Lactobacillus gasseri JY01 and application thereof

Abstract

The invention provides lactobacillus gasseri JY01, and belongs to the technical field of probiotic application, the lactobacillus gasseri JY01 is preserved in Guangdong Microbial Culture Collection Center on May 21, 2025, the preservation number is GDMCC NO. 66341, and the nucleotide sequence is shown as SEQ ID No: 1. The strain is obtained by separating and purifying a pickle sample produced in Liaoning region of China, has multiple functions of producing gamma-aminobutyric acid (GABA) at high yield, reducing blood sugar, resisting oxidation, regulating gastrointestinal tracts and the like, and has very high application value and economic value.

Description

Technical Field

[0001] The present invention relates to the technical field of probiotic applications, and in particular to Lactobacillus gasseri JY01 and applications thereof. Background Art

[0002] Lactobacillus gasseri ( Lactobacillus gasseri Lactobacillus gasseri is a Gram-positive lactic acid bacterium widely found in the human intestine and female reproductive tract, with excellent colonization and beneficial effects. It produces lactic acid and bacteriocins, inhibiting the growth of harmful bacteria and helping to maintain a balanced intestinal and vaginal microbiome. It also demonstrates potential in immune regulation and improving metabolic health (e.g., combating obesity and lowering blood sugar). Due to its excellent physiological properties, Lactobacillus gasseri is widely used in functional foods, dietary supplements, and medical research.

[0003] Lactobacillus gasseri is a widely distributed and versatile lactic acid bacterium that can survive in the gastrointestinal tract of fermented foods, meat, and mammals. As a key component of the normal intestinal microbiome and a lifelong companion of the host, it plays a crucial role in maintaining the balance of the intestinal microbiome. In recent years, Lactobacillus gasseri has become a research hotspot due to its significant advantages and has gained significant attention in the food and health product industries.

[0004] Research indicates that Lactobacillus gasseri exhibits multiple beneficial effects: 1. Improved Metabolic Health: Studies have shown that Lactobacillus gasseri can influence lipid metabolism and reduce body fat accumulation, thus showing potential for regulating weight and improving obesity-related metabolic disorders. For example, Lactobacillus gasseri strains have been shown to lower serum total cholesterol and low-density lipoprotein (LDL) levels, contributing to cardiovascular health. 2. Gastrointestinal Protection: Lactobacillus gasseri can strengthen intestinal barrier function, reduce the risk of leaky gut, and help alleviate intestinal inflammation. For example, Lactobacillus gasseri strains can reduce bloating and abdominal pain in patients with irritable bowel syndrome (IBS), improving digestive comfort. 3. Anti-Helicobacter pylori Effect: Lactobacillus gasseri inhibits Helicobacter pylori colonization through competitive exclusion and secretion of antimicrobial substances, and can alleviate gastric inflammation to a certain extent. For example, studies have shown that Lactobacillus gasseri SBT2055 can significantly reduce gastric inflammation in patients infected with Helicobacter pylori, contributing to improved gastric health.

[0005] Lactobacillus gasseri has a wide range of sources and possesses rich genetic and functional diversity. However, research into its isolation, identification, probiotic properties, and metabolic mechanisms is relatively insufficient. Although some strains with probiotic functions have been discovered, their number remains insufficient. While current research has made some progress in the functions and applications of Lactobacillus gasseri, its potential benefits have yet to be fully explored and developed. Therefore, it is necessary to further explore more Lactobacillus gasseri with probiotic functions and to delve deeper into their functions based on their diverse sources to enable them to function more effectively. For example, the efficacy of Lactobacillus gasseri can be determined based on its functions and probiotic metabolites, thereby clarifying its application prospects in different fields. Overall, there is broad room for further research into the probiotic properties and application prospects of Lactobacillus gasseri. Summary of the Invention

[0006] In order to solve the above-mentioned defects and deficiencies in the prior art, the present invention provides a Lactobacillus gasseri ( Lactobacillus gasseri )JY01 strain, which has multiple functions such as high production of γ-aminobutyric acid (GABA), lowering blood sugar, antioxidant and gastrointestinal regulation.

[0007] To solve the above technical problems: The first object of the present invention is to provide a strain of Lactobacillus gasseri ( Lactobacillus gasseri )JY01 strain, which was deposited in Guangdong Provincial Microbial Culture Collection Center on May 21, 2025, with the deposit number: GDMCCNO.66341; the 16SrDNA complete sequence of the Lactobacillus gasseri JY01 strain is shown in SEQIDNo: 1.

