Glyphosate and glufosinate herbicide resistant corn transformation event LE4 and detection method thereof
By serially integrating glufosinate and glyphosate herbicide resistance gene expression cassettes into transgenic corn, the problem of single resistance of transgenic crops to herbicides was solved, and dual resistance to glyphosate and glufosinate was achieved, which simplified field management, delayed the evolution of pest resistance, and improved economic benefits.
Patent Information
- Application Number
- CN202510805571.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-05-09
- Filing Date
- 2025-06-17
- Publication Date
- 2025-09-19
AI Technical Summary
The single resistance of existing genetically modified crops to glyphosate and glufosinate herbicides has led to the accelerated evolution of weed resistance in the field. Traditional refuge strategies are complex and costly to operate, making it difficult to effectively delay the evolution of pest resistance.
By serially integrating glufosinate-ammonium and glyphosate-resistant gene expression cassettes into transgenic corn, high-efficiency tolerance to both herbicides is achieved. The presence of transformation event LE4 is identified through specific nucleic acid molecule detection methods, simplifying field operation procedures and enhancing weed control capabilities.
The genetically modified corn has achieved dual resistance to glyphosate and glufosinate herbicides, which has simplified the field management process, reduced labor and pesticide costs, delayed the evolution of pest resistance, and improved farmers' compliance and economic benefits.
Smart Images

Figure CN120666077A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant biotechnology. Specifically, it relates to a nucleic acid molecule, detection method, and application of a glyphosate- and glufosinate-resistant corn transformation event LE4, and more particularly to a transgenic corn event LE4 that tolerates the application of glyphosate and glufosinate-resistant herbicides, and a nucleic acid molecule and detection method for detecting whether a biological sample contains a specific transgenic corn event LE4. Background Art
[0002] Corn is the most widely cultivated crop in my country. Field weeds compete with corn plants for water, fertilizer, light, and growing space, directly impacting crop yield and quality. Furthermore, many weeds serve as intermediate hosts for crop pathogens and pests, making them a key biological limiting factor in crop yield. According to the Food and Agriculture Organization of the United Nations, global food production losses due to weeds amount to $95 billion annually, equivalent to a loss of 380 million tons of wheat, or more than half of the global wheat production in 2009. Therefore, effective weed control is a crucial measure to increase grain production. The widespread use of herbicides can significantly reduce the number of workers required for field management and reduce labor intensity. However, developing new, highly effective, low-toxic, and residue-free herbicides is costly, time-consuming, and challenging.
[0003] With the widespread cultivation of genetically modified herbicide-resistant crops, broad-spectrum herbicides such as glyphosate and glufosinate have become core tools for weed control in modern agriculture. However, the long-term use of single-resistant crops has led to the accelerated evolution of weed resistance in the field, seriously threatening herbicide efficacy and crop yields. In addition, to delay the development of resistance in target pests to genetically modified insect-resistant crops, the internationally accepted "refuge" strategy requires the planting of non-insect-resistant crops in a certain proportion of farmland. However, traditional refuges face management challenges because they cannot tolerate herbicides: farmers need to additionally distinguish between planting areas and adopt differentiated weed control plans, which leads to complex operations, increased costs, and even a reduction in the implementation rate of refuges due to human negligence, weakening the effectiveness of resistance management.
[0004] The present invention is directed to the above-mentioned problems, and the glufosinate-resistant herbicide gene expression cassette is connected in series with the glyphosate-resistant herbicide gene expression cassette, so that it is efficiently expressed in transgenic corn, not only having two herbicide resistance traits, but also can be used as a supporting shelter material for transgenic insect-resistant crops, so that the shelter corn and the main insect-resistant corn can tolerate the spraying of the same herbicide (glufosinate or glyphosate) in the same plot, realizing the coordinated management of weed control and shelter function, further enhancing the application and economic value of the product. This move of the strain not only simplifies the field operation process, reduces labor and drug costs, but also significantly enhances the enthusiasm of farmers to adopt compliant shelters, thereby effectively delaying the evolution of pest resistance and extending the commercial life cycle of insect-resistant transgenic technology. At the same time, the dual-resistance characteristics give crops stronger weed competition protection, reduce the risk of excessive use of herbicides, meet the needs of sustainable agriculture and ecological safety, and have significant economic and social benefits.
[0005] The expression of exogenous genes in plants is known to be influenced by their chromosomal location, potentially due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. Therefore, screening a large number of events is often required to identify those suitable for commercialization (i.e., those that achieve optimal expression of the introduced target gene). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary significantly between events. Spatial or temporal expression patterns can also vary, such as the relative expression of the transgene between different plant tissues. This variability manifests itself in actual expression patterns that may differ from those expected based on the transcriptional regulatory elements in the introduced gene construct, leading to variability in the trait expression of the transformation event. Consequently, it is often necessary to generate hundreds or even thousands of different events and screen these events to identify a single event that exhibits the desired transgene expression level and pattern for commercialization. Events with the desired transgene expression level and pattern can then be used to introgress the transgene into other genetic backgrounds through sexual outcrossing using conventional breeding methods. Progeny produced by such crosses retain the transgene expression characteristics of the original transformation event. Applying this strategy ensures reliable gene expression in a wide range of varieties that are well adapted to local growing conditions. Therefore, more transformation events need to be characterized and screened for traits to identify superior transformation events with comprehensive trait performance and commercial potential.
