Furthermore, the vector is a CRISPR-Cas9 vector, which includes a Cas9 protein and sgRNA, and the target sequence of the sgRNA is a DNA molecule shown in SEQ ID NO: 1-3.
[0018] A fourth object of the present invention is to provide the use of the aforementioned OsbZIP45 gene, or the aforementioned OsbZIP45 protein, or the aforementioned knockout vector in regulating the effective panicle number and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
[0019] Furthermore, knocking out the aforementioned OsbZIP45 gene in rice, or reducing the expression level of the aforementioned OsbZIP45 protein in rice, or introducing the aforementioned knockout vector into rice can increase the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
[0020] Furthermore, overexpressing the aforementioned OsbZIP45 gene in rice, or increasing the expression level of the aforementioned OsbZIP45 protein in rice, can reduce the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
[0021] The beneficial effects of the present invention are:
[0022] 1. The present invention provides a new gene and protein that can increase the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
[0023] 2. The present invention provides a new gene capable of increasing the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice, and its corresponding mutant sequence and materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Phenotypic identification of representative varieties with high and low nitrogen efficiency under high and low nitrogen conditions.
[0025] Figure 2 Prediction results of OsCKX2 promoter binding elements and transcription factors.
[0026] Figure 3 Molecular validation of OsbZIP45 transcriptional regulation of OsCKX2, including:
[0027] a is the yeast one-hybrid screening and verification results of OsbZIP45 binding to OsCKX2 promoter;
[0028] b shows the results of a dual luciferase reporter gene (LUC) experiment in which OsbZIP45 transcriptionally regulates the OsCKX2 promoter;
[0029] c is the detection result of OsCKX2 expression level in OsbZIP45 knockout families.
[0030] Figure 4 Construction of OsbZIP45 knockout families and identification of nitrogen-efficient phenotypes, including:
[0031] a is a schematic diagram of the OsbZIP45 knockout family sequence and the sgRNA primer sites in Example 2;
[0032] b is a photo of the phenotypes of the OsbZIP45 knockout family and the wild type under high / low nitrogen fields;
[0033] c is the plant height statistics of OsbZIP45 knockout families and wild type at maturity under high / low nitrogen fields;
[0034] d is the statistics of the effective tiller number (effective ear number) of OsbZIP45 knockout families and wild type under high / low nitrogen fields;
[0035] e is the single plant yield statistics of OsbZIP45 knockout family and wild type in high / low nitrogen fields;
[0036] f shows the NUE statistics of OsbZIP45 knockout families and wild type under high / low nitrogen fields.
[0037] Figure 5 Identification of nitrogen-efficient phenotypes in OsbZIP45 overexpressing families, including:
[0038] a is a photo of the phenotypes of OsbZIP45 overexpression lines and wild type lines under high / low nitrogen fields;
[0039] b is the detection of OsbZIP45 expression abundance in OsbZIP45 overexpressing families and wild type;
[0040] c is the plant height statistics of OsbZIP45 overexpression families and wild type at maturity under high / low nitrogen fields;
[0041] d is the statistics of effective tiller numbers (effective ears) of OsbZIP45 overexpression lines and wild type under high / low nitrogen fields;
[0042] e is the single plant yield statistics of OsbZIP45 overexpression lines and wild type in high / low nitrogen fields. DETAILED DESCRIPTION
[0043] The embodiments of the present invention are described in detail with reference to the examples (but not limited thereto). The experimental methods in the following examples are conventional methods unless otherwise specified; the test materials used are conventional biochemical reagents unless otherwise specified. The quantitative tests in the following examples were all repeated three times, and the results were averaged. The statistical tests in the following examples were all repeated multiple times.
[0044] Example 1 Identification of nitrogen-efficient materials and mining of nitrogen-efficient gene OsbZIP45.
[0045] 1. Screening of Nitrogen-Efficient Materials
[0046] 1. Planting of core germplasm resources
[0047] Rice germplasm resources distributed in Jiangsu Province, China, including farm varieties and bred varieties, were selected and planted in high nitrogen fields (fertilizer rate 300kg / h pure nitrogen), medium nitrogen fields (fertilizer rate 150kg / h pure nitrogen), and low nitrogen fields (fertilizer rate 50kg / h pure nitrogen). Each variety was planted in 4×10 plots with three replicates distributed in different areas of the field. The planting was continued for three consecutive years, and the data were measured.
[0048] 2. Collection of nitrogen efficiency data for core germplasm resources
[0049] When the plants were filling and mature, the plant height, number of effective ears (number of effective tillers), dry weight of biomass after harvest, and yield per plant of each variety in fields with different nitrogen levels were measured. Ten plants were measured in each replicate for each variety, and the test was repeated for three years.
[0050] 3. Calculation of nitrogen high efficiency index and screening of nitrogen high efficiency materials
[0051] The extreme values of the repeated data of each variety in the nitrogen level field were removed and the average value was calculated. The data under high and medium nitrogen levels were analyzed by normal distribution. For three consecutive years, at least two of the three groups of data were in the top 20% of the data, which were nitrogen-efficient varieties, and the varieties in the bottom 20% were low-nitrogen-sensitive varieties.