[0008] The second object of the present invention is to provide a use of Lactobacillus gasseri JY01 or its fermentation broth in increasing the production of γ-aminobutyric acid, wherein the fermentation method of the fermentation broth is as follows: S1 Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 was activated in MRS medium; S2: inoculate the activated bacterial solution into a shake flask and ferment for 24-96 hours; Among them, the culture temperature was 37°C and the rotation speed was 200 rpm; The components and concentrations of the fermentation broth are: 20 g / L glucose, 10 g / L peptone, 4 g / L yeast powder, 5 g / L beef extract, 10 g / L MSG, 2 g / L K2HPO4, 0.1 g / L MgSO4, 1 mL / L Tween 80, 3 g / L anhydrous sodium acetate, 2 g / L ammonium citrate, 0.033 g / L mnSO4·H2O, pH=6.5.

[0009] The third object of the present invention is to provide a Lactobacillus gasseri ( Lactobacillus gasseri) Use of JY01 or its fermentation broth in the preparation of a product for lowering blood sugar.

[0010] The fourth object of the present invention is to provide a Lactobacillus gasseri ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in the preparation of antioxidant products.

[0011] The fifth object of the present invention is to provide a Lactobacillus gasseri ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in the preparation of products for regulating the gastrointestinal tract.

[0012] The beneficial technical effects achieved by the present invention are as follows: the present invention provides a Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 is a kimchi sample produced in Liaoning Province, China. It is obtained through separation and purification. It has multiple functions such as high production of γ-aminobutyric acid (GABA), lowering blood sugar, antioxidant, regulating gastrointestinal tract, etc., and has high application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a colony picture of Lactobacillus gasseri JY01 of the present invention; Figure 2 This is a phylogenetic tree of Lactobacillus gasseri JY01 of the present invention; Figure 3 This is a bar graph of the GABA production capacity of Lactobacillus gasseri JY01 of the present invention, wherein 3A is a standard curve of GABA, and 3B is the amount of GABA produced by Lactobacillus gasseri JY01 at different times; Figure 4 This is a bar graph showing the inhibition of α-amylase by Lactobacillus gasseri JY01 of the present invention; Figure 5 A bar graph showing the total antioxidant capacity of Lactobacillus gasseri JY01 according to the present invention; Figure 6 This is a graph showing the acid resistance of Lactobacillus gasseri JY01 of the present invention; Figure 7 This is a hydrophobicity histogram of Lactobacillus gasseri JY01 of the present invention; Figure 8 This is a histogram of the autoagglutination ability of Lactobacillus gasseri JY01 of the present invention. DETAILED DESCRIPTION

[0014] The present invention will be further described below in conjunction with specific examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention.

[0015] The present invention is further described below with reference to the accompanying drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified. The experimental materials involved in the following examples are as follows: Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 strain: isolated from a kimchi sample produced in Liaoning, China, and stored in a glycerol tube at -78°C.

[0016] Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 strain fermentation broth: inoculate the bacteria onto MRS solid culture medium plates, culture them upside down in a constant temperature anaerobic incubator at 37°C for 24 hours to obtain colonies, and pick out single colonies to culture in MRS liquid culture medium to obtain fermentation broth.

[0017] MRS plate medium: 5 g beef extract, 10 g peptone, 4 g yeast extract, 2 g triammonium citrate, 3 g anhydrous sodium acetate, 20 g glucose·H2O, 2 g dipotassium hydrogen phosphate, 80 1 mL Tween, 0.2 g MgSO4·7H2O, 0.037 g manganese sulfate, 15 g agar, make up to 1 L with ROH2O, adjust pH to 6.5, autoclave at 121°C for 20 min, and prepare MRS plates.

[0018] MRS liquid medium: 5 g beef extract, 10 g peptone, 4 g yeast extract, 2 g triammonium citrate, 3 g anhydrous sodium acetate, 20 g glucose·H2O, 2 g dipotassium hydrogen phosphate, 801 mL Tween, 0.2 g magnesium sulfate·MgSO4·7H2O, 0.037 g manganese sulfate, and ROH2O to 1 L. Adjust the pH to 6.5 and sterilize by autoclave at 121°C for 20 min to prepare MRS liquid medium.