[0006] It will be useful to be able to detect the presence of a specific event to determine whether the offspring of sexual hybridization comprises the target gene. In addition, the method for detecting a specific event will also help to comply with relevant laws and regulations, such as the need to obtain formal approval and labeling of food derived from recombinant crops before being put on the market. It is all possible to detect the presence of transgenic by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR). These detection methods usually focus on conventional genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the transgenic DNA inserted is known, this method just cannot be used to distinguish different events, particularly those events produced with the same DNA construct. Therefore, a pair of primers that have crossed the junction of the transgenic and flanking DNA inserted is often utilized to identify the transgenic specific event by PCR, specifically a first primer comprising flanking sequences and a second primer comprising the inserted sequence. Summary of the Invention
[0007] The present invention aims to provide a maize transformation event resistant to glyphosate and glufosinate, as well as a nucleic acid molecule for detecting LE4 and a detection method thereof. The transgenic maize event LE4 exhibits good tolerance to glyphosate and glufosinate herbicides, and the detection method can accurately and rapidly identify whether a biological sample contains a nucleic acid molecule specific to the transgenic maize event LE4.
[0008] To achieve the above objectives, the present invention used the pCAMBIA3300+CPB-EPSPS expression vector to transform maize strain Zheng 58 via Agrobacterium-mediated transformation, resulting in a number of positive transformation events. Herbicide tolerance identification revealed that transformation event LE4 exhibited excellent tolerance to glyphosate and glufosinate herbicides, potentially enabling improved herbicide tolerance in maize.
[0009] In order to characterize the identity characteristics of LE4, the present invention provides a nucleic acid molecule, the nucleic acid molecule sequence of which is the sequence shown in SEQ ID NO.1 and / or SEQ ID NO.2 and / or SEQ ID NO.13, or the reverse complementary sequence thereof.
[0010] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO.3 and / or SEQ ID NO.4, or the reverse complementary sequence thereof.
[0011] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO.6 and / or SEQ ID NO.7 and / or SEQ ID NO.14, or the reverse complementary sequence thereof.
[0012] Furthermore, the nucleic acid molecule sequence is the sequence shown in SEQ ID NO.5 or its reverse complementary sequence.
[0013] The nucleic acid molecule is derived from a plant, seed or cell of the corn transformation event LE4. The seeds of the corn transformation event LE4 have been deposited with the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University Collection Center, Postal Code 430072) under the deposit number CCTCC NO: P202508. The deposit date is April 10, 2025.
[0014] The present invention also provides a probe for detecting maize transformation event LE4, characterized in that the sequence of the probe includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.6 or SEQ ID NO.7 or SEQ ID NO.13 or SEQ ID NO.14 or its reverse complementary sequence.
[0015] The present invention also provides a primer pair for detecting maize transformation event LE4, characterized in that the sequence of the amplified product of the primer pair comprises the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.6 or SEQ ID NO.7 or SEQ ID NO.13 or SEQ ID NO.14 or its reverse complementary sequence.
[0016] In some embodiments, the sequences of the primer pair are shown as SEQ ID NO.8 and SEQ ID NO.9; or as SEQ ID NO.10 and SEQ ID NO.11; or as SEQ ID NO.12 and SEQ ID NO.9.
[0017] The present invention also provides a kit or microarray for detecting maize transformation event LE4, characterized in that it comprises the above-mentioned probe and / or primer pair.
[0018] The present invention also provides a method for detecting maize transformation event LE4, characterized in that it comprises using the above-mentioned probe or the above-mentioned primer pair or the above-mentioned probe and primer pair or the above-mentioned kit or microarray to detect whether the transformation event exists in a test sample.
[0019] The present invention also provides a method for breeding corn, characterized in that the method comprises the following steps:
[0020] 1) obtaining corn containing the nucleic acid molecule;
[0021] 2) subjecting the corn obtained in step 1) to pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, selfing or hybridization, or a combination thereof, to obtain corn plants, seeds, plant cells, offspring plants, or plant parts; and optionally,
[0022] 3) The offspring plants obtained in step 2) are subjected to glyphosate and glufosinate herbicide resistance identification, and the above-mentioned method is used to detect whether the transformation event occurs therein.
[0023] Furthermore, the present invention also provides products made from corn plants, seeds, plant cells, progeny plants or plant parts obtained by the above method, including food, feed or industrial raw materials.
[0024] The SEQ ID NO. 13 is a 22-nucleotide sequence located near the insertion junction site at the 5' end of the insertion sequence on Chr1 of the maize genome in the transgenic maize event LE4. The SEQ ID NO. 13 spans the genomic DNA sequence on the left flank of the maize insertion site and the DNA sequence at the 5' end of the left border of the insertion sequence. The presence of the transgenic maize event LE4 can be identified by containing the SEQ ID NO. 13 or its reverse complementary sequence.
[0025] The SEQ ID NO.1 is a 22-nucleotide sequence located near the insertion junction site at the 5' end of the insertion sequence on Chr2 of the maize genome in the transgenic maize event LE4. The SEQ ID NO.1 spans the genomic DNA sequence on the left flank of the maize insertion site and the DNA sequence at the 5' end of the left border of the insertion sequence. The presence of the transgenic maize event LE4 can be identified by containing the SEQ ID NO.1 or its reverse complementary sequence.
