Kit for identifying genotyping of functional marker of waxy gene of corn variety

By designing a dual-platform compatible kit suitable for KASP and capillary electrophoresis platforms, the problems of low efficiency and insufficient accuracy in glutinous corn breeding were solved, and high-throughput, low-cost glutinous gene detection and classification were achieved.

CN120666068APending Publication Date: 2025-09-19BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510739144.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

In the existing technology, traditional glutinous corn breeding methods are inefficient and lack accuracy, making it difficult to meet the needs of high-throughput testing. In addition, existing molecular marker technologies cannot cover all glutinous corn variations and cannot be applied on different detection platforms.

Method used

A dual-platform compatible kit was designed, which contains KASP primer combinations targeting wx-D7, wx-D10, wx-124 and wx-hAT. It can perform high-throughput detection on KASP and capillary electrophoresis platforms, realizing rapid and accurate identification and screening of waxy genes.

Benefits of technology

It significantly improves the efficiency and accuracy of glutinous corn breeding, shortens the breeding cycle, reduces costs, is applicable to multiple testing platforms, and can accurately identify and classify more than 98% of glutinous corn varieties on the market.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666068A_ABST
    Figure CN120666068A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular markers, and particularly provides a kit for identifying the genotyping of a functional marker of a waxy gene of a corn variety. The multi-marker multi-detection platform compatible kit provided by the invention contains a primer combination as shown in SEQ ID NO.1-14, can detect and distinguish waxy genes wx-D7, wx-D10, wx-124 and wx-hAT at the same time, significantly improves the accuracy and efficiency of corn waxy gene detection, can be used on different molecular detection platforms, and has broad application prospects. Such as a KASP high-throughput platform and a capillary electrophoresis platform. According to the double-platform compatible kit provided by the invention, the waxy corn breeding period is greatly shortened, the breeding efficiency and accuracy are improved, and the use cost and the technical learning threshold are reduced, so that waxy corn breeding, variety identification and germplasm resource management are quicker and more accurate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a kit for genotyping and identification of functional markers of glutinous genes of corn varieties. Background Art

[0002] In the field of modern agricultural science and technology, glutinous corn is highly valued for its unique edible and industrial value. wx Control, the main mutation types are: wx -D7, wx -D10, etc. These genes can effectively identify and utilize glutinous corn and play a key role in breeding, germplasm resource management, and variety identification.

[0003] The primary technical challenge with existing waxy corn breeding technology is the low efficiency and inaccuracy of traditional phenotypic screening methods. Traditional breeding methods rely on phenotypic selection, such as observing seed transparency to determine the presence of waxy genes. This requires waiting for crops to grow and screening each seed individually. This method is time-consuming and inefficient, resulting in lengthy breeding cycles. Furthermore, phenotypic observation is susceptible to environmental factors, such as temperature and humidity fluctuations, which can affect observation results, reduce selection accuracy, and fail to meet the demands of modern, efficient agriculture.

[0004] Early functional markers have limitations in diversity analysis and large-scale screening. Furthermore, existing molecular marker technologies often fail to capture all types of waxy variants during screening and cannot effectively distinguish all waxy variants. Gene identification using traditional molecular biology methods often involves complex experimental steps and high technical barriers, making it difficult to meet the needs of high-throughput testing.

[0005] Corresponding molecular markers have been developed in previous studies. Xu Yang et al. developed a detection method based on KASP (Kompetitive AlleleSpecific PCR) wx -D7 molecular marker; Wu Xiaoyang et al. developed a wx -124 labeling; these studies are mostly based on single-platform labeling development, which cannot meet the diverse detection needs. Therefore, there is an urgent need to develop a new technology that is fast, efficient, and widely applicable to address these technical challenges.

[0006] Backcrossing is currently a primary method of waxy corn breeding. This process requires rapid tracking of recessive waxy genes. Traditional methods for screening for waxy variation are costly, time-consuming, and labor-intensive, lacking a method for quickly and easily detecting waxy gene types. To address the need for high sample throughput in backcross populations, the high-throughput, low-cost KASP platform is an option.

