Corn disease-resistant gene ZmCRK10 and application of disease-resistant molecular marker of corn disease-resistant gene ZmCRK10 in improvement of corn stem rot resistance

By overexpressing the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 in corn plants and using the disease-resistant molecular marker ZmCRK10TypeB, the problem of insufficient resistance to corn stalk rot was solved, effective resistance to stalk rot was achieved, and the yield and quality of corn were improved.

CN120665941APending Publication Date: 2025-09-19HUAZHONG AGRI UNIV +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510947335.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-09
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing technologies lack effective plant genetic engineering methods to cultivate varieties resistant to corn stalk rot, resulting in serious impacts on corn yield and quality.

Method used

By overexpressing the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 in corn plants and using the disease-resistant molecular marker ZmCRK10TypeB for molecular marker-assisted selection, the resistance of corn to stalk rot is improved.

Benefits of technology

It significantly enhances the resistance of corn plants to stalk rot, especially to pathogens such as Fusarium graminearum, and improves corn yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665941A_ABST
    Figure CN120665941A_ABST
Patent Text Reader

Abstract

The invention provides an application of a corn disease-resistant gene ZmCRK10 and a disease-resistant molecular marker thereof in improvement of corn stem rot resistance, and belongs to the technical field of plant genetic engineering. The invention provides application of a disease-resistant gene ZmCRK10 or a disease-resistant protein ZmCRK10-T03 in improvement of corn stem rot resistance. The disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 can be used for constructing a transgenic corn variety resistant to corn stem rot. The invention further provides application of the disease-resistant molecular marker ZmCRK10TypeB of the corn disease-resistant gene ZmCRK10 in improving the corn stem rot resistance, and effective auxiliary molecular marker selection can be provided for corn stem rot resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a maize disease-resistant gene ZmCRK10 and a disease-resistant molecular marker thereof in improving maize stalk rot resistance. Background Art

[0002] Corn (Zea mays L.) is an important food, fuel, and feed crop. Corn stalk rot is a soil-borne disease that severely impacts corn yield and quality. Currently, there are few plant genetic engineering methods to develop corn varieties resistant to stalk rot. Summary of the Invention

[0003] The purpose of the present invention is to provide an application of the maize disease-resistant gene ZmCRK10 and its disease-resistant molecular marker in improving maize stalk rot resistance, so as to cultivate maize varieties resistant to stalk rot based on plant genetic engineering methods.

[0004] The present invention provides an application of a disease-resistant gene ZmCRK10 or a disease-resistant protein ZmCRK10-T03 in improving corn stalk rot resistance. The genomic nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.1; the CDS nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.2; and the amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.3.

[0005] The present invention also provides an application of knocking out or knocking down the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 in constructing a corn stalk rot susceptible plant model, wherein the genomic nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.1; the CDS nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.2; and the amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.3.

[0006] The present invention also provides a disease resistance molecular marker ZmCRK10 of the maize disease resistance gene ZmCRK10 TypeB The application of the invention in improving the resistance to corn stalk rot is characterized in that the disease resistance molecular marker ZmCRK10 TypeB The nucleotide sequence is shown in SEQ ID NO.4.

[0007] Preferably, the pathogens causing the corn base rot include one or more of the following pathogens: Pythium graminicola Subraman, Pythium spinosum Sawada, Pythium aphanidermatum (Edson) Fitzp and Pythium inflatum VD Matthews.

[0008] The present invention also provides a method for improving corn stalk rot resistance, comprising the following steps: overexpressing the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 in corn plants; the genomic nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.1; the CDS nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.2; and the amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.3.

[0009] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB A primer set comprising a first upstream primer having a nucleotide sequence as shown in SEQ ID NO.5, a second upstream primer having a nucleotide sequence as shown in SEQ ID NO.6, and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.7.

[0010] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB The kit comprises the primer set and PCR amplification reagents described in the above scheme.

[0011] The present invention also provides the use of the primer set or the kit described in the above scheme in identifying corn varieties with excellent resistance to corn stalk rot.