[0026] The SEQ ID NO.2 is a 22-nucleotide sequence located near the insertion junction site at the 3' end of the insertion sequence on Chr2 of the maize genome in the transgenic maize event LE4. The SEQ ID NO.2 spans the DNA sequence at the 3' end of the right border of the insertion sequence and the right flank genomic DNA sequence of the maize insertion site. The presence of the transgenic maize event LE4 can be identified by containing the SEQ ID NO.2 or its reverse complementary sequence.
[0027] In the present invention, the nucleic acid sequence can be at least 11 or more consecutive polynucleotides of any part of the transgenic insertion sequence in SEQ ID NO.14 or its reverse complementary sequence (first nucleic acid sequence), or at least 11 or more consecutive polynucleotides of any part of the 5' left flank corn genomic DNA region in SEQ ID NO.14 or its reverse complementary sequence (second nucleic acid sequence). The nucleic acid sequence can further be homologous to or reverse complementary to a portion of SEQ ID NO.14 that includes the entire SEQ ID NO.13. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO.13 or SEQ ID NO.14 or its reverse complementary sequence, the presence of transgenic corn event LE4 or its progeny can be diagnosed.
[0028] SEQ ID NO. 14 is a 542-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in transgenic maize event LE4. SEQ ID NO. 14 consists of a 289-nucleotide maize left flank genomic DNA sequence (nucleotides 1-289 of SEQ ID NO. 14), a 95-nucleotide pCAMBIA3300+CPB-EPSPS construct left border DNA sequence (nucleotides 290-384 of SEQ ID NO. 14), and a 158-nucleotide 5'-end DNA sequence of the first expression cassette of the glufosinate-tolerance gene (nucleotides 385-542 of SEQ ID NO. 3). The presence of SEQ ID NO. 14 or its reverse complement sequence can be used to identify the presence of transgenic maize event LE4.
[0029] The nucleic acid sequence can be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any part of the transgenic insertion sequence in the SEQ ID NO.3 or its reverse complementary sequence, or at least 11 or more consecutive polynucleotides (fourth nucleic acid sequence) of any part of the 5' left flank corn genomic DNA region in the SEQ ID NO.3 or its reverse complementary sequence. The nucleic acid sequence can further be homologous to or reverse complementary to a portion of the SEQ ID NO.3 comprising the complete SEQ ID NO.1 or SEQ ID NO.6. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for producing an amplified product. When the amplified product produced in the DNA amplification method using the DNA primer pair is an amplified product including SEQ ID NO.1 or SEQ ID NO.3 or SEQ ID NO.6 or its reverse complementary sequence, the presence of transgenic corn event LE4 or its progeny can be diagnosed.
[0030] SEQ ID NO. 3 is a 1624-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in transgenic maize event LE4. SEQ ID NO. 3 consists of a 666-nucleotide maize left flank genomic DNA sequence (nucleotides 1-666 of SEQ ID NO. 3), a 216-nucleotide pCAMBIA3300+CPB-EPSPS construct left border DNA sequence (nucleotides 667-882 of SEQ ID NO. 3), and a 742-nucleotide 5'-end DNA sequence of the first expression cassette of the glufosinate-tolerance gene (nucleotides 883-1624 of SEQ ID NO. 3). The presence of SEQ ID NO. 3 or its reverse complementary sequence can be used to identify the presence of transgenic maize event LE4.
[0031] The nucleic acid sequence can be at least 11 or more consecutive polynucleotides (fifth nucleic acid sequence) of any part of the transgenic insertion sequence in SEQ ID NO.4 or its reverse complementary sequence, or at least 11 or more consecutive polynucleotides (sixth nucleic acid sequence) of any part of the 3' right flank corn genomic DNA region in SEQ ID NO.4 or its reverse complementary sequence. The nucleic acid sequence can further be homologous to or reverse complementary to a portion of SEQ ID NO.4 that includes the complete SEQ ID NO.2 or SEQ ID NO.7. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer set in a DNA amplification method for producing an amplified product. When the amplified product produced in the DNA amplification method using the DNA primer pair is an amplified product comprising SEQ ID NO.2 or SEQ ID NO.4 or SEQ ID NO.7 or its reverse complementary sequence, the presence of transgenic corn event LE4 or its progeny can be diagnosed.
[0032] SEQ ID NO. 4 is a 1589-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in transgenic maize event LE4. SEQ ID NO. 4 consists of a 232-nucleotide 3'-terminal DNA sequence of the second expression cassette of the glyphosate-tolerance gene (nucleotides 1-232 of SEQ ID NO. 4), a 730-nucleotide pCAMBIA3300+CPB-EPSPS construct right border DNA sequence (nucleotides 233-962 of SEQ ID NO. 4), and a 627-nucleotide genomic DNA sequence of the right flank of the maize integration site (nucleotides 963-1589 of SEQ ID NO. 4). The presence of SEQ ID NO. 4 or its reverse complement sequence can be used to identify the presence of transgenic maize event LE4.
[0033] The SEQ ID NO. 5 is a 6243-nucleotide sequence inserted into Chr2 of the maize genome that can characterize the transgenic maize event LE4. The presence of the SEQ ID NO. 5 or its reverse complementary sequence can be used to identify the presence of the transgenic maize event LE4.
[0034] The present invention also provides a method for protecting corn plants from damage caused by herbicides, characterized in that transgenic corn plants comprising corn event LE4 are planted and an effective dose of glufosinate herbicide and / or glyphosate herbicide is applied, wherein the seeds of the corn event LE4 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202508.