[0007] In view of the shortcomings of existing technologies, researchers urgently need to develop a new technology that is both efficient and economical. Taking into account the diversity of different breeding projects and laboratory equipment, the new technology should have cross-platform applicability to adapt to different testing needs. Summary of the Invention

[0008] In order to make up for the shortcomings of the existing technology, the present invention provides a kit for genetic typing and identification of functional markers of glutinous genes in corn varieties. The present invention obtains a combination of functional markers for identifying glutinous genes suitable for different detection platforms, which can quickly and accurately identify and screen glutinous corn carrying glutinous genes at the molecular level, and can quickly identify and distinguish the types of glutinous genes.

[0009] Based on this, the first aspect of the present invention provides a KASP primer combination, which includes one or more of the sequences shown in SEQ ID NOs. 1-3, 4-6, 7-10, or 11-14.

[0010] The sequences shown in SEQ ID NO.1-3 include: wx -D7-F1:5'-ATCTACAGGGACGCCGT-3', wx -D7-F2: 5'-CTCTGAACTGAACAACGC-3', wx -D7-R: 5'-GACGAGGTATACGAGCATGGA-3'; Sequences shown in SEQ ID NO. 4-6: wx -D10-F1:5'-GCCTGCAGCGCCTT-3', wx -D10-F2: 5'-GCCTGCAGCGCCTC-3', wx -D10-R: 5'-GGTGTCCGGTTCAGGC-3'; Sequences shown in SEQ ID NO.7-10: wx -124-F1:5'-TGCTTCTTGAGGTAGCACGAGG-3', wx -124-F2:5'-GTTGCTCTTGAGGTAGCACGAGA-3', wx-124-R1:5'-CCATCGACAAATTCAGAGGATCCCAA-3', wx -124-R2: 5'-GAGGACGTCGTGTTCGTCTGCAA-3'; Sequences shown in SEQ ID NO.11-14: wx -hAT-F1:5'-GTCCCAGGCGTCCTTGTACTC-3', wx -hAT-F2:5'-GTCCCAGGCGTCCTTGTACTG-3', wx -hAT-R1:5'-AGCTCGGCATACTCTAACTTAAAATCCTA-3', wx -hAT-R2: 5'-TCATGGTCGTCTCTCCCCGCTA-3'.

[0011] Furthermore, in the KASP primer combination, different F primers carry different fluorescent marker tags, and the fluorescent markers include one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0012] For example: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGTCGGAGTCAACGGATT.

[0013] The present invention selects 4 core waxy gene detection sites from more than 50 known waxy genes in corn. wx -D7, wx -D10, wx -124 and wx -hAT, primers were designed based on the characteristics of the core waxy gene detection site to obtain the sequences shown in SEQ ID NO.1-14.

[0014] The present invention targets 4 core waxy gene detection sites, wx -D7, wx -D10, wx -124 and wx -hAT designed primers are suitable for multiple molecular detection platforms.

[0015] Therefore, the second aspect of the present invention provides a dual-platform compatible kit for detecting the waxy gene in corn, comprising a waxy gene locus. wx-D7, wx-D10, wx -124, wx More specifically, the dual-platform compatible kit provided by the present invention contains the above-mentioned primer-probe combination.

[0016] The present invention applies a dual-platform compatible kit to a capillary electrophoresis platform to achieve multiple detection of multiple sites of a single variety; the present invention uses a dual-platform compatible kit on a KASP platform for high-throughput detection to track multiple individual strains with a single marker.

[0017] Based on this, in a third aspect, the present invention provides the use of the above-mentioned primer-probe combination or the above-mentioned multi-platform compatible kit in any of the following: (1) Identification of the waxy type of corn; (2) Screening, improvement or identification of waxy corn varieties; (3) Waxy gene tracking markers in corn; (4) Identification and management of corn germplasm resources.

[0018] In the present invention, the corn waxy gene tracking marker includes: In the backcross breeding of glutinous corn, individual corn plants are tested for a single glutinous gene; or in the breeding of sweet and glutinous double recessive homozygotes, individual corn plants are tested for a glutinous gene.

[0019] Furthermore, the aforementioned KASP primer combination or the aforementioned kit is used to detect the corn to be tested, and the waxy genotype of the corn to be tested is determined based on the test results.

[0020] Furthermore, it also includes: The waxy type of the corn to be tested is determined according to the waxy genotype of the corn to be tested.