[0052] Representative varieties are as follows Figure 1 shown.
[0053] 2. Discovery of the OsbZIP45 gene
[0054] 1. Using promoter binding element prediction and upstream transcription factor screening techniques, we identified upstream regulatory factors for OsCKX2, a gene widely used in Jiangsu rice varieties. Using PlantPAN4.0, we predicted binding elements for the OsCKX2 promoter, revealing that bZip family transcription factor binding motifs are enriched in the OsCKX2 promoter.
[0055] The results are as attached Figure 2 shown.
[0056] 2. Combining promoter single-hybrid screening technology and verifying it through transcriptional regulation experiments, the transcription factor OsbZIP45 was identified and cloned.
[0057] The results are as attached Figure 3 As shown, the results show: Figure a, yeast one-hybrid results show that OsbZIP45 directly binds to the two haplotype promoters of OsCKX2; Figure b, dual luciferase reporter gene (LUC) experimental results show that OsbZIP45 directly transcriptionally activates the activity of the OsCKX2 promoter; Figure c, quantitative results show that knocking out OsbZIP45 significantly increases the expression level of OsCKX2. Therefore, the OsbZIP45 gene was identified, and the nucleotide sequence of its coding region is shown in SEQ ID NO: 1; the cDNA sequence is shown in SEQ ID NO: 2; and the genomic DNA is shown in SEQ ID NO: 3.
[0058] Example 2 Acquisition and phenotypic investigation of OsbZIP45 knockout families
[0059] 1. Acquisition of OsbZIP45 Knockout Families
[0060] 1. sgRNA design
[0061] Using SEQ ID NO: 1 as the reference sequence, a pair of sgRNA primers were designed in the OsbZIP45 coding region. The primer sequences are as follows:
[0062] OsbZIP45-sgRNA-F:ggcaGCTGGGGCAAAATATGTCGG (SEQ ID NO: 5);
[0063] OsbZIP45-sgRNA-R:aaacCCGACATATTTTGCCCCAGC (SEQ ID NO: 6).
[0064] To facilitate subsequent ligation, a ggca linker was added to the 5' end of the front primer OsbZIP45-sgRNA-F, and an aaac linker was added to the 5' end of the rear primer OsbZIP45-sgRNA-R.
[0065] 2. Construction of knockout vector
[0066] 1) Denature and anneal the synthesized primers OsbZIP45-sgRNA-F and OsbZIP45-sgRNA-R to obtain primer dimer products.
[0067] 2) The primer dimer product was ligated into the vector pCAMBIA1305 using T4 ligase to obtain the constructed intermediate vector pCAMBIA-OsbZIP45.
[0068] 3. Obtaining transgenic plants
[0069] The intermediate vector pCAMBIA-OsbZIP45 from step 2 was heat-shocked into competent Agrobacterium EHA105 cells, and colony PCR was performed to obtain positive monoclonal strains containing the pCAMBIA-OsbZIP45 vector. The monoclonal Agrobacterium strain containing pCAMBIA-OsbZIP45 was used to infect Nipponbare (Nip) calli. Positive T0 generation plants were obtained, and DNA was extracted from individual plants. PCR amplification was performed using detection primers. The amplified fragments were sent for next-generation sequencing and compared with the Nipponbare reference sequence. Positive individual strains of the OsbZIP45 knockout family (bZIP45-cr1 and bZIP45-cr2) were obtained. These individual plants were harvested for seed, further propagation, and phenotypic investigation.
[0070] PCR identification primers are as follows:
[0071] OsbZIP45-detect-F:CATTTCCTGATTGGTCCGCT (SEQ ID NO:7);
[0072] OsbZIP45-detect-R:CATAAGAGGGTGTGGATAAG (SEQ ID NO: 8).
[0073] 2. Identification of nitrogen-efficient phenotypes in knockout families
[0074] The homozygous plants of the OsbZIP45 knockout family were planted and phenotypic data were collected according to the method of "Screening of nitrogen-efficient materials" in Example 1.
[0075] The results are as follows Figure 4 As shown in Figure 2, compared with the wild-type phenotypic data, the OsbZIP45 knockout lines showed significantly increased rice plant height under both high and low nitrogen conditions ( Figure 4 c) Number of effective ears ( Figure 4 d) Output ( Figure 4 e) and NUE( Figure 4 f), indicating that the OsbZIP45 knockout line has higher nitrogen utilization efficiency than the wild type.
[0076] Example 3: Obtaining OsbZIP45 Overexpressing Transgenic Materials and Identifying Nitrogen Efficiency Phenotypes
[0077] 1. Obtaining OsbZIP45-overexpressing transgenic plants
[0078] 1. Overexpression vector construction
[0079] 1) OsbZIP45 gene cloning
[0080] Using the Nipponbare (Nip) genome as a template, RNA was extracted and cDNA was obtained by reverse transcription. The nucleotide sequence of the coding region of OsbZIP45 was amplified by PCR using primers OsbZIP45-CDS-F / R. To facilitate the next step of recombination, the ttacttctgcactaggtacc linker sequence was added to the 5' end of OsbZIP45-CDS-F, and the gaattcccggggatcc linker sequence was added to the 5' end of OsbZIP45-CDS-F.
[0081] The primer sequences are as follows:
[0082] OsbZIP45-CDS-F: ttacttctgcactaggtaccATGGCTCATGATGAAGCTGT (SEQ ID NO: 9);
[0083] OsbZIP45-CDS-R: gaattcccggggatccTTAGCTTGCAGCAACAACAT (SEQ ID NO: 10).
[0084] 2) Construction of expression vector
[0085] The CDS fragment amplified in step 1) was ligated into the vector pCUbi1390 to obtain the recombinant expression vector pCUbi1390-OsbZIP45.
[0086] 2. Obtaining OsbZIP45 overexpression families
[0087] The pCUbi1390-OsbZIP45 expression vector obtained in step 1 was transferred into the competent Agrobacterium EHA105 by heat shock method, and a positive monoclonal strain containing the pCUbi1390-OsbZIP45 vector was obtained by colony PCR. The Agrobacterium monoclonal strain containing pCUbi1390-OsbZIP45 was used to infect Nipponbare (Nip) callus. Positive T0 generation plants OsbZIP45-OE were obtained, DNA was extracted from individual plants, PCR was amplified using detection primers, and positive individual plants were identified by agarose gel electrophoresis. Positive individual plants (including homozygous and heterozygous plants) were obtained, individual plants were harvested for seed, and seeding was continued until homozygous. PCR identification primers are as follows:
[0088] OsbZIP45-CDS-F: ttacttctgcactaggtaccATGGCTCATGATGAAGCTGT (SEQ ID NO: 11);
[0089] OsbZIP45-CDS-R: gaattcccggggatccTTAGCTTGCAGCAACAACAT (SEQ ID NO: 12).
[0090] II. Identification of nitrogen-efficient phenotypes of OsbZIP45-overexpressing transgenic materials
[0091] The obtained transgenic homozygous plants were planted according to the method of "Screening of nitrogen-efficient extreme materials" in Example 1 and phenotypic data were collected.
[0092] The results are as attached Figure 5 As shown in Figure 2, compared with the wild-type phenotypic data, the OsbZIP45 overexpression lines showed significantly reduced rice plant height under both high and low nitrogen conditions ( Figure 5 c) Number of effective ears ( Figure 5 d) and single plant yield ( Figure 5 e), indicating that the nitrogen utilization efficiency of the OsbZIP45 overexpression lines was reduced. Combined with the knockout results, it was concluded that OsbZIP45 negatively regulates rice yield and nitrogen utilization efficiency.
[0093] The above is an example of the present invention, and the well-known specific technical solutions and / or features in the solution are not described in detail here. For those skilled in the art, several variations and improvements can be made without departing from the technical solution of the present invention. These should also be considered as the scope of protection of the present invention and will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection claimed in this application shall be based on the content of its claims, and the specific implementation methods and other records in the description can be used to interpret the content of the claims.
Claims
1. OsbZIP45 gene, characterized in that The OsbZIP45 gene is the coding region nucleotide sequence shown in any one of A1) to A3): A1) the nucleotide sequence of the OsbZIP45 coding region shown in SEQ ID NO: 1; A2) the cDNA sequence shown in SEQ ID NO: 2; A3) a genomic DNA molecule represented by SEQ ID NO: 3; A4) a DNA molecule having more than 90% homology to the nucleotide sequence defined by SEQ ID NO: 1-3; A5) A nucleotide sequence obtained by deletion and / or base mutation of the nucleotide sequence shown in SEQ ID NO: 1-3 and / or ligation / recombination of the nucleotide sequence with a vector sequence.
2. OsbZIP45 protein, characterized in that The OsbZIP45 protein is the protein shown in B1) and / or B2) below: B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4; B2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 4; B3) A protein having more than 80% homology with the nucleotide sequence defined by SEQ ID NO: 4 and having the same function.
3. The knockout vector of the OsbZIP45 gene according to claim 1.
4. The knockout vector according to claim 3, characterized in that The vector is a CRISPR-Cas9 vector, which includes a Cas9 protein and an sgRNA, and the target sequence of the sgRNA is a DNA molecule shown in SEQ ID NO: 1-3.
5. Use of the OsbZIP45 gene according to claim 1, or the OsbZIP45 protein according to claim 2, or the knockout vector according to claim 3 in regulating the effective panicle number and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
6. The use according to claim 5, characterized in that Knocking out the OsbZIP45 gene of claim 1 in rice, or reducing the expression level of the OsbZIP45 protein of claim 2 in rice, or introducing the knockout vector of claim 3 into rice can increase the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.
7. The use according to claim 5, characterized in that Overexpressing the OsbZIP45 gene of claim 1 in rice, or increasing the expression level of the OsbZIP45 protein of claim 2 in rice, can reduce the number of effective panicles and / or plant height and / or yield and / or nitrogen utilization efficiency of rice.