[0035] The present invention also provides a method for controlling weeds in a field of corn plants, characterized in that it includes applying an effective dose of glufosinate herbicide and / or glyphosate herbicide to a field planted with transgenic corn plants comprising corn event LE4, wherein the seeds of the corn event LE4 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202508.
[0036] In the present invention for detecting nucleic acid molecules and detection methods of corn plants, the following definitions and methods can better define the present invention and guide ordinary technicians in this field to implement the present invention. Unless otherwise specified, the terms are understood according to the conventional usage of ordinary technicians in this field.
[0037] The term "corn" refers to maize (Zea mays) and includes all plant varieties that can be crossed with maize, including wild maize species.
[0038] The term "including" means "including but not limited to".
[0039] A transgenic "event" is obtained by transforming plant cells with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, transgenically inserted into the plant genome to produce a plant population, regenerate the plant population, and select for specific plants characterized by the insertion at a specific genomic locus. The term "event" refers to the original transformation event that includes the heterologous DNA and the progeny of that transformation event. The term "event" also refers to progeny resulting from sexual crosses between a transformation event and individuals of another variety containing heterologous DNA, where the inserted DNA and flanking genomic DNA from the parent of the transformation event are present at the same chromosomal location in the progeny of the hybrid, even after repeated backcrossing with the recurrent parent. The term "event" also refers to a DNA sequence from the original transformation event, comprising the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which is expected to be transferred to progeny produced by sexually crossing a parental line containing the inserted DNA (e.g., the original transformation event and progeny resulting from selfing thereof) with a parental line that does not contain the inserted DNA, and which progeny receive the inserted DNA containing the gene of interest.
[0040] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can produce offspring plants that are homozygous for both added exogenous genes. Backcrossing of the parent plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual propagation.
[0041] Transgenic corn event LE4 can be combined with other transgenic corn varieties, such as corn with tolerance to herbicides (such as dicamba, quizalofop-p-ethyl, etc.), or transgenic corn varieties carrying insect-resistant genes. Various combinations of all these different transgenic events, bred together with the transgenic corn event LE4 of the present invention, can provide improved hybrid transgenic corn varieties that are insect-resistant and resistant to multiple herbicides. These varieties can show more excellent characteristics such as insect resistance and multiple herbicide resistance compared to non-transgenic varieties and single-trait transgenic varieties.
[0042] The present invention provides a nucleic acid molecule and a detection method for detecting corn plants. Transgenic corn event LE4 exhibits tolerance to glyphosate and glufosinate herbicides. Corn plants expressing this trait express 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and phosphinothricin acetyltransferase (PAT) proteins, which confer tolerance to glyphosate and glufosinate. Furthermore, nucleic acid molecules having sequences such as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 13, and SEQ ID NO. 14, or their reverse complements, in the detection method of the present invention can be used as DNA primers or probes to generate amplification products that are diagnostic of transgenic corn event LE4 or its progeny. This allows for rapid, accurate, and stable identification of the presence of plant material derived from transgenic corn event LE4.
[0043] The transgenic maize event LE4 exhibits strong tolerance to glyphosate and glufosinate. These characteristics make the LE4 transformation event potentially useful for improving maize tolerance to glyphosate and glufosinate herbicides, thereby enabling the development of new maize varieties tolerant to multiple herbicides.
[0044] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 Physical map of the recombinant expression vector pCAMBIA3300+CPB-EPSPS. The English names and abbreviations of the components are listed below:
[0046] LB: the left border sequence of the T-DNA of Agrobacterium.
[0047] CaMVpoly(A) 35S terminator of cauliflower mosaic virus (CaMV).
[0048] bar encodes the PAT protein, which relieves the toxicity of glufosinate ammonium.
[0049] CaMV35S promoter (enhanced) 35S promoter of cauliflower mosaic virus, which initiates the transcription of the target gene
[0050] NOSterminator The terminator of the nopaline synthase gene.
[0051] EPSPS EPSPS Protein-coding genes.
[0052] CTP transport peptide protein encoding gene.
[0053] CaMV35S promoter 35S promoter of cauliflower mosaic virus (CaMV).
[0054] RB is the right border sequence of the T-DNA of Agrobacterium.
[0055] pVS1 staA Plasmid stabilization site of the pVS1 plasmid.
[0056] pVS1 RepA The replication origin of the pVS1 plasmid.
[0057] bom The bom site of the pBR322 plasmid.
[0058] ori origin of replication of the pBR322 plasmid.
[0059] kanR encodes an aminoglycoside phosphotransferase protein that confers kanamycin resistance to bacteria.
[0060] Figure 2 Alignment of the chimeric sequence at the insertion site of transformation event LE4 with the maize reference genome.
[0061] A: Insertion position 1LB end;
[0062] B: insertion position 2LB end;
[0063] C: Insertion position 2RB end.
[0064] Figure 3 Diagram of the genome structure near the T-DNA insertion site (arrows indicate the specific insertion site).
[0065] A: insertion position 1 (Chr1: 77591693 bp);
[0066] B: insertion position 2 (Chr2: 189203297 bp);
[0067] C: Insertion position 2 (Chr2: 189192328 bp).
[0068] Figure 4LE4 transformation event-specific PCR validation results.
[0069] M: molecular weight standard, from top to bottom: 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, 100bp;
[0070] 1: transformation event LE4, expected band size 542 bp;
[0071] 2: receptor control;
[0072] 3: transformation event LE4, expected band size 700 bp;
[0073] 4: receptor control;
[0074] 5: receptor control;
[0075] 6: Transformation event LE4, expected band size 586 bp.