[0021] Furthermore, when the corn to be tested is a corn inbred line, if a mutant sequence is detected at any one of the sites wx-D7, wx-D10, wx-124, and wx-hAT, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detected site, and the waxy phenotype is waxy; if no mutant sequence is detected at wx-D7, wx-D10, wx-124, and wx-hAT, the corn to be tested is judged to be non-waxy or to contain a rare mutation; When the corn to be tested is a corn hybrid, if a mutation sequence is detected at any one of wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detection site, and the waxy phenotype is waxy; if a mutation sequence is detected at any two of wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detection site, and the waxy phenotype is waxy. The phenotype is glutinous; if a mutant sequence is detected at any one of wx-D7, wx-D10, wx-124 and wx-hAT, and a non-mutated sequence is also detected, the genotype of the corn to be tested is judged to be a waxy mutation corresponding to the detected site and a wild genotype, and the waxy phenotype is non-glutinous; if no mutant sequence is detected in wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be non-glutinous or to contain a rare mutation.

[0022] The genotype limitation method of the present invention is a common limitation method in the art. Waxy corn is affected by recessive waxy quality ( wx ) gene controls an endosperm mutation type, and the recessive waxy gene contains multiple alleles such as wx -D7, wx -D10, wx -124, wx -hAT, these alleles form haplotypes wD7WD10W124WhAT (D7), WD7wD10W124WhAT (D10), WD7WD10w124WhAT (124) and WD7WD10W124whAT (hAT), which are dominant Wx The genetic haplotype is WD7WD10W124WhAT (Wx).

[0023] Furthermore, when the recessive waxy gene is a rare gene other than the above four InDel variants, wx Allele, then the allele is defined as wx -mut, the haplotype formed is WD7WD10W124WhAT(mut), and the corresponding waxy genotypes mut / mut, mut / D7, mut / D10, mut / 124 and mut / hAT are waxy; the waxy genotype mut / Wx is non-waxy.

[0024] Furthermore, these haplotypes can be used as tags to determine the waxy genotype.

[0025] In a fourth aspect, the present invention provides a method for breeding glutinous corn, wherein the dual-platform compatible kit is used to detect glutinous genes in the female parent used in hybridization and the progeny produced during the hybridization process.

[0026] Beneficial effects of the present invention: (1) Screening and combination of core waxy loci: The present invention selects 4 core waxy gene detection loci from more than 50 known waxy gene loci ( wx -D7, wx -D10, wx -124, wx -hAT) can accurately identify more than 98% of waxy corn varieties on the market; (2) Dual-platform compatible primer design: Existing technologies usually only design long sequences on the flanks of the waxy gene locus, which is limited to the electrophoresis platform. The present invention innovatively adopts a probe-type primer design to convert the variant site into a dimorphic detection scheme with insertions and deletions, making it compatible with multiple detection platforms including KASP and fluorescence capillary electrophoresis; (3) Specific and standardization of primer sequences: The present invention targets four core waxy gene loci. wx -D7, wx -D10, wx -124, wx -hAT, a total of 14 primer sequences were designed to achieve standardized detection of multiple sites; (4) Conversion of haplotype detection tags for waxy soya: This invention converts 14 detection primers designed based on 4 core waxy soya gene loci into 5+1 haplotype detection tags. These tags can be used to accurately classify more than 98% of waxy soya variants on the market. (5) The present invention uses the above 5+1 haplotype tags for variety identification to determine whether an unknown variety is a waxy variety and what type of waxy variety it is, and uses the haplotype tags as functional markers to determine the variety phenotype. This solution can apply the 5+1 haplotype tags to a capillary electrophoresis platform to achieve multiplex detection of multiple sites on a single variety; (6) Based on the solution provided by the present invention, the above 5+1 haplotype tags are used in waxy corn backcross breeding to detect waxy genes. Specifically, the 5+1 haplotype tags can be used in the KASP platform for high-throughput detection, tracking multiple individual plants with a single marker; (7) Germplasm identification and new gene mining: Based on the solution provided by this invention, the above 5+1 haplotype tags are used for germplasm identification. Similar to variety identification, new genes that potentially control the waxy phenotype can be reversely mined when the waxy phenotype of the germplasm is known. In addition, it can also better classify and manage waxy corn germplasm resources.