[0019] MRS slant medium: 5 g beef extract, 10 g peptone, 4 g yeast extract, 2 g triammonium citrate, 3 g anhydrous sodium acetate, 20 g glucose·H2O, 2 g dipotassium hydrogen phosphate, 801 mL Tween, 0.2 g magnesium sulfate·MgSO4·7H2O, 0.037 g manganese sulfate, and make up to 1 L with ROH2O. Adjust the pH to 6.5 and sterilize by autoclave at 121°C for 20 min. Pour the culture medium into a tilted test tube before it solidifies and insert cotton into the bottle mouth. Wait for it to condense to make a tilted culture medium.

[0020] Example 1 Lactobacillus gasseri ( Lactobacillus gasseri ) Isolation and identification of JY01 Lactobacillus gasseri JY01 was isolated from kimchi samples produced in Liaoning, China. The specific process is as follows: Take 1 gram of kimchi sample purchased from Liaoning Province, suspend it in 9 mL of sterile physiological saline solution (NSS, 0.85% (w / v)), and homogenize it to obtain kimchi bacteria suspension. Pipette 1 mL of the kimchi bacteria suspension into 9 mL of sterile water and mix thoroughly to obtain 10 -2 Gradient, and so on to get 10 -3 , 10 -4 and 10 -5 Use a sterile pipette to take 100uL of bacterial solution from each gradient dilution and spread it evenly on an MRS plate medium. Incubate at 37°C for 2 days. Select the colonies with milky white protrusions, then pick a single colony and streak culture on a fresh MRS plate medium. Incubate at 37°C for 48 hours to obtain pure bacterial colonies. The results are as follows Figure 1 shown.

[0021] The obtained pure bacterial colonies were transferred to MRS slant medium, and the 16S rDNA of the strain was sequenced using 16S rDNA universal primers (SEQ ID NO: 2: F: AGAGTTTGATCCTGGCTCAG, SEQ ID NO: 2: R: TACGGCTACCTTGTTACGACTT), and its gene sequence was obtained as shown in SEQ ID NO: 1, and a phylogenetic tree was created, as shown in Figure 2 shown.

[0022] SEQ ID NO: 1:

[0023] Example 2 Lactobacillus gasseri ( Lactobacillus gasseri )Detection of JY01's ability to produce γ-aminobutyric acid 1) Preparation of the γ-aminobutyric acid standard curve: γ-aminobutyric acid (GABA) standard solution with concentrations of 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, 0.5 g / L, 0.6 g / L, 0.7 g / L, 0.8 g / L, 0.9 g / L, and 1.0 g / L was accurately prepared with ultrapure water. 0.5 ml of the standard solution was placed in an ice bath. 0.2 ml of 0.2 mol / L (pH = 9) borate buffer solution, 1 ml of phenol solution, and 0.4 ml of sodium hypochlorite solution were added. After thorough shaking, the solution was reacted in a 100°C water bath for 7 minutes. Immediately cool in an ice bath for 9 minutes. After the solution turns blue-green, 2 ml of distilled water was added. The absorbance was measured at a wavelength of 630 nm. A standard curve was drawn with GABA concentration as the horizontal axis and absorbance as the vertical axis, as shown in the following example: Figure 3 As shown in 3A.

[0024] 2) Lactobacillus gasseri ( Lactobacillus gasseri ) Fermentation culture: The bacterial liquid was activated with MRS medium and inoculated into the fermentation medium. The inoculation volume was 4%, and the culture conditions were 37°C and 200 rpm shaking. 1 mL of fermentation liquid was collected every 24 hours, centrifuged at 5000 rpm for 3 minutes, and the supernatant was collected. The absorbance value of the supernatant was detected at a wavelength of 630 nm. The obtained absorbance value was substituted into the standard curve to calculate the GABA content. The blank culture medium was used as the control group. The results are shown in Figure 2. Figure 3 As shown in Figure 3B, at the start of fermentation, the GABA content gradually increased, reaching 1.94 g / L at 24 hours. However, at 48 hours, the GABA content decreased slightly, falling to 1.38 g / L. By 72 hours, the GABA content had increased dramatically, reaching a high of 3.22 g / L at 96 hours of fermentation. This indicates that the optimal fermentation time is 96 hours, and the yield is 3.22 g / L. Therefore, the Lactobacillus gasseri JY01 provided by the present invention has a high GABA production capacity.