[0076] Figure 5 PCR detection results of the full-length insert sequence at position 2 in transformation event LE4.
[0077] M: molecular weight standard, from top to bottom: 5kb, 3kb, 2kb, 1kb, 750bp, 500bp, 250bp, 100bp;
[0078] 1: Transformation event LE4, expected band size 5556 bp.
[0079] Figure 6 Southern blot hybridization diagram of the inserted copy number of the target gene EPSPS.
[0080] A: HindⅢ and EcoRI enzyme digestion hybridization map; B: Schematic diagram of the T-DNA region enzyme digestion site and probe position. The numbers represent the size of the band after enzyme digestion, in kb. The position of the probe used is marked with a line segment at the bottom.
[0081] N: blank control;
[0082] M: DNA Marker, the band size is marked next to it, unit bp;
[0083] 1: HindIII digestion of transformation event LE4 genomic DNA;
[0084] 2: Digest genomic DNA from other transformation events with the same vector with HindIII;
[0085] 3: HindIII-digested receptor control Zheng 58 genomic DNA;
[0086] 4: HindIII digestion of pCAMBIA3300-CPB-EPSPS positive plasmid;
[0087] 5: EcoRI digestion of pCAMBIA3300-CPB-EPSPS positive plasmid;
[0088] 6: EcoRI digestion of receptor control Zheng 58 genomic DNA;
[0089] 7: EcoRI digestion of genomic DNA from other transformation events with the same vector;
[0090] 8: EcoRI digestion of transformation event LE4 genomic DNA.
[0091] Figure 7 Southern blot hybridization diagram of the insertion copy number of the target gene bar.
[0092] A: HindⅢ and EcoRI enzyme digestion hybridization map; B: Schematic diagram of the T-DNA region enzyme digestion site and probe position. The numbers represent the size of the band after enzyme digestion, in kb. The position of the probe used is marked with a line segment at the bottom.
[0093] N: blank control;
[0094] M: DNA Marker, the band size is marked next to it, unit bp;
[0095] 1: HindIII digestion of pCAMBIA3300-CPB-EPSPS positive plasmid;
[0096] 2: HindIII digestion of genomic DNA from the LE4 transformation event;
[0097] 3: Digestion of genomic DNA from other transformation events with HindIII;
[0098] 4: HindIII-digested receptor control Zheng 58 genomic DNA;
[0099] 5: EcoRI digestion of pCAMBIA3300-CPB-EPSPS positive plasmid;
[0100] 6: EcoRI digestion of genomic DNA from LE4 transformation event;
[0101] 7: EcoRI digestion of genomic DNA from other transformation events;
[0102] 8: EcoRI digestion of receptor control Zheng 58 genomic DNA.
[0103] Figure 8 Schematic diagram of the insertion sequence structure of transformation event LE4. DETAILED DESCRIPTION
[0104] The transformation event LE4 involved in this application refers to a corn plant that has a foreign gene insert (T-DNA insert) inserted between specific genomic sequences after genetic transformation using corn Zheng 58 as the recipient. In a specific embodiment, the expression vector used for transgenic Figure 1 The physical map shown shows that the resulting transformation event, in which the exogenous sequence is inserted into the maize genome Chr1 and Chr2, is a double-copy insertion transformation event. Transformation event LE4 can refer to this transgenic process, or to the T-DNA insert within the genome resulting from this process, or to the combination of the T-DNA insert and flanking sequences, or to the maize plant resulting from this transgenic process. In specific examples, this event is also applicable to plants obtained by transforming other recipient varieties with the same expression vector, thereby inserting the T-DNA insert into the same genomic location. Transformation event LE4 can also refer to offspring plants obtained by asexual reproduction, sexual reproduction, doubling, or a combination of the above from the aforementioned plants.
[0105] Example 1 Acquisition of transformation events and character identification
[0106] The EPSPS gene (5-enolpyruvylshikimate-3-phosphate synthase) encodes 5-enolpyruvylshikimate-3-phosphate synthase, which can significantly enhance the plant's tolerance to glyphosate herbicides; the bar gene (phosphinothricin acetyltransferase) encodes phosphinothricin acetyltransferase, which can improve the plant's tolerance to glufosinate herbicides. The present invention uses the pCAMBIA3300+CPB-EPSPS expression vector (see the vector physical map for details). Figure 1 , containing both the EPSPS and bar gene expression cassettes, was transformed into the recipient strain Zheng 58 via Agrobacterium tumefaciens EHA105-mediated genetic transformation, resulting in 562 positive transformation events. A large number of T3 transgenic maize seeds were obtained through three generations of self-pollination. These transformation events were systematically evaluated for their dual herbicide tolerance to glyphosate / glufosinate and related agronomic traits.
[0107] 1. Screening for transformation events with excellent glyphosate- and glufosinate-resistant traits
[0108] (1) Glyphosate herbicide tolerance screening
[0109] Using Zheng 58 as a control, we screened for transformation events with high glyphosate tolerance by spraying the field with glyphosate at a concentration four times the recommended field dose (4×). The results showed that only 12 transformation events exhibited significantly higher tolerance to glyphosate than the control (Table 1).
[0110] Table 1 Tolerance to glyphosate herbicide
[0111]
[0112]
[0113] The values are the mean ± standard deviation of three biological replicates. Statistical analysis was performed using LSD for multiple comparisons (α = 0.05). Different letters indicate significant differences between the data in the same column at the same herbicide concentration.