[0027] In summary, the present invention utilizes modern molecular biotechnology and genomic information to develop a series of functional primers based on waxy gene markers, resulting in a dual-platform compatible kit. This kit significantly improves the accuracy and efficiency of waxy gene detection in maize and can be used on different detection platforms, such as the KASP high-throughput platform and the capillary electrophoresis platform. The dual-platform compatible kit provided by the present invention significantly shortens the waxy maize breeding cycle, improves the efficiency and accuracy of breeding, reduces the cost of use and the technical learning threshold, and makes waxy maize breeding, variety identification, and germplasm resource management faster and more accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 This is a schematic diagram of the corn waxy gene mutation type and functional marker primer design. A is the corn waxy gene mutation type and allelic variation diagram; B is wx -D7, wx -D10 functional marker contains three primers, wx -124, wx The -hAT functional marker contains four primers; the sequences in square brackets represent variant sequences, and the sequences marked with different types of arrows represent primer sequences, among which the sequence marked with a straight arrow represents primer 1, the sequence marked with a dashed arrow represents primer 2, and the sequence marked with a double-line arrow represents primers 3 and 4.

[0030] Figure 2 Figure 2 is the genotyping results of four waxy gene functional markers using KASP and fluorescence capillary electrophoresis platform. A is the genotyping results of four functional markers based on the KASP platform. Each point represents the genotyping result of a corn material. The blue and red points represent the homozygous mutant genotype and the reference genotype, respectively, and the black point represents the blank control. B is the genotyping peak graph of four functional markers based on the fluorescence capillary electrophoresis platform. The blue one represents the waxy variation labeled with FAM fluorescence, and NTC is the no-template control.

[0031] Figure 3 This is the identification of waxy gene types of different types of corn germplasm based on the KASP platform. A is the genotyping results of four waxy gene variants in 302 corn germplasms; B is the genotyping results of four waxy gene variants in five waxy × non-waxy corn hybrids.

[0032] Figure 4These are the genotyping results of D7-1 and D7-2.

[0033] Figure 5 These are the genotyping results of D10-1 and D10-2. DETAILED DESCRIPTION

[0034] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0035] The DNA extraction method used in the present invention is as follows: the DNA of the test material is extracted by magnetic bead method, the DNA concentration and quality are detected by 1% agarose gel electrophoresis and Nanodrop2000, and the DNA is uniformly diluted to 20 ng / µL for use.

[0036] The KASP platform reaction system, program and data acquisition method used in the present invention are: PCR reaction system: 1 µL total system, including 1.5 µL DNA (dry), 0.5 µL 2× Master Mix (LGCGenomic, 1536 format, standard content ROX, UK), 0.486 µL deionized water or ultrapure water, and 0.014 µL KASP primer working solution.

[0037] PCR reaction program: 94°C, 15 min; 94°C, 20 s, 61-55°C, 10 cycles; 94°C, 20 s, 55°C, 60 s, 26 cycles; the amplified product was stored at 4°C.

[0038] Data collection: The original fluorescence signal was collected using Pherastar fluorescence scanner, and genotyping was performed using Klustercaller software. wx -D7, wx -D10, wx -124, wx -hAT tag, with wx -D7, wx -D10, wx -124, wx - Samples containing the hAT waxy gene should detect significant FAM fluorescence, and the samples should be concentrated at x Axis direction; samples other than the above waxy genes should detect significant HEX fluorescence, and samples are clustered in y axial direction; samples with heterozygous genotypes should cluster in the diagonal direction.

[0039] The fluorescence capillary platform reaction system, procedure and data acquisition method used in the present invention are: PCR reaction system: The total system is 20 µL, including 2 µL DNA, 10 µL 2× Taq Plus Master Mix, 7.72 µL deionized water or ultrapure water, and 0.28 µL fluorescence capillary electrophoresis primer working solution.

[0040] PCR reaction program: 95°C, 5 min; 95°C, 40 s, 65°C, 35 s, 35 cycles; the amplified product was stored at 4°C.

[0041] Data acquisition: PCR products were diluted 20-fold. 9.05 μL of deionized formamide, 0.05 μL of GS3730_500 molecular weight internal standard, and 2 μL of the diluted PCR product were added to each well of a 96-well plate. The samples were denatured at 95°C for 5 minutes, and capillary electrophoresis was performed on an ABI3730XL DNA analyzer. Raw data were collected using Data Collection software. Data Collection V1.0 software, which comes with the ABI3730XL DNA analyzer, was used to generate FSA files. Genotyping analysis was performed on the FSA files using the SSR Analyser V1.2.4 fingerprint analyzer.