[0012] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB The method comprises the following steps: extracting genomic DNA of corn to be tested; using the genomic DNA of corn to be tested as a template, performing a first PCR amplification using the first upstream primer and the downstream primer in the primer set described in the above scheme to obtain a first amplification product; using the genomic DNA of corn to be tested as a template, performing a first PCR amplification using the second upstream primer and the downstream primer in the primer set described in the above scheme to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; when a band of 528 bp appears in the first amplification product and no band appears in the second amplification product, the corn to be tested is determined to be homozygous for ZmCRK10 TypeBType; When the first amplification product shows a band of 528 bp in length and the second amplification product shows a band of 285 bp in length, the maize to be tested is determined to be heterozygous for ZmCRK10 TypeA / ZmCRK10 TypeB Type; When the second amplification product shows a band of 285 bp in length and the first amplification product has no band, it is determined that the tested corn is homozygous and does not contain ZmCRK10 TypeB ZmCRK10 TypeA type.

[0013] The present invention also provides a method for identifying corn varieties with excellent resistance to corn stalk rot, comprising the following steps: extracting genomic DNA of the corn to be tested; using the genomic DNA of the corn to be tested as a template, and using the first upstream primer and the downstream primer in the primer set described in the above scheme to perform a first PCR amplification to obtain a first amplification product; using the genomic DNA of the corn to be tested as a template, and using the second upstream primer and the downstream primer in the primer set described in the above scheme to perform a first PCR amplification to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; when the first amplification product shows a band with a length of 528 bp and the second amplification product shows no band, it is determined that the corn to be tested has strong resistance to corn stalk rot; when the second amplification product shows a band with a length of 285 bp and no band of the first amplification product, it is determined that the corn to be tested has weak resistance to corn stalk rot.

[0014] The present invention provides the use of a disease-resistance gene, ZmCRK10, or a disease-resistance protein, ZmCRK10-T03, for improving corn stalk rot resistance. The genomic nucleotide sequence of the disease-resistance gene ZmCRK10 is shown in SEQ ID NO. 1; the CDS nucleotide sequence of the disease-resistance gene ZmCRK10 is shown in SEQ ID NO. 2; and the amino acid sequence of the disease-resistance protein ZmCRK10-T03 is shown in SEQ ID NO. 3. In the present invention, the disease-resistance gene ZmCRK10 or the disease-resistance protein ZmCRK10-T03 exhibits significant resistance to corn stalk rot and can be used to construct transgenic corn varieties resistant to corn stalk rot.

[0015] The present invention also provides a disease resistance molecular marker ZmCRK10 of the maize disease resistance gene ZmCRK10 TypeB Application in improving corn stalk rot resistance. In the present invention, the disease resistance molecular marker ZmCRK10 TypeB It has obvious resistance to corn stalk rot and can provide effective auxiliary molecular marker selection for corn stalk rot resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 , are the phenotypes of ZmCRK10-T03-OE overexpressing plants inoculated with Fusarium graminearum at the seedling stage; among them, a: the seedling growth phenotype of the ZmCRK10-T03-OE1 family before inoculation; b: the phenotype of the ZmCRK10-T03-OE1 family after inoculation with Fusarium graminearum; c: the seedling growth phenotype of the ZmCRK10-T03-OE2 family before inoculation; d: the phenotype of the ZmCRK10-T03-OE2 family after inoculation with Fusarium graminearum;

[0018] Figure 2 , are phenotypic images of ZmCRK10-T03-OE overexpressing plants inoculated with Fusarium graminearum by the root wound and soil burial method at the adult stage; a: phenotypic image of ZmCRK10-T03-OE overexpressing families by the root wound and soil burial method; b: statistical image of stem rot disease grade of ZmCRK10-T03-OE overexpressing families by the root wound and soil burial method; *: p<0.05; **: p<0.01; ***: p<0.001;

[0019] Figure 3 , are the phenotypes of ZmCRK10-T03-KO gene knockout plants inoculated with Fusarium graminearum at the seedling stage; among them, a: the seedling growth phenotype of the ZmCRK10-T03-KO1 family before inoculation; b: the phenotype of the ZmCRK10-T03-KO1 family after inoculation with Fusarium graminearum; c: the seedling growth phenotype of the ZmCRK10-T03-KO2 family before inoculation; d: the phenotype of the ZmCRK10-T03-KO2 family after inoculation with Fusarium graminearum;