[0114] (2) Screening for tolerance to glufosinate herbicide
[0115] Using Zheng 58 as a control, 12 glyphosate-tolerant transformation events identified in the initial screening were tested for glufosinate resistance. Foliar spraying of a glufosinate solution at a concentration four times the recommended field dose (4×) was performed to screen for superior transformation events with resistance to both glyphosate and glufosinate (Table 2). The results showed that transformation events LE4, LE8, and LE15 exhibited excellent resistance to both glyphosate and glufosinate, showing no obvious signs of phytotoxicity under both glyphosate (4×) and glufosinate (4×) treatments, and their plant growth vigour was not significantly different from that of the untreated control (P>0.05). While transformation events LE1, LE3, LE5, LE6, LE10, LE11, LE12, LE13, and LE16 demonstrated stable resistance to glyphosate, they exhibited varying degrees of phytotoxicity under 4× glufosinate treatment, with phytotoxicity rates ranging from 1.67% to 14.33% (Table 2). Among them, LE1 and LE3 showed the most significant phytotoxicity (P<0.05), with leaf yellowing area exceeding 10%.
[0116] Table 2 Tolerance to glufosinate herbicide
[0117]
[0118]
[0119] The values are the mean ± standard deviation of three biological replicates. Statistical analysis was performed using LSD for multiple comparisons (α = 0.05). Different letters indicate significant differences between the data in the same column at the same herbicide concentration.
[0120] (3) Agronomic traits survey
[0121] Key agronomic traits of the superior transformation events (LE4, LE8, and LE15) with dual herbicide resistance were analyzed, including plant height, leaf area, ear traits (ear length and diameter), and grain characteristics (100-grain weight). A randomized block design was used, with wild-type Zheng 58 as the control, and 30 plants per transformation event were analyzed (Table 3). The data showed that the LE4 transformation event showed no significant differences from the control in all tested agronomic traits (P>0.05). Its plant height (mean ± SE: 175.33 ± 13.0 cm) and 100-grain weight (38.2 ± 2.3 g) were comparable to those of Zheng 58 (plant height 175.52 ± 12.7 cm, 100-grain weight 38.6 ± 2.5 g). Both the LE8 and LE15 transformation events exhibited significant dwarfing, significantly different from the control (P<0.05), and their 100-grain weight was significantly lower than the control (P<0.05).
[0122] Table 3 Survey results of some agronomic traits
[0123]
[0124] The values are the mean ± SD of three biological replicates. Statistical analysis was performed using LSD for multiple comparisons (α = 0.05). Different letters indicate significant differences between the data in the same column at the same time.
[0125] Overall, LE4 has dual resistance to glyphosate and glufosinate and has excellent agronomic phenotypes. It can be used to improve the tolerance of corn to glyphosate and glufosinate herbicides, cultivate new corn varieties with resistance to multiple herbicides, and solve the problem of cross-resistance in weed control in corn fields.
[0126] Example 2 Copy number and insertion structure analysis
[0127] In order to clarify the insertion structure of the exogenous sequence of maize LE4, the present invention analyzed the copy number of the target gene of maize LE4 and the insertion structure on the genome.
[0128] 1. Target gene copy number analysis
[0129] Southern blot hybridization is used to determine the copy number of the exogenous sequence. In Southern blot analysis, genomic DNA is digested with two restriction endonucleases that are located within the T-DNA region and not within the hybridization region. Each inserted copy in the genome will appear as a single, specific band after hybridization. After restriction endonuclease digestion, the region to be tested is used as a probe for Southern blot hybridization.
[0130] Restriction endonucleases HindIII and EcoRI were used to digest the positive control plasmid, the control Zheng 58, and the genomic DNA of the LE4 transformation event. Sequence fragments of the target genes EPSPS and bar were selected as probes. The specific sequences of the probe primers are shown in Table 4.
[0131] Table 4 Probes used in Southern hybridization experiments
[0132]
[0133] 1: Unit: bp.
[0134] Detection of the copy number of the target gene EPSPS
[0135] Restriction enzymes HindIII and EcoRI were used to digest the positive control plasmid, negative control Zheng 58 genomic DNA, and LE4 transformation event genomic DNA. After gel transfer, the EPSPS gene probe was used to label the cells. The hybridization results were as follows: Figure 6 As shown in A. The probe position of the exogenous gene EPSPS and the restriction endonuclease HindⅢ and EcoRI restriction sites are as follows Figure 6 As shown in B. The hybridization results showed that the EPSPS gene of LE4 was inserted into the maize genome as two copies.
[0136] Detection of the copy number of the target gene bar
[0137] Restriction enzymes HindIII and EcoRI were used to digest the positive control plasmid, negative control Zheng 58 genomic DNA, and LE4 transformation event genomic DNA. After gel transfer, the bar gene probe was used to label the membrane. The hybridization results were as follows: Figure 7 As shown in A. The probe position of the target gene bar and the restriction endonuclease HindⅢ and EcoRI restriction sites are as follows Figure 7 As shown in B. The hybridization results show that the bar gene of LE4 is also inserted into the maize genome in two copies.
[0138] Southern hybridization results showed that the exogenous sequence of LE4 transformation event was inserted into the maize genome in two copies.