[0042] Example 1 Screening of waxy gene loci and design of waxy marker primers The present invention selects 4 core waxy gene detection sites from more than 50 known waxy genes in corn. wx -D7, wx -D10, wx -124 and wx -hAT, the mutation types and information of the above four corn core waxy genes are detailed in Figure 1 A, targeting the core waxy gene detection site wx -D7, wx -D10, wx -124 and wx -hAT characteristics to design primers.

[0043] wx -D7 with wx -D10 are small fragments missing, wx -D7 as an example ( Figure 1 In B), Primer 1 and Primer 2 can be paired with Primer 3 for PCR reaction; wx -D10 variant sequence and flanking sequence have repeating units, so the present invention is directed to wx -D10 performed reverse primer design; wx-124, wx -hAT waxy gene is a large insertion mutation, so 4 primers were designed for detection. Figure 1 The B is given wx -124 primer design schematic diagram, wx -hAT primer design ideas and wx -124 is similar.

[0044] The KASP platform detection primers added FAM (5'-GAAGGTGACCAAGTTCATGCT-3') and HEX (5'-GAAGGTCGGAGTCAACGGATT-3') linker sequences at the 5' end of the specific primers. -1 , downstream primer 30 µmol L -1 The four primers were based on the upstream primer 6 μmol L -1 , downstream primer 15 µmol L -1 Mix and prepare KASP primer working solution for use. Capillary electrophoresis specificity detection wx -D7, wx -D10, wx -124, wx -hAT gene primer sequence 5' end to add FAM fluorescent reporter group, primers according to the upstream and downstream 40 μmol L -1 Mix and prepare fluorescent capillary electrophoresis primer working solution for later use.

[0045] Example 2 Specific verification of waxy gene functional markers based on KASP and fluorescence capillary electrophoresis platform The present invention screened the designed waxy primers and used the KASP platform to screen the waxy genes carrying the glutinous rice to verify the specificity of the designed functional markers of different waxy gene variant types on different molecular detection platforms. wx -D7, wx -D10, wx -124, wx The standard sample of the hAT waxy gene and two common corn materials were used for identification, and three replicates were set. Figure 2 As shown in A, carry wx -D7, wx -D10, wx -124, wx -hAT waxy gene samples should detect significant FAM fluorescence, non-waxy gene samples should detect significant HEX fluorescence, and the blank control should have no obvious fluorescence amplification signal. The final selected primer information is shown in Table 1. wx -D7, wx -D10, wx-124, wx The typing results of the standard samples of -hAT were consistent with expectations, indicating that the four functional marker primers can identify the four types of waxy gene variations on the KASP platform.

[0046] Four pairs of fluorescently modified waxy detection primers were used to perform single-plex PCR amplification on standard samples carrying corresponding waxy gene mutations, and electrophoresis was performed using a fluorescent capillary electrophoresis platform. The target gene amplification fragments of the four pairs of primers were clear ( Figure 2 The product size was consistent with the expected value (Table 1), and no nonspecific amplification peaks were found in other detection areas. wx -D7, wx -D10, wx -124, wx -hAT and other four functional marker primers are suitable for fluorescence capillary electrophoresis platform. The above results show that the four waxy gene functional markers developed have high specificity on different molecular detection platforms and can distinguish different [[ID=1 Type of genetic variation.

[0047] Example 3 Verification of waxy gene functional markers using expanded samples The present invention selected 34 common corns, 211 waxy corn materials, 1 sweet-waxy double recessive homozygous material, 58 sweet corn materials and 3 sweet-waxy corn materials from the currently promoted and used corn germplasm materials, and used them to verify the applicability of the developed waxy functional gene in different types of corn germplasm. ​ -D7, ​ -D10, ​ -124, ​ -hAT functional markers were used to identify waxy variant types. KASP typing results ( ​ ) showed that the genotyping results of different types of corn were consistent with the four known carriers ​ The genotyping results of corn with genetic variant types were consistent with those of ​ -D7, ​ -D10, ​ -124, ​ -hAT waxy corn germplasm was concentrated on FAM fluorescence, while other waxy corn and non-waxy corn were concentrated on HEX fluorescence. According to the KASP typing results of the four waxy gene markers (Table 2), 29 of the 34 common corn materials did not detect waxy variant genes, and the genotype detection results of the five hybrids were Wx / D7 ( ​ Middle B ​ -D7). No waxy variant gene was detected in 58 sweet corn samples, but was detected in 3 sweet and waxy corn hybrids. ​The wx-D7 waxy variant gene was detected in one sweet and waxy double recessive homozygous material. Different waxy variant genes were detected in all 211 waxy corn samples, of which 8 waxy corn hybrids had the genotype D7 / D10.