[0020] Figure 4 , is the result of phenotypic identification of stem rot inoculated in LY042 / CML423, BC3F3 population; a: ZmCRK10 TypeA Mutation type genotype identification; b: ZmCRK10 TypeB Genotyping of the mutation type; c: Phenotypic diagram of the LY042 / CML423, BC3F3 population at the seedling stage before inoculation; d: Phenotypic diagram of the LY042 / CML423, BC3F3 population after inoculation with Fusarium graminearum;

[0021] Figure 5 , is the result of phenotypic identification of stem rot inoculated in K22 / CI7, BC6F3 population; a: ZmCRK10TypeA Mutation type genotype identification; b: ZmCRK10 TypeB Identification of mutant type genotype; c: Seedling growth phenotype of K22 / CI7, BC6F3 population before inoculation; d: Phenotype of K22 / CI7, BC6F3 population after inoculation with Fusarium graminearum;

[0022] Figure 6 , is the phenotype of corn stalk rot caused by the root wounding soil burial method inoculated with Fusarium graminearum in K22 / CI7,BC6F3 population;

[0023] Figure 7 , is the statistical chart of the disease grade of stem rot in K22 / CI7,BC6F3 population using the root wound and soil burial method; *: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001. DETAILED DESCRIPTION

[0024]

[0025] In this study, the disease-resistance gene ZmCRK10 encodes a cysteine-rich receptor-like kinase (CRK). ZmCRK10 primarily transcribes two transcripts. Overexpression of the full-length ZmCRK10 transcript, the T03 transcript, revealed that the overexpressing plant, ZmCRK10-T03-OE, exhibited significant resistance to stalk rot caused by Fusarium graminearum at both the seedling and adult stages. ZmCRK10 positively regulates resistance to maize stalk rot.

[0026] The present invention also provides an application of knocking out or knocking down the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 in constructing a corn stalk rot susceptible plant model, wherein the genomic nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.1; the CDS nucleotide sequence of the disease-resistant gene ZmCRK10 is shown in SEQ ID NO.2; and the amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.3.

[0027] In the present invention, knocking out or knocking down the disease-resistant gene ZmCRK10 or the disease-resistant protein ZmCRK10-T03 can reduce the resistance of plants to stem rot at the seedling stage. The knockout material Zmcrk10-KO is more susceptible to stem rot than the wild-type plants.

[0028] The present invention also provides a disease resistance molecular marker ZmCRK10 of the maize disease resistance gene ZmCRK10 TypeB Application of the disease resistance molecular marker ZmCRK10 in improving corn stalk rot resistance TypeBThe nucleotide sequence is shown in SEQ ID NO.4, specifically:.

[0029] In the present invention, the promoter region of the disease resistance gene ZmCRK10 has two major transposon variants in the population. TypeA and ZmCRK10 TypeB By constructing multiple NIL populations with promoter mutations, we found that ZmCRK10 TypeB The variant increases corn's resistance to corn stalk rot.

[0030] As an embodiment, the pathogens causing the corn base rot include one or more of the following pathogens: Pythium graminicola Subraman, Pythium spinosum Sawada, Pythium aphanidermatum (Edson) Fitzp and Pythium inflatum V.D. Matthews, and further Pythium graminicola.

[0031] As an embodiment, improving the resistance to corn stalk rot includes improving the resistance of corn plants to stalk rot during the seedling stage and / or the adult stage.

[0032] The present invention also provides a method for improving corn stalk rot resistance, comprising the following steps:

[0033] Overexpression of the disease resistance gene ZmCRK10 or the disease resistance protein ZmCRK10-T03 in maize plants;

[0034] The genomic nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.1;

[0035] The CDS nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.2;

[0036] The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.3.

[0037] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB The primer set comprises a first upstream primer (ZmCRK10 TypeB -F1), a second upstream primer (ZmCRK10 TypeA -F1) and the downstream primer (ZmCRK10 TypeB -R1).

[0038] As an embodiment, the nucleotide sequence of the first upstream primer shown in SEQ ID NO.5 is specifically: GCTACCCTCTAGAAGGCCCG.

[0039] As an embodiment, the nucleotide sequence of the second upstream primer shown in SEQ ID NO.6 is specifically: TTCGCGCACGCCCATTTAAC.

[0040] As an embodiment, the nucleotide sequence of the downstream primer shown in SEQ ID NO.7 is specifically: GCATAGGTGGAATCGTCGCAG.

[0041] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB The kit comprises the primer set and PCR amplification reagents described in the above scheme.