[0139] 2. Insertion site detection
[0140] 100mg of plant leaves were rapidly ground in liquid nitrogen and total DNA was extracted using the CTAB method. Transformation event LE4 was subjected to 10× depth whole-genome resequencing, using the vector T-DNA sequence as a template for alignment analysis, successfully identifying the T-DNA insertion site. The whole-genome resequencing and data analysis methods are as follows:
[0141] After measuring the genomic DNA concentration, the total DNA amount was ensured to be >2μg. The DNA was fragmented into 200-300bp fragments using a non-contact ultrasonic disruptor. The required genomic library was constructed using the standard Illumina TruSeq Nano DNA LT library preparation protocol (Illumina TruSeq DNA Sample Preparation Guide) using the TruSeq™ DNA Sample Prep Kit. Conventional genome resequencing was performed using the Illumina NovaSeq, with each read being 150bp long, generating at least 20Gb of data and ensuring a data quality index of Q30 ≥80% (i.e., the proportion of bases with a sequencing error rate greater than 0.1% was less than 20%).
[0142] Based on the genome resequencing results, sequence homology was screened against all sequenced sequences using BWA software (BWA, http: / / bio-bwa.sourceforge.net / , default settings), using the transgenic vector T-DNA sequence as a template. The resulting exogenous sequences were all located within the T-DNA sequence, with no matches to the vector backbone, indicating that the vector backbone sequence had not been inserted into the recipient genome. The resulting sequences were further assembled and screened, removing reads containing entirely T-DNA sequences. Ultimately, three chimeric reads were obtained for transformation event LE4, characterized by half genomic sequence and half vector T-DNA sequence.
[0143] The genomic sequences in the obtained chimeric sequences (including the vector sequence and the flanking genomic sequences) were aligned with the maize reference genome (MaizeGDB database https: / / www.maizegdb.org / blast) using the BLASTN tool. Zm-B73-REFERENCE-NAM-5.0 was used as the reference sequence. The alignment results are shown in Figure 2 Analysis showed that the exogenous sequence was inserted into two positions in the maize genome, with insertion position 1 at Chr1: 77591693bp and insertion position 2 at Chr2: 189203297bp and Chr2: 189192328bp. It is speculated that the two insertions on Chr2, about 10kb apart, were caused by the insertion of a T-DNA fragment.
[0144] Using BLASTN analysis of the upstream and downstream genomes of the insertion position 1 in the MaizeGDB database, it was found that the insertion position was located in the 5'UTR region of the transcript 1 of the maize gene Zm00001eb020710 (see Figure 3A). This gene encodes a receptor protein kinase containing an LRR domain. This large protein family plays an important role in regulating plant growth and development and responding to environmental stress. Analysis of the genome upstream and downstream of insertion position 2 shows that the insertion position is located in the promoter of the maize gene Zm00001eb100180 (see Figure 3 B) and the last intron (see Figure 3 C). This gene encodes acetaldehyde dehydrogenase, whose core function is to detoxify aldehydes, maintain metabolic homeostasis, and enhance stress resistance. It is crucial for corn plants to adapt to environmental stress and maintain normal growth and development.
[0145] After obtaining the insertion position, primers were designed based on the genomic sequences flanking the insertion site and the left and right border sequences of the T-DNA. Specific PCR amplification and product sequencing were performed to analyze the integration of the exogenous insertion sequence. The primer sequences used are shown in Table 5. The PCR amplification results are shown in Table 5. Figure 4 shown.
[0146] Table 5 Primer information used for transformation event-specific PCR
[0147]
[0148] 1: Unit: bp.
[0149] PCR reaction system:
[0150]
[0151]
[0152] PCR reaction procedure:
[0153]
[0154] The sequencing results of the left border of the insertion position 1 of transformation event LE4 are shown in SEQ ID NO.14. After alignment, it was found that the LB end vector sequence was deleted by 7bp (TGGCAGG); the sequencing results of the left border of the insertion position 2 are shown in SEQ ID NO.6. The LB end vector sequence was deleted by 5bp (TGGCA), and at the same time, an insertion mutation of a 119bp vector sequence was caused (TTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACGCCGAATTA ATTCATAACTTCGTATAGCATACATTATACGAAGTTATGTTTGATCTGGATTTTAGTACT); the sequencing results of the right border of the insertion position 2 are shown in SEQ ID NO.7. The RB end vector sequence was deleted by 28bp (GTTTGACAGGATATATTGGCGGGTAAAC).
[0155] To further verify that the two insertions on Chr2, which were about 10 kb apart, were caused by the insertion of a T-DNA fragment, PCR amplification of transformation event LE4 was performed using genomic primers SEQ ID NO. 8 and SEQ ID NO. 11 flanking the LB and RB ends. The results are shown in Figure 2. Figure 5 As shown. Sequencing analysis of the PCR product revealed the full-length exogenous insert sequence and upstream and downstream genomic flanking sequences (shown in SEQ ID NO. 5). The results demonstrated that the LE4 exogenous fragment was stably inserted into the maize genome at position 189192328-189203297 bp in Chr2. Analysis of the left and right flanking border sequences revealed that the insertion of the exogenous sequence caused a chromosomal rearrangement in the maize genome at that location, with a 5 bp deletion and a 119 bp insertion at the LB end of the vector, and a 28 bp deletion at the RB end.