[0048] In addition, using ​ -D7 and ​ -D10 associated functional markers were used to genotype two groups of waxy corn triplet germplasms. The results showed that Jingkenuo 2000 and its two parents Jingnuo 6 and BN2 were all mutant types. ​ -D7. The waxy genotype of Jingkenuo 623 is D7 / D10, and its female parent Jingnuo 2 carries ​ -D10 waxy mutation gene, carried by the male parent D6644-2 ​ -D7 waxy mutant gene ( ​ B and Table 3).

[0049] The results showed that the waxy gene functional marker combination developed in the present invention has high universality in corn and can effectively identify the waxy gene types in different types of corn.

[0050] The relationship among haplotype, genotype and phenotype of waxy gene is shown in Table 4. Waxy corn is affected by recessive waxy gene ( ​ ) gene controls an endosperm mutation type, and the recessive waxy gene contains multiple alleles such as ​ -D7, ​ -D10, ​ -124, ​ -hAT, these alleles form five haplotypes wD7WD10W124WhAT (D7), WD7wD10W124WhAT (D10), WD7WD10w124WhAT (124), WD7WD10W124whAT (hAT) and WD7WD10W124WhAT (mut), which are dominant ​ The genetic haplotype was WD7WD10W124WhAT(Wx) (Table 4).

[0051] When the sample to be tested is a corn inbred line, if one pair of waxy primers in the waxy functional marker primers specifically amplifies a mutant sequence and the other three pairs of primers amplify non-variant sequence products, it means that one of the recessive homozygous haplotypes exists, and the corresponding waxy mutation is detected in the sample, and the sample is a waxy material; if all four pairs of primers in the functional marker primers amplify non-variant sequence products, the result is that the sample has not detected a waxy mutation or has a rare waxy mutation.

[0052] When the sample to be tested is a corn hybrid, there may be four situations, including recessive homozygous genotype, recessive allelic glutinous heterozygous genotype, glutinous / non-glutinous heterozygous genotype and dominant homozygous genotype. The specific judgment scheme is as follows: (1) When only one glutinous variant haplotype is detected (that is, the mutant sequence is detected), the result is that the sample is detected with the corresponding glutinous mutation, and the sample is a glutinous material; (2) When two glutinous variant haplotypes are detected at the same time, the result is that the sample is detected with the corresponding two glutinous mutations, and the sample is a glutinous material; (3) When the same glutinous variant and non-variant haplotype are detected at the same time, the result is that the sample is detected with the corresponding glutinous mutation and glutinous wild-type gene, and the sample appears to be a non-glutinous material; (4) When the above four glutinous variant haplotypes are not detected, it indicates that the sample is not detected with the glutinous mutation, and the sample is non-glutinous or has a rare glutinous mutation.

[0053] Table 2 Statistics of waxy genotypes in 307 maize germplasms

[0054] Table 3 Identification of waxy genotypes of triplet maize germplasm

[0055] Example 4 Genetic Improvement of Waxy Genes The present invention statistically analyzed the waxy mutation types of 307 corn germplasms collected. The results showed that ​ -D7, ​ -D10, ​ -124 and ​ -hAT and other four waxy gene mutations are commonly found in waxy corn. In non-waxy corn, waxy mutation genes are rarely identified, and only heterozygous waxy mutation genes exist (Table 5). Currently, more than 80% of waxy corn waxy mutation genotypes are D7 / D7 (86.73%, 183 / 211). The proportions of the other three waxy gene mutation types are as follows: ​ -hAT, ​ -D10, ​ -124 (Table 5), indicating ​ -D7 is the main type used in waxy corn breeding. The present invention also identified eight corn germplasms with the genotype D7 / D10, all of which are waxy corn hybrids. No heterozygosity for waxy allele variation was observed in the waxy corn inbred lines, indicating that genetic improvement can be achieved by aggregating different types of waxy variation in waxy corn hybrid breeding.