[0042] The present invention also provides the use of the primer set or the kit described in the above scheme in identifying corn varieties with excellent resistance to corn stalk rot.

[0043] The present invention also provides a method for detecting the disease resistance molecular marker ZmCRK10 TypeB The method comprises the following steps: extracting genomic DNA of corn to be tested; using the genomic DNA of corn to be tested as a template, performing a first PCR amplification using the first upstream primer and the downstream primer in the primer set described in the above scheme to obtain a first amplification product; using the genomic DNA of corn to be tested as a template, performing a first PCR amplification using the second upstream primer and the downstream primer in the primer set described in the above scheme to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; when a band of 528 bp appears in the first amplification product and no band appears in the second amplification product, the corn to be tested is determined to be homozygous for ZmCRK10 TypeB Type; When the first amplification product shows a band of 528 bp in length and the second amplification product shows a band of 285 bp in length, the maize to be tested is determined to be heterozygous for ZmCRK10 TypeA / ZmCRK10 TypeB Type; When the second amplification product shows a band of 285 bp in length and the first amplification product has no band, it is determined that the corn to be tested does not contain ZmCRK10 TypeB Homozygous ZmCRK10 TypeA type.

[0044] In the present invention, homozygous ZmCRK10 TypeB Type is the dominant disease-resistant type.

[0045] The present invention also provides a method for identifying corn varieties with excellent resistance to corn stalk rot, comprising the following steps: extracting genomic DNA of the corn to be tested; using the genomic DNA of the corn to be tested as a template, performing a first PCR amplification using the first upstream primer and the downstream primer in the primer set described in the above scheme to obtain a first amplification product; using the genomic DNA of the corn to be tested as a template, performing a first PCR amplification using the second upstream primer and the downstream primer in the primer set described in the above scheme to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; when a band with a length of 528 bp appears in the first amplification product and no band appears in the second amplification product, it is determined that the corn to be tested has strong resistance to corn stalk rot; when a band with a length of 285 bp appears in the second amplification product, it is determined that the corn to be tested has weak resistance to corn stalk rot.

[0046] To further illustrate the present invention, the application of the maize disease-resistant gene ZmCRK10 and its disease-resistant molecular marker provided by the present invention in improving maize stalk rot resistance is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] 1. Construction of a CRISPR knockout vector for maize ZmCRK10-T03 and acquisition and detection of a CRISPR knockout transgenic maize line. For specific methods, see CN 118956901 A.

[0049] 2. Construction of the maize ZmCRK10-T03 overexpression vector and acquisition and detection of ZmCRK10-T03 overexpressing transgenic maize lines. For specific methods, see CN 118956901 A.

[0050] Example 2

[0051] Identification of resistance of the ZmCRK10-T03 overexpressing transgenic line to corn stalk rot in Example 1

[0052] 1. Inoculate corn rootlets with Fusarium graminearum.

[0053] The Fusarium graminearum strain is F.g0609, which comes from the research group of Professor Gao Xiquan of Nanjing Agricultural University.

[0054] 1) Activation of pathogens

[0055] Remove the F.g0609 strain from the -80°C freezer and, using a sterile laminar flow hood, place the bacterial mass on PDA solid medium and incubate it upside down in a 25°C incubator for 3 days. Remove the plate once the mycelium has completely covered the entire plate and set aside.

[0056] 2) Wheat grain culture pathogen inoculum

[0057] Weigh 200 g of wheat grains and place them in a high-temperature sterilization bag (13 × 26 × 5 cm). Add 100 mL of tap water and autoclave at 121°C for 30 min. After cooling naturally to room temperature, inoculate 12 6 mm F.g0609 cakes on a sterile workbench and incubate in a dark incubator at 25°C for 10 days. Knead and mix thoroughly every other day to ensure robust growth of the pathogen. Once the wheat grain inoculum is established, remove it from the bag, mix thoroughly, and air-dry for later use.

[0058] 3) Corn seed germination

[0059] Place 30 seeds in a 50ml centrifuge tube and add 30ml of distilled water to soak overnight. Discard the distilled water and add 25ml of 4% sodium hypochlorite disinfectant. Disinfect for 30 minutes, inverting the tubes every 10 minutes. After discarding the disinfectant, rinse the seeds three times with 25ml of sterile double-distilled water. Place the sterilized seeds in a 150mm Petri dish with a double layer of sterile filter paper on the bottom and soak them with sterile double-distilled water. Orient the embryo downward. Germinate the seeds in a dark incubator at 28°C for 3 days. Once the corn germinates and the rootlets are about 2cm long, remove the seeds and set aside.