[0156] Based on the results of Southern hybridization and flanking sequence separation, it was preliminarily determined that the exogenous sequence of transformation event LE4 was inserted into the maize genome at Chr1: 77591693bp (insertion position 1) and Chr2: 189192328-189203297bp (insertion position 2), indicating a double-copy insertion transformation event. The exogenous sequence at insertion position 2 was 4950bp in length. The structures of the exogenous sequences at the two insertion positions are shown in Figure 2. Figure 8 shown.
[0157] Typically, genomic sequence rearrangements and the insertion of two copies of exogenous sequences, particularly in the case of LE4, where both insertions are located within endogenous maize genes, often result in the suppression of some gene expression or even loss of function, thereby impacting normal plant growth and agronomic performance. Surprisingly, however, the identification results in Example 1 demonstrated that LE4 plants not only exhibited excellent herbicide tolerance, but also maintained their growth and agronomic phenotypes.
[0158] Example 3 Detection Method of Transformation Event LE4
[0159] New varieties can be developed from transgenic corn event LE4 and used to produce agricultural products or commodities. If detected in sufficient quantities in the agricultural products or commodities, the agricultural products or commodities are expected to contain nucleotide sequences that are diagnostic for the presence of transgenic corn event LE4 material in the agricultural products or commodities. The agricultural products or commodities include, but are not limited to, corn oil, cornmeal, cornstarch, corn paste, starch, and other condiments or any other food product consumed by animals as a food source, or cosmetics, industrial products, and the like. Nucleic acid detection methods and / or kits based on probe or primer pairs can be developed to detect transgenic corn event LE4 nucleotide sequences, such as those shown in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 13, in biological samples, where the probe sequence or primer amplification sequence is selected from the sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 13, and SEQ ID NO. 14, to diagnose the presence of transgenic corn event LE4.
[0160] One detection method is to use PCR to detect specific border sequences in corn plants obtained by backcrossing transformation event LE4 with other corn germplasm. The PCR primer pairs used are SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, SEQ ID NO.9.
[0161] The PCR reaction system is:
[0162]
[0163] The PCR reaction program is:
[0164]
[0165] The PCR products were electrophoresed in 1% (w / v) 1×TAE agarose gel. Figure 4 The expected target bands (SEQ ID NO. 6, SEQ ID NO. 7, and / or SEQ ID NO. 14, respectively) can be amplified from the LE4 transformation event. Furthermore, this PCR method can track the presence of transformation events and thus be applied to breeding work.
[0166] In summary, the transgenic maize event LE4 of the present invention can improve plant tolerance to glyphosate and glufosinate herbicides and can be used to improve other maize germplasm and create new maize hybrid combinations. Its detection method can accurately and rapidly identify whether a biological sample contains DNA molecules from the transgenic maize event LE4.
[0167] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A nucleic acid molecule, characterized in that Includes any of the following: i) a nucleic acid molecule having the sequence shown in SEQ ID NO.1 and / or SEQ ID NO.2 and / or SEQ ID NO.13, or a reverse complementary sequence thereof; ii) a nucleic acid molecule having the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4, or a reverse complementary sequence thereof; iii) a nucleic acid molecule having the sequence shown in SEQ ID NO. 6 and / or SEQ ID NO. 7 and / or SEQ ID NO. 14, or a reverse complementary sequence thereof; iv) a nucleic acid molecule having the sequence shown in SEQ ID NO. 5, or its reverse complementary sequence; The nucleic acid molecule is derived from a plant, seed or cell of maize transformation event LE4. The seeds of maize transformation event LE4 have been deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: P202508.
2. A probe for detecting maize transformation event LE4, characterized in that: The sequence of the probe includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.6 or SEQ ID NO.7 or SEQ ID NO.13 or SEQ ID NO.14 or the reverse complementary sequence thereof.
3. A primer pair for detecting maize transformation event LE4, characterized in that: The sequence of the amplified product of the primer pair is the sequence described in claim 2; Optionally, the sequences of the primer pair are shown as SEQ ID NO.8 and SEQ ID NO.9; or as SEQ ID NO.10 and SEQ ID NO.11; or as SEQ ID NO.12 and SEQ ID NO.
9.
4. A kit or microarray for detecting maize transformation event LE4, characterized in that: Comprising the probe according to claim 2 and / or the primer pair according to claim 3.
5. A method for detecting maize transformation event LE4, characterized in that The method comprises detecting whether the conversion event exists in the sample to be tested by any of the following methods: i) the probe according to claim 2; ii) the primer pair according to claim 3; iii) the probe according to claim 2 and the primer pair according to claim 3; iv) The kit or microarray according to claim 4.
6. A method for breeding corn, characterized in that: The method comprises the following steps: 1) obtaining corn containing the nucleic acid molecule according to claim 1; 2) subjecting the corn obtained in step 1) to pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, selfing or hybridization, or a combination thereof, to obtain corn plants, seeds, plant cells, offspring plants, or plant parts; and optionally, 3) Identifying the resistance of the progeny plants obtained in step 2) to glufosinate herbicide and / or glyphosate herbicide, and detecting whether there is a transformation event therein using the method of claim 5.
7. The product obtained by the method according to claim 6, characterized in that The product is a product made from corn plants, seeds, plant cells, progeny plants or plant parts, including food, feed or industrial raw materials.
8. A method for protecting corn plants from damage caused by herbicides, characterized in that Transgenic corn plants comprising corn event LE4 are planted and an effective amount of glufosinate herbicide and / or glyphosate herbicide is applied. The seeds of corn event LE4 have been deposited in China Center for Type Culture Collection with deposit number CCTCC NO: P202508