[0025] GABA can effectively improve sleep quality, lower blood ammonia, resist convulsions, lower blood pressure, improve brain function, calm the mind, promote growth hormone secretion and increase brain activity, accelerate brain metabolism, regulate airway allergic reactions, and suppress coughs. Therefore, the Lactobacillus gasseri JY01 of the present application can be used to prepare medicines and other related products to alleviate or treat the above symptoms.

[0026] Example 3 Lactobacillus gasseri ( Lactobacillus gasseri ) Testing of JY01's blood sugar-lowering ability Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 bacterial liquid was inoculated into MRS liquid culture medium with an inoculation amount of 4%. The culture was carried out at 37°C and 200rpm for 24 hours to obtain bacterial fermentation liquid. Take 25μL bacterial fermentation liquid, add 25μL of 1mg / mL α-amylase solution, mix evenly in a 1.5ml centrifuge tube, incubate at 37°C for 10min, then add 50μL of 1.5% soluble starch, incubate at 37°C for 15min, and terminate the reaction with 50μL DNS reagent. Transfer the reaction mixture to a 100°C boiling water bath, incubate for 5min, then cool to room temperature, transfer to a 96-well plate, and detect the absorbance OD (540nm) at 540nm using a microplate reader. The standard curve method was used to calculate the inhibition rate of Lactobacillus gasseri JY01 on α-amylase, and the results are as follows. Figure 4 The calculation formula of the inhibition rate of α-amylase is as follows: α-amylase inhibition rate (%) = (OD (540nm) 初始 -OD(540nm) 检测点 ) / OD(540nm) 初始 from Figure 4 As can be seen, compared to blank culture medium, the 48-hour mixed fermentation of Lactobacillus gasseri JY01 and α-amylase showed an α-amylase inhibition rate of 95.5%. This indicates that Lactobacillus gasseri JY01 has a strong ability to inhibit α-amylase and can be used in the preparation of hypoglycemic drugs, preparations, and other related products.

[0027] Example 4 Lactobacillus gasseri ( Lactobacillus gasseri ) Detection of antioxidant capacity of JY01 Stable Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 was expanded into MRS liquid culture medium with an inoculation volume of 4%. The bacterial suspension was collected after 24 hours, 200ul of pre-cooled PBS was added, and then ultrasonic treatment was performed. The purpose of ultrasonic treatment was to fully break up the bacterial cells to release the antioxidant enzymes, vitamin C, vitamin E and carotene inside. Centrifugation was performed and the supernatant was collected for later use. The centrifugation conditions were 4°C, 12000r / min, and the centrifugation time was 5min. The total antioxidant capacity of the fermentation broth was determined using the T-AOC (FRAR method) specific ELISA kit (TO1005). Among them, the detection principle of -AOC (FRAR method) is: in an acidic environment, the substance reduces Fe 3+ -tripyridine triazine (Fe 3+ -TPTZ) produces blue Fe 2+ -TPTZ's ability reflects its total antioxidant capacity. Figure 5As shown in the figure: the blank culture medium MRS has no antioxidant capacity, and the total antioxidant capacity of the fermentation broth of Lactobacillus gasseri strain JY01 is 0.6465mmol / g, indicating that Lactobacillus gasseri JY01 has certain antioxidant properties and can eliminate activated oxygen and free radicals produced in the body.

[0028] Example 5 Lactobacillus gasseri ( Lactobacillus gasseri ) Detection of JY01's ability to regulate the gastrointestinal tract 1. Acid resistance test: Lactobacillus gasseri in the stable period ( Lactobacillus gasseri ) JY01 was expanded into 50 mL of LMRs liquid culture medium with pH values ​​of 6.5, 4.0, and 3.0, with an inoculum size of 4%. The culture was maintained at 37°C and 200 rpm for 24 h. The OD (600 nm) values ​​at 0 h, 6 h, 12 h, and 24 h were measured. The concentration of Lactobacillus gasseri JY01 under different culture conditions was calculated using the standard curve method. The blank culture medium was used as the control. The results are shown in Figure 2. Figure 6 As shown, after 24 hours of growth in pH 4 medium, the OD (600nm) of Lactobacillus gasseri JY01 was 1.55, while after 24 hours of growth in pH 3 medium, the OD600 remained at 0.6, with a survival rate of approximately 27%. This indicates that Lactobacillus gasseri JY01 has strong acid tolerance and can survive in relatively acidic environments.