[0060] 4) Inoculate corn seedlings with fungi.

[0061] Mix nutrient soil and fine sand in a 1:1 (v:v) ratio and sterilize. Then mix with wheat grain pathogen inoculum in a 3:1 (v:v) ratio. Place in a 15 cm diameter plastic pot. Place corn kernels that have been germinated for 3 days in the pot and cover with a layer of sterile soil (about 2 cm). After growing in a greenhouse at 24°C for 16 hours of light, 22°C for 8 hours of darkness, and 60% humidity for 7 days, dissect the entire corn seedling, clean it, and analyze the root phenotype.

[0062] The results are as follows Figure 1 As shown in a and b, without inoculation, there was no difference in the growth state of CRK10-T03-OE1 and its control CRK10-T03-OE1-WT in the seedling stage, and there was no difference in the growth state of the roots. However, under the inoculated state, the seedling growth state of CRK10-T03-OE1 was significantly better than that of its control CRK10-T03-OE1-WT, and the root growth state of CRK10-T03-OE1 was significantly better than that of the control CRK10-T03-OE1-WT. The root lesions of OE materials were also less, indicating that CRK10-T03-OE1 was more resistant to stem rot. Similarly, CRK10-T03-OE2 was also more resistant to stem rot than its control CRK10-T03-OE2-WT ( Figure 1 In conclusion, overexpression of CRK10-T03 transcripts can improve the resistance of plants to stem rot at the seedling stage.

[0063] 2. During the mature stage, injure the roots and bury them in the soil to inoculate stem rot.

[0064] 1) Preparation of corn kernel pathogen infection materials:

[0065] Soak corn kernels in water overnight to allow them to absorb and expand. Boil over high heat for 10 minutes. Weigh 500g of cooked corn kernels and place them in a sterilization bag. Sterilize at 121°C for 30 minutes. In a sterile laminar flow hood, add 12 F.g0609 fungus clumps to each bag of corn kernels. Incubate in a dark incubator at 25°C for 15-20 days. Rub the sterilization bag every other day to ensure uniform distribution. Once the pathogen culture is complete, remove the bag and air-dry in a cool, dark place until ready for use.

[0066] 2) Field root wound soil burial method of inoculation: Field inoculation needs to be carried out during the flowering period of corn. The above-mentioned dried corn kernel pathogens are fully mixed to ensure the uniformity of the inoculation amount. When inoculating, dig the capillary roots of the corn vertically downward at 5-10 cm from the root of the corn to ensure the invasion of the pathogen. Each plant is inoculated with about 50g of corn kernel pathogens, covered with soil and compacted. After inoculation, artificial watering is carried out to maintain soil moisture to promote the growth, reproduction and infection of Fusarium graminearum pathogens. Dig out the corn plants 50 days after inoculation, split the stems to observe the disease situation, and divide them into grades 1, 3, 5, 7, and 9 according to the degree of pathogen infection.

[0067] The results are as follows Figure 2 As shown in a, the pathogen infection degree of CRK10-T03-OE1 overexpressing plants was lower than that of the control plants CRK10-T03-OE1-WT, and the stems did not have too much pathogen infection, which caused the inside of the stems to turn black. The statistical results are shown in Figure 2 Figure b also shows that the disease level of overexpressed CRK10-T03-OE1 plants is lower than that of the control plants, indicating that CRK10-T03-OE1 overexpression plants have improved corn resistance to stalk rot. Similarly, CRK10-T03-OE2 overexpression plants also have significant resistance to stalk rot compared to the control plants CRK10-T03-OE2-WT ( Figure 2 In conclusion, CRK10-T03 improved the resistance of maize to stalk rot during the adult stage.

[0068] Example 3

[0069] Identification of resistance of ZmCRK10-T03-KO knockout lines to maize stalk rot

[0070] Maize rootlets were inoculated with Fusarium graminearum.

[0071] See Example 2 for the inoculation method.

[0072] like Figure 3 a in Figure 3As shown in Figure b, there is no difference in the growth status of crk10-T03-KO1 and its control crk10-T03-KO1-WT during the seedling stage, and there is no difference in the growth status of the roots. However, under the inoculated state, the seedling growth status of crk10-T03-KO1 is significantly weaker than that of its control crk10-T03-KO1-WT, and the root growth status is also significantly weaker than that of the control crk10-T03-KO1-WT. The degree of pathogen infection is also more serious in the KO material, indicating that crk10-T03-KO1 is more susceptible to stem rot. The same is true for crk10-T03-KO2 compared to its control. In summary, knocking out CRK10-T03 transcripts can reduce the plant's resistance to stem rot during the seedling stage.

[0073] Example 4

[0074] Identification of resistance of ZmCRK10 promoter variant NIL population to maize stalk rot

[0075] 1. Phenotypic Identification of Stem Rot in LY042 / CML423 and BC3F3 Populations

[0076] 1)ZmCRK10 TypeA ,ZmCRK10 TypeB Type genotype identification

[0077] Maize disease resistance molecular marker ZmCRK10 TypeB The primer pairs are:

[0078] ZmCRK10 TypeB -F1:GCTACCCTCTAGAAGGCCCG

[0079] ZmCRK10 TypeB -R1:GCATAGGTGGAATCGTCGCAG

[0080] ZmCRK10 TypeA -F1:TTCGCGCACGCCCATTTAAC

[0081] ZmCRK10 TypeB -F1 and ZmCRK10 TypeB -R1 combination amplified DNA band was 528 bp, and ZmCRK10 TypeA -F1 and ZmCRK10 TypeB If no band is amplified by the -R1 combination, the corn variety is homozygous for ZmCRK10 TypeB Dominant disease-resistant type. TypeA -F1 and ZmCRK10 TypeB-R1 combination amplified a DNA fragment of 285 bp in size, and ZmCRK10 TypeB -F1 and ZmCRK10 TypeB If the -R1 combination fails to amplify a DNA band, it indicates homozygous ZmCRK10 TypeA type.

[0082] like Figure 4 a in Figure 4 The b in.

[0083] 2) Seedling inoculation stem rot phenotype

[0084] See Example 2 for the inoculation method.

[0085] like Figure 4 c in Figure 4 As shown in d, ZmCRK10 TypeB Type plants and ZmCRK10 TypeA The growth status and root phenotype of the plants of different types were consistent. TypeB The growth state of the mutant plants at the seedling stage was significantly better than that of ZmCRK10 TypeA Mutation type, and ZmCRK10 TypeB The root growth of the variant type is better than that of ZmCRK10 TypeA Variant type, the pathogen infection level is much lower than ZmCRK10 TypeA Variant type. In summary, ZmCRK10 TypeB The variant type improves the corn plant's resistance to corn stalk rot.

[0086] 2. Phenotypic Identification of Stem Rot in K22 / CI7 and BC6F3 Populations

[0087] 1)ZmCRK10 TypeA ,ZmCRK10 TypeB Type genotype identification

[0088] The primer pair for the maize disease resistance molecular marker ZmCRK10Type B was identified as shown above:

[0089] The results are as follows Figure 5 As shown in a in , b in 5.

[0090] 2) Phenotype of stem rot in seedlings after inoculation

[0091] 3) See Example 2 for the inoculation method. Figure 5 c in Figure 5 As shown in d, ZmCRK10 TypeB Type plants and ZmCRK10 TypeAThe growth status and root phenotype of the plants of different types were consistent. TypeB The growth state of the mutant plants at the seedling stage was significantly better than that of ZmCRK10 TypeA Mutation type, and ZmCRK10 TypeB The root growth of the variant type is better than that of ZmCRK10 TypeA Variant type, the pathogen infection level is much lower than ZmCRK10 TypeA Variant type. In summary, ZmCRK10 TypeB The variant type improves the corn plant's resistance to corn stalk rot.

[0092] 4) Field root wounding soil burial inoculation: The inoculation method is shown in Example 2, and the results are as follows: Figure 6 As shown, ZmCRK10 TypeB Plants were compared with their control plants ZmCRK10 TypeA The pathogen infection level is low, and the stems do not have too much pathogen infection, which causes the inside of the stems to turn black. Figure 7 , also showed that overexpressed ZmCRK10 TypeB The disease level of plants was higher than that of control ZmCRK10 TypeA The plant should be low, indicating that ZmCRK10 TypeB The mutant plants have improved the resistance of corn to stalk rot. TypeB The variant type improves the plant's resistance to corn stalk rot.

[0093] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of disease resistance gene ZmCRK10 or disease resistance protein ZmCRK10-T03 in improving corn stalk rot resistance, characterized in that: The genomic nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.1; The CDS nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.2; The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.

3.

2. The use of knocking out or knocking down the disease resistance gene ZmCRK10 or the disease resistance protein ZmCRK10-T03 in constructing a plant model susceptible to corn stalk rot, characterized in that: The genomic nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.1; The CDS nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.2; The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.

3.

3. Disease resistance molecular marker of maize disease resistance gene ZmCRK10 TypeB The application in improving corn stalk rot resistance is characterized in that: The disease resistance molecular marker ZmCRK10 TypeB The nucleotide sequence is shown in SEQ ID NO.

4.

4. The use according to any one of claims 1 to 3, characterized in that The pathogens causing the corn base rot include one or more of the following pathogens: Pythium graminicola Subraman, Pythium spinosum Sawada, Pythium aphanidermatum (Edson) Fitzp and Pythium inflatum VD Matthews.

5. A method for improving corn stalk rot resistance, characterized in that: The following steps are involved: Overexpression of the disease resistance gene ZmCRK10 or the disease resistance protein ZmCRK10-T03 in maize plants; The genomic nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.1; The CDS nucleotide sequence of the disease resistance gene ZmCRK10 is shown in SEQ ID NO.2; The amino acid sequence of the disease-resistant protein ZmCRK10-T03 is shown in SEQ ID NO.

3.

6. A method for detecting the disease resistance molecular marker ZmCRK10 TypeB The primer set is characterized in that The primer set includes a first upstream primer whose nucleotide sequence is shown as SEQ ID NO.5, a second upstream primer whose nucleotide sequence is shown as SEQ ID NO.6, and a downstream primer whose nucleotide sequence is shown as SEQ ID NO.

7.

7. A method for detecting the disease resistance molecular marker ZmCRK10 TypeB The kit is characterized in that Comprising the primer set according to claim 6 and a reagent for PCR amplification.

8. Use of the primer set according to claim 6 or the kit according to claim 7 in identifying corn varieties with excellent resistance to corn stalk rot.

9. A method for detecting the disease resistance molecular marker ZmCRK10 TypeB The method is characterized in that The following steps are involved: Extracting genomic DNA of the corn to be tested; Using the genomic DNA of the corn to be tested as a template, a first PCR amplification is performed using the first upstream primer and the downstream primer in the primer set of claim 6 to obtain a first amplification product; Using the genomic DNA of the corn to be tested as a template, a first PCR amplification is performed using the second upstream primer and the downstream primer in the primer set of claim 6 to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; When the first amplification product showed a band of 528 bp in length and the second amplification product had no band, the maize to be tested was determined to be homozygous for ZmCRK10. TypeB type; When the first amplification product showed a band of 528 bp in length and the second amplification product showed a band of 285 bp in length, the maize to be tested was determined to be heterozygous for ZmCRK10. TypeA / ZmCRK10 TypeB type; When the second amplification product shows a band of 285 bp in length and the first amplification product has no band, it is determined that the corn to be tested is homozygous and does not contain ZmCRK10. TypeB ZmCRK10 TypeA type.

10. A method for identifying corn varieties with superior resistance to corn stalk rot, characterized in that: The following steps are involved: Extracting genomic DNA of the corn to be tested; Using the genomic DNA of the corn to be tested as a template, a first PCR amplification is performed using the first upstream primer and the downstream primer in the primer set of claim 6 to obtain a first amplification product; Using the genomic DNA of the corn to be tested as a template, a first PCR amplification is performed using the second upstream primer and the downstream primer in the primer set of claim 6 to obtain a second amplification product; performing electrophoresis on the first amplification product and the second amplification product; When a band of 528 bp appears in the first amplified product and no band appears in the second amplified product, it is determined that the tested corn has strong resistance to corn stalk rot; When a band of 285 bp appears in the second amplification product and there is no band of the first amplification product, it is determined that the resistance of the tested corn to corn stalk rot is weak.

Citation Information

Cited By

  • Application of corn zma-miR319 and / or target gene of corn zma-miR319 in regulation and control of corn stem rot resistance

    CN121249749A