[0056] Table 5 Proportion of waxy gene types in waxy corn

[0057] Comparative Example 1 The present invention designed multiple pairs of KASP primers during the research process, for example: Based on the same detection method as Example 2, the following ​ and ​ The experimental results showed that under the D7-1 primer amplification, the sample typing results were inconsistent with expectations, and the NTC of D7-2 was significantly offset. D10-1 and D10-2 could not be correctly typed and had NTC offsets.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A KASP primer combination, characterized in that: The KASP primer combination includes any one or more of the following KASP primer pairs: i) wx -D7-F1:5'-ATCTACAGGGACGCCGT-3', wx -D7-F2:5'-CTCTGAACTGAACAACGC-3', wx -D7-R:5'-GACGAGGTATACGAGCATGGA-3'; ii)wx-D10-F1:5'-GCCTGCAGCGCCTT-3', <h2 style=";text-align:left;direction:ltr"> wx <h2 style=";text-align:left;direction:ltr"> -D10-F2:5'-GCCTGCAGCGCCTC-3', wx -D10-R:5'-GGTGTCCGGTTCAGGC-3'; iii) wx-124-F1: 5'-TGCTTCTTGAGGTAGCACGAGG-3', wx -124-F2:5'-GTTGCTCTTGAGGTAGCACGAGA-3', wx -124-R1:5'-CCATCGACAAATTCAGAGGATCCCAA-3', wx -124-R2:5'-GAGGACGTCGTGTTCGTCTGCAA-3'; iv) wx-hAT-F1:5'-GTCCCAGGCGTCCTTGTACTC-3', wx -hAT-F2:5'-GTCCCAGGCGTCCTTGTACTG-3', wx -hAT-R1:5'-AGCTCGGCATACTCTAACTTAAAATCCTA-3', wx -hAT-R2:5'-TCATGGTCGTCTCTCCCCGCTA-3'。 2. A kit, characterized in that The kit includes a method for detecting waxy gene sites wx- D7, wx- D10, wx- 124. wx- Detection primers for hAT.

3. The kit according to claim 2, wherein The kit comprises the KASP primer combination according to claim 1.

4. The kit according to claim 3, wherein The platforms applicable to the kit include: one or more of a capillary electrophoresis platform, a KASP platform, a fluorescence quantitative platform, a chip platform or a sequencing platform.

5. Use of the KASP primer combination according to claim 1 or the kit according to any one of claims 2 to 4 in detecting waxy genes in maize.

6. Use of the KASP primer combination according to claim 1 or the kit according to any one of claims 2 to 4 in any of the following: (1) Identification of the waxy type of corn; (2) Screening, improvement or identification of waxy corn varieties; (3) Waxy gene tracking markers in corn; (4) Identification and management of corn germplasm resources.

7. The use according to claim 6, characterized in that The corn to be tested is detected using the KASP primer combination according to claim 1 or the kit according to any one of claims 2 to 4, and the waxy genotype of the corn to be tested is determined according to the detection results.

8. The use according to claim 7, characterized in that Also includes: The waxy type of the corn to be tested is determined according to the waxy genotype of the corn to be tested.

9. The use according to claim 8, characterized in that When the corn to be tested is a corn inbred line, if a mutant sequence is detected at any one of wx-D7, wx-D10, wx-124 and wx-hAT sites, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detected site, and the waxy phenotype is waxy; if no mutant sequence is detected at wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be non-waxy or to contain a rare mutation.

10. The use according to claim 8, characterized in that When the corn to be tested is a corn hybrid, if a mutation sequence is detected at any one of wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detection site, and the waxy phenotype is waxy; if a mutation sequence is detected at any two of wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be a waxy mutant genotype corresponding to the detection site, and the waxy phenotype is waxy. The phenotype is glutinous; if a mutant sequence is detected at any one of wx-D7, wx-D10, wx-124 and wx-hAT, and a non-mutated sequence is also detected, the genotype of the corn to be tested is judged to be a waxy mutation corresponding to the detected site and a wild genotype, and the waxy phenotype is non-glutinous; if no mutant sequence is detected in wx-D7, wx-D10, wx-124 and wx-hAT, the corn to be tested is judged to be non-glutinous or to contain a rare mutation.