[0029] 2. Colonization experiment: Sterile phosphate-buffered saline was used to adjust the number of Lactobacillus gasseri JY01 cells at the end of the logarithmic phase to an equivalent standard bacterial concentration (OD600nm = 1 ± 0.05, 1x10 8 CFU / mL), centrifuge and collect the bacterial precipitate, the centrifugation conditions are 12000rpm, 4℃, 10min. Wash the bacterial precipitate twice with 0.1moL / mL sterile phosphate buffered saline (pH=7.2±0.2) and then suspend it in 0.1moL / mL sterile phosphate buffered saline (PBS). Pipette 3mL of the bacterial suspension, add 1mL of xylene, pre-incubate at room temperature for 10min, quickly vortex mix for 2min, and then incubate at room temperature for 20min. After the mixed solution is separated, the lower aqueous phase is aspirated, the absorbance at 600nm is measured, and the hydrophobicity of Lactobacillus gasseri JY01 is calculated as follows: Hydrophobicity (%) = 1-OD(600nm) 检测点 / OD(600nm) 初始 The results are as follows Figure 7 As shown: The experimental determination shows that the hydrophobicity of Lactobacillus gasseri JY01 is 22.32%, indicating that Lactobacillus gasseri JY01 can effectively colonize the human gastrointestinal tract.

[0030] 3. Adhesion test: Lactobacillus gasseri JY01 was incubated in MRS liquid medium for 24 h at 37°C, and then the bacterial count was adjusted to the standard bacterial concentration (A600 = 1 ± 0.05, 1x10 8 CFU / mL) and sterile phosphate-buffered saline at a concentration of 0.1 mol / mL. The bacterial pellet was collected by centrifugation at 4°C, 12,000 rpm, and 10 min. The bacterial pellet was washed twice with 0.1 mol / mL sterile phosphate-buffered saline (pH = 7.2 ± 0.2), resuspended, and incubated at room temperature for 0 h, 2 h, 4 h, and 6 h. The absorbance at 600 nm was measured and the autoagglutination rate of Lactobacillus gasseri JY01 was calculated using the following formula: Autoagglutination rate (%) = 1 - OD (600 nm) 检测点 / OD(600nm) 初始 The results are as follows Figure 8 As shown, the autoaggregation rate of Lactobacillus gasseri JY01 reached 16.7% after 6 hours of storage. Bacterial autoaggregation significantly influences bacterial adhesion to intestinal cells, while coaggregation eliminates gastrointestinal pathogen colonization by preventing pathogens from attaching to host tissues, demonstrating that this strain has excellent pathogen-clearing capabilities.

[0031] The present invention has been disclosed above with preferred embodiments, which are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. A Lactobacillus gasseri ( Lactobacillus gasseri ) JY01, characterized by: The Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 was deposited in Guangdong Provincial Microbiological Culture Collection Center on May 21, 2025, with the deposit number: GDMCC NO. 66341, and the nucleotide sequence is shown in SEQ ID No:

1.

2. Lactobacillus gasseri according to claim 1 ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in increasing the yield of γ-aminobutyric acid, characterized in that: The fermentation method of the fermented liquid is as follows: S1 Lactobacillus gasseri ( Lactobacillus gasseri ) JY01 was activated in MRS medium; S2: inoculate the activated bacterial solution into a shake flask and ferment for 24-96 hours; Among them, the culture temperature was 37°C and the rotation speed was 200 rpm; The components and concentrations of the fermentation broth are: 20 g / L glucose, 10 g / L peptone, 4 g / L yeast powder, 5 g / L beef extract, 10 g / L MSG, 2 g / L K2HPO4, 0.1 g / L MgSO4, 1 mL / L Tween 80, 3 g / L anhydrous sodium acetate, 2 g / L ammonium citrate, 0.033 g / L mnSO4·H2O, pH=6.

5.

3. Lactobacillus gasseri according to claim 1 ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in the preparation of a product for lowering blood sugar.

4. Lactobacillus gasseri according to claim 1 ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in the preparation of antioxidant products.

5. Lactobacillus gasseri according to claim 1 ( Lactobacillus gasseri ) Use of JY01 or its fermentation broth in the preparation of products for regulating the gastrointestinal tract.

Images