Application of rice OsBZR4 gene in cultivation of rice embryo-free seeds

Abstract

The invention discloses application of a rice OsBZR4 gene in cultivation of rice embryo-free seeds, relates to the technical field of gene engineering, and aims to provide application of the rice OsBZR4 gene in cultivation of rice embryo-free seeds, which has important practical significance and agricultural utilization value. A CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR associated 9) technology is utilized to perform targeted knockout on the rice gene OsBZR4, so as to obtain the rice gene OsBZR4 knockout According to the gene knockout mutant of the rice OsBZR4 gene under the background of different rice varieties, 60-90% of non-embryo seeds and 10-40% of small embryo and normal embryo seeds can be generated. On the premise that the yield and the quality character are not affected, the polished rice rate of the rice can be increased, and the storage resistance of the rice can be improved. Precious germplasm resources are provided for rice seed embryo and endosperm development research, and the method has very important scientific value for research of a rice seed embryo and endosperm development regulation mechanism.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of rice OsBZR4 gene in cultivating rice embryoless seeds. Background Art

[0002] Rice is an important food crop, and fluctuations in its annual yield and storage capacity have significant implications for global food security. Rice seeds are both responsible for breeding and a crucial source of human food. Their development directly impacts grain yield and quality. Rice milling rate and storability are two key quality traits during rice processing. After rice seeds are harvested, large quantities of harvested rice need to be stored for extended periods of time, from processing, transportation, and sales to consumer consumption. Annual rice losses in my country due to storage deterioration account for approximately 3% of the stored volume. Therefore, improving rice storability is crucial for food production. In recent years, many genes that improve rice yield and quality have been identified and applied in rice breeding. However, research on improving rice milling rate and storability from a genetic breeding perspective has been limited. The discovery of genes regulating embryoless seeds theoretically provides valuable genetic material for studying the mechanisms of rice seed development. In practice, introducing embryoless seeds into elite varieties has been shown to effectively increase milling rate and improve rice storability, thus possessing significant theoretical and practical value.

[0003] The embryo and endosperm are two crucial daughter organs of rice seeds. The embryo is responsible for offspring development, while the endosperm is a crucial storage organ, providing nutrients to the embryo during development and germination. It also serves as a crucial source of human staple food. Normal development of rice seeds requires close coordination between the embryo and endosperm. Furthermore, within the limited space of the glume, the sizes of the two are mutually constrained. Embryoless rice seeds were discovered as early as the 1990s, but the genes regulating their development have remained largely unidentified. To date, only a few genes regulating embryo development have been cloned, including GE, GLE4 / OsMPK6, and DWT1. However, the genetic basis of embryoless rice seed formation remains unclear, and the molecular mechanisms regulating embryo and endosperm size remain unelucidated. Therefore, identifying genes regulating embryoless rice is of great scientific importance for understanding the molecular mechanisms governing embryo and endosperm development in rice seeds. Furthermore, cultivating embryoless rice within the context of superior rice varieties could increase milling efficiency and improve grain storage durability, which has important production implications. Summary of the Invention

[0004] The purpose of the present invention is to provide an application of the rice OsBZR4 gene in cultivating rice embryoless seeds, which has important practical significance and agricultural utilization value.

[0005] The present invention provides an application of the rice OsBZR4 gene in cultivating rice embryoless seeds. The nucleotide sequence of the coding region of the rice OsBZR4 gene is shown in the sequence listing SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in the sequence listing SEQ ID NO: 2.

[0006] Furthermore, the application is to use CRISPR / Cas9 technology to perform targeted knockout of the rice OsBZR4 gene to obtain a rice gene OsBZR4 knockout mutant.

[0007] The method for preparing the rice gene OsBZR4 knockout mutant comprises the following steps:

[0008] 1. Design knockout targets based on the rice OsBZR4 gene and construct target sgRNA expression cassettes;

[0009] 2. Constructing a gene knockout expression vector based on the target sgRNA expression cassette and CRISPR / Cas9 gene knockout system;

[0010] 3. Using an Agrobacterium-mediated method, transforming the gene knockout expression vector into a rice variety to obtain a transgenic rice plant;

[0011] 4. Use detection primers to identify the OsBZR4 gene editing status of transgenic rice plants and obtain the rice gene OsBZR4 knockout mutant.

[0012] Furthermore, there are two knockout targets in step 1, both of which are located in the first exon of the rice OsBZR4 gene, with the first target starting site located at 85 bp and the second target starting site located at 138 bp.

[0013] Furthermore, the first target sequence is shown in the sequence listing SEQ ID NO: 3, and the second target sequence is shown in the sequence listing SEQ ID NO: 4.

[0014] Furthermore, the detection primer sequences in step 4 are shown in the sequence listing as SEQ ID NO: 5 and SEQ ID NO: 6.

[0015] The present invention provides application of rice OsBZR4 gene in improving rice polishing rate.

[0016] The present invention also provides application of the rice OsBZR4 gene in improving the storage resistance of rice.

[0017] Beneficial effects of the present invention:

[0018] The present invention knocks out the rice OsBZR4 gene using CRISPR / Cas9 technology to obtain gene knockout mutants. A large proportion of the seeds of these gene knockout mutants are embryoless seeds, while a small number are seeds with small or normal embryos. The gene knockout mutants of the rice OsBZR4 gene in different rice variety backgrounds can produce 60%-90% embryoless seeds and 10%-40% small and normal embryo seeds. This provides precious germplasm resources for research on rice seed embryo and endosperm development, and has very important scientific value for studying the regulatory mechanism of rice seed embryo and endosperm development. At the same time, cultivating embryoless rice in the context of excellent rice varieties can increase the rice polishing rate and improve rice storage resistance without affecting yield and quality traits, which has important production significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the rice OsBZR4 gene structure and editing target site provided in Example 1;

[0020] Figure 2 Schematic diagram of the structure of the rice OsBZR4 gene editing vector provided in Example 1;

[0021] Figure 3 The genotypes of the rice osbzr4 mutants in different backgrounds provided in Example 3;

[0022] Figure 4 Morphological images of hulled dry seeds of osbzr4 mutant and wild-type rice under different rice variety backgrounds provided in Example 3;

[0023] Figure 5 A statistical graph showing the proportions of embryoless, small, and normal embryos in osbzr4 mutant and wild-type rice seeds under different rice variety backgrounds provided in Example 3;

[0024] Figure 6 Statistical graphs of agronomic traits of osbzr4 mutant and wild-type rice under the Zhongjia 11 background provided in Example 4;

[0025] Figure 7 This is a diagram showing the nutritional quality analysis of osbzr4 mutant and wild-type rice seeds under the Zhongjia 11 background provided in Example 4;

[0026] Figure 8 The appearance of the osbzr4 mutant and wild-type polished rice under the Zhongjia 11 background provided in Example 4;

[0027] Figure 9 This is a graph showing changes in fatty acid content of osbzr4 mutant and wild-type brown rice in the Zhongjia 11 background provided in Example 4, treated under high temperature and high humidity conditions (42° C., 85% humidity) for 30 days;

[0028] Figure 10 The statistical graphs show the proportions of embryoless, small and normal embryos in seeds of rice osbzr4 mutant cultured at different temperatures.

[0029] Figure 11 This is a statistical chart showing the proportions of embryoless, small and normal embryos in seeds produced by the same rice osbzr4 mutant line planted in Harbin and Sanya. DETAILED DESCRIPTION

[0030] The following embodiments of the present invention are described in detail. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation plans and specific operating processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0031] Example 1: Construction of editing vector for rice OsBZR4 gene

[0032] The knockout target site was designed based on the rice OsBZR4 gene. The structure of the rice OsBZR4 gene is as follows: Figure 1 As shown, the gene is 3399bp in length, including 2 exons and 1 intron sequence. The coding region sequence of the OsBZR4 gene is 1056bp in length, and the sequence is shown in the sequence listing SEQ ID NO: 1. The amino acid sequence of the encoded protein is shown in the sequence listing SEQ ID NO: 2.

[0033] The online software CRISPR-GE (http: / / skl.scau.edu.cn / ) was used to screen the target sequences for gene editing. Two target sequences were selected, as shown in SEQ ID NO: 3 and SEQ ID NO: 4, and named Target 1 and Target 2, respectively. The gene locations of the two target sites are shown in Figure 1 As shown, they are all located in the first exon, with the start sites located at 85 bp and 117 bp respectively.

[0034] Target 1 sequence: ATCGCGGCGAAGATCTACG

[0035] Target 2 sequence: GAAGCACTGCGACAACAACG

[0036] Based on the two target sites, a target sgRNA expression cassette was constructed. In this example, the sgRNA expression cassette was constructed using the CRISPR / sgRNA vectors pYLgRNA-OsU3 and pYLgRNA-OsU6a as the backbone. First, the primer sequences for connecting the target site and the sgRNA expression cassette were synthesized, as shown in the sequence listing SEQ ID NO: 7-SEQ ID NO: 14.

[0037] Subsequently, the first round of PCR was performed using the pYLgRNA-OsU3 plasmid as a template, with the addition of forward primer F2 and reverse primer R2, and the pYLgRNA-OsU6a plasmid as a template, with the addition of forward primer F3 and reverse primer R3. For 25-28 cycles: 94°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds. Subsequently, the pYLgRNA-OsU3 product from the first round of PCR was added with forward primer F4 and reverse primer R4, and the pYLgRNA-OsU6a product from the first round of PCR was added with forward primer F5 and reverse primer R5. For 17-20 cycles: 95°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds, a second round of PCR was performed. Finally, the second-round PCR products were recovered by agarose gel electrophoresis to obtain the target sgRNA expression cassette.

[0038] Forward primer F2: 5′-GGCAGATCGCGGCGAAGATCTACG-3′

[0039] Reverse primer R2: 5'-AAACCGTAGATCTTCGCCGCGATC-3'

[0040] Forward primer F3: 5′-GCCGCGTTGTTGTCGCAGTGCTTC-3′

[0041] Reverse primer R3: 5'-AAACGAAGCACTGCGACAACAACG-3'

[0042] Forward primer F4: 5′-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3′

[0043] Reverse primer R4: 5′-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3′

[0044] Forward primer F5: 5′-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3′

[0045] Reverse primer R5: 5′-AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC-3′

[0046] In this example, the CRISPR / Cas9 vector used was pYLCRISPR / Cas9Pubi-H. The target sgRNA constructed above, pYLCRISPR / Cas9Pubi-H, DNA ligase, and endonuclease Bsa I were mixed and ligated to the CRISPR / Cas9 vector pYLCRISPR / Cas9Pubi-H using a cleavage-and-ligation method for 10-15 cycles: 37°C for 5 min; 10°C for 5 min; 20°C for 5 min; and finally 37°C for 5 min to obtain a ligation product.

[0047] The pYLCRISPR / Cas9Pubi-H vector has been published in the following article: Ma X, Zhang Q, ZhuQ, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274–1284.

[0048] The ligation product was transformed into Escherichia coli, and high-purity plasmids were extracted. Enzyme digestion was performed for identification, and plasmids with the correct product size were sequenced to obtain a CRISPR / Cas9 vector for knocking out the rice OsBZR4 gene, as shown in FIG. Figure 2 This is the rice OsBZR4 gene editing vector.

[0049] Example 2: Genetic transformation of rice callus using rice OsBZR4 gene editing vector

[0050] The rice OsBZR4 gene editing vector plasmid obtained in Example 1 was transformed into competent cells of Agrobacterium. In this example, competent cells of Agrobacterium tumefaciens EHA105 were transformed by heat shock method, and single colonies were picked for PCR identification to obtain strains containing positive clones. Subsequently, rice callus was transformed using Agrobacterium-mediated method. The specific operation steps are as follows:

[0051] (1) Induction of rice seed callus

[0052] Mature seeds of the rice variety Zhongjia 11 were dehulled, disinfected and cleaned in 75% alcohol and 50% sodium hypochlorite, and then placed on a rice callus induction medium. Subsequently, the seeds were cultured in a 30°C light incubator for 2-3 weeks until callus tissue grew. Afterwards, the seeds were subcultured for 1-2 generations, and callus tissue with good growth conditions was selected for Agrobacterium infection.

[0053] (2) Agrobacterium activation

[0054] Take the Agrobacterium containing positive clones and inoculate it into liquid YEP medium containing kanamycin and rifampicin. Incubate it at 28°C in a shaker at 200 rpm until the OD 600 0.3-0.5; then, 1 mL of bacterial solution was inoculated again into fresh liquid YEP medium containing kanamycin and rifampicin, and cultured under the same conditions until OD 600 is 0.3-0.5; finally, the bacteria are collected by centrifugation and resuspended in AAM medium containing acetosyringone (AS) to obtain a bacterial solution.

[0055] (3) Co-cultivation of callus and Agrobacterium, screening of resistant callus, and rooting

[0056] The obtained callus tissue was immersed in the bacterial solution, infected for 30 minutes, and gently shaken; then, the excess bacterial solution was absorbed with sterilized filter paper, and the infected callus tissue was transferred to a co-culture solid culture medium and cultured in the dark at 28°C for 3 days; then, it was transferred to a screening medium containing hygromycin for culture; the resistant callus tissue obtained on the screening medium was transferred to a differentiation medium for differentiation and regeneration; the regenerated seedlings were moved to pots and managed according to routine procedures to obtain rice OsBZR4 gene-edited T0 generation plants.

[0057] Example 3: CRISPR / Cas9 knockout identification and phenotypic analysis of rice OsBZR4 gene

[0058] To obtain rice plants homozygous for the OsBZR4 gene knockout for phenotypic analysis, genomic DNA was extracted from leaves of the T0 generation of OsBZR4 gene-edited plants obtained above. Forward primer F1 and reverse primer R1 were designed based on the target sequence, as shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. A product of approximately 487 bp was amplified for sequencing.

[0059] The sequencing results were compared with the rice OsBZR4 gene sequence to identify the gene-edited rice OsBZR4 genotype, and the heterozygous OsBZR4 gene-edited plants were planted until homozygous OsBZR4 gene-edited plants were obtained. Figure 3As shown: In the backgrounds of Zhongjia 11 (ZJ11), Songjing 2 (SJ2), Longjing 11 (LJ11), Hongyuan Rice 1 (HYD1), Suijing 18 (SJ18) and indica rice 9311, different numbers of base deletions were obtained between the two editing target sites of the OsBZR4 gene, resulting in amino acid coding frame shift or premature termination.

[0060] like Figure 4 As shown in Figure 2, osbzr4 mutants in different genetic backgrounds can produce embryoless seeds, in which the place where the embryo was originally located is occupied by the endosperm. Figure 5 As shown, the proportions of embryoless, small embryos and normal embryos in homozygous osbzr4 mutant seeds under different genetic backgrounds were statistically analyzed, among which embryoless seeds accounted for about 60%-90%, and small embryos and normal embryos accounted for about 10%-40%.

[0061] Example 4: Analysis of application value using the osbzr4 mutant in the Zhongjia 11 background as an example

[0062] Taking the osbzr4 mutant in the Zhongjia 11 background as an example, the T2 generation homozygous bzr4-ZJ11 and its wild-type ZJ11 rice were planted in Sanya, Hainan. After the seeds matured, agronomic traits such as plant height, number of effective tillers, number of grains per panicle, 1000-grain weight and yield per plant were investigated. Figure 6 As shown in the data, compared with the wild type ZJ11, the plant height, effective tiller number, number of grains per panicle, 1000-grain weight and yield per plant of osbzr4-ZJ11 had no significant changes, indicating that knockout of the OsBZR4 gene had no significant effect on rice yield traits.

[0063] Taking the osbzr4 mutant in the Zhongjia 11 background as an example, the lipid, protein and amylose contents in osbzr4-ZJ11 and ZJ11 seeds were analyzed. Figure 7 As shown, compared with ZJ11, the lipid content of osbzr4-ZJ11 seeds was significantly reduced. This may be because lipids in seeds are primarily stored in the embryo, and most oszr4-ZJ11 seeds lack or have smaller embryos, resulting in reduced lipid content. In contrast, the amylose content of osbzr4-ZJ11 seeds was significantly higher than that of the wild type, consistent with the increased volume of the starchy endosperm in osbzr4-ZJ11. Protein content in osbzr4-ZJ11 seeds did not change significantly compared with the wild type.

[0064] Because the osbzr4 mutant produces a large number of embryoless seeds, the original embryo position is occupied by the endosperm, and the proportion of the endosperm increases. The polished rice consumed by humans is mainly the starchy endosperm part. During the milling process, the seed coat and endosperm are removed, and the embryo is passively shed. Figure 8As shown in Table 1, the polished rice appearance of ZJ11 and osbzr4-ZJ11 reveals a gap in the original embryo position in ZJ11. Analysis of the brown and polished rice yields of ZJ11 and osbzr4-ZJ11, as shown in Table 1, reveals that compared with ZJ11, the brown rice yield of osbzr4-ZJ11 remained unchanged, while the polished rice yield increased by 2.87%. The polished rice appearance quality of osbzr4-ZJ11 showed no significant changes, including no significant changes in the chalkiness of the polished rice kernels or the degree of chalkiness. This suggests that osbzr4-ZJ11 significantly increased the polished rice yield without changing the yield or appearance quality of ZJ11.

[0065] Table 1

[0066] Brown rice yield (%) Milled rice yield (%) Chalkiness grains (%) Chalkiness degree (%) ZJ11 79.82±0.48 65.30±0.46 2.00±1.00 0.93±0.14 osbzr4-ZJ11 80.72±0.61 68.17±0.32** 2.33±0.58 0.94±0.16

[0067] To study the effect of the osbzr4 mutant on the storage stability of rice, this example subjected osbzr4-ZJ11 and ZJ11 hulled brown rice to accelerated aging in a constant temperature and humidity incubator at 42°C and 85% humidity for 30 days. Samples were taken every 5 days, sealed in ziplock bags, and stored in a -80°C refrigerator. Seed aging and deterioration during storage is mainly caused by lipid oxidation and rancidity, so fatty acid value is an important indicator of the degree of grain aging. This example determined the fatty acid value of brown rice according to the method specified in Appendix A of the national standard GB / T 20569-2006. Specific method:

[0068] (1) Crush the brown rice with a grinder, pass it through a 50-mesh sieve to remove large particles, and collect the brown rice flour;

[0069] (2) Weigh 10 g ± 0.01 g of brown rice flour into a 250 mL conical flask with a stopper. Use a 50 mL pipette to accurately add 50 mL of anhydrous ethanol, shake well, and place on an oscillator for 10 min.

[0070] (3) After shaking, let it stand for 1-2 minutes, filter it with a short-necked glass funnel and filter paper, remove the first few drops of filtrate, and collect more than 25 mL of filtrate with a stoppered test tube or conical flask.

[0071] (4) Use a 25 mL pipette to accurately transfer 25 mL of filtrate into a measuring cup, add 25 mL of carbon dioxide-free distilled water, add a stirrer, place the measuring cup on the magnetic stirring table of the fully automatic potentiometric titrator, place the electrode and burette, and titrate with 0.01 mol / L KOH standard titrant prepared with neutral ethanol.

[0072] (5) The instrument automatically determines the endpoint and stops titration, and automatically records the volume of KOH standard titrant consumed. Anhydrous ethanol is used instead of the filtrate as a blank test.

[0073] (6) Determine the moisture content according to the national standard GB / T 5497 timed and constant temperature drying method.

[0074] (7) Measured as the mass of KOH consumed to neutralize the free fatty acids in 100 g of rice flour (mg / 100 g).

[0075] The results are as follows Figure 9 As shown in the data, during the accelerated aging process of brown rice, the fatty acid values ​​of both ZJ11 and osbzr4-ZJ11 increased with treatment time. However, the rate of increase in the fatty acid value of osbzr4-ZJ11 was significantly lower than that of ZJ11. After 30 days of accelerated aging, the fatty acid value of osbzr4-ZJ11 was approximately 40, which was comparable to the value of ZJ11 after 20 days of treatment. This indicates that the storage stability of osbzr4-ZJ11 is significantly improved compared to ZJ11.

[0076] Example 5: The proportion of embryoless seeds produced by the rice osbzr4 mutant is regulated by temperature

[0077] The three allelic mutant lines of the osbzr4 mutant, osbzr4-SJ2-1, osbzr4-SJ2-2 and osbzr4-SJ2-3, were planted in three incubators with the same conditions except for the different temperatures, namely 32°C (High Temperature, HT), 27°C (Normal Temperature, NT) and 22°C (Low Temperature, LT). After the seeds matured and were harvested, the proportions of seeds with no embryos, small embryos and normal embryos under different temperature conditions were counted. The results are shown in Figure 2. Figure 10 As shown in the figure, at 27°C, about 70% of seeds were embryoless, 10% had small embryos, and 20% had normal embryos. At 32°C, about 95% of seeds were embryoless, and about 5% had small and normal embryos. At 22°C, about 50% of seeds were embryoless, 20% had small embryos, and 30% had normal embryos. This indicates that the proportion of embryoless seeds produced by the rice mutant osbzr4 increases with increasing temperature.

[0078] To further confirm the effect of temperature on embryo development of the rice mutant osbzr4, rice mutants from the same line were planted in Harbin, Heilongjiang Province (45°30'N) and Sanya, Hainan Province (18°30'N). After the seeds matured and were harvested, the proportions of seeds with no embryos, small embryos, and normal embryos were counted. Figure 11As shown, about 70% of rice seeds with the osbzr4 mutant grown in Harbin were embryoless, while over 95% of seeds with the osbzr4 mutant grown in Sanya were embryoless. This further confirms that increasing temperature increases the proportion of embryoless seeds in rice with the osbzr4 mutant.

Claims

1. Application of rice OsBZR4 gene in breeding embryoless rice seeds.

2. The use according to claim 1, characterized in that The application is to use CRISPR / Cas9 technology to perform targeted knockout of the rice OsBZR4 gene to obtain a rice gene OsBZR4 knockout mutant.

3. The use according to claim 2, characterized in that The method for preparing the rice gene OsBZR4 knockout mutant comprises the following steps:

1. Design knockout targets based on the rice OsBZR4 gene and construct target sgRNA expression cassettes; 2. Constructing a gene knockout expression vector based on the target sgRNA expression cassette and CRISPR / Cas9 gene knockout system; 3. Using an Agrobacterium-mediated method, transforming the gene knockout expression vector into a rice variety to obtain a transgenic rice plant; 4. Use detection primers to identify the OsBZR4 gene editing status of transgenic rice plants and obtain the rice gene OsBZR4 knockout mutant.

4. The use according to claim 3, characterized in that There are two knockout targets in step 1. Both target sites are located in the first exon of the rice OsBZR4 gene. The starting site of the first target is located at 85 bp, and the starting site of the second target is located at 138 bp.

5. The use according to claim 4, characterized in that The first target sequence is shown in the sequence listing as SEQ ID NO: 3, and the second target sequence is shown in the sequence listing as SEQ ID NO:

4.

6. The use according to claim 3, characterized in that The detection primer sequences in step 4 are shown in the sequence listing as SEQ ID NO: 5 and SEQ ID NO:

6.

7. Application of rice OsBZR4 gene in improving rice polishing rate.

8. Application of rice OsBZR4 gene in improving rice storage tolerance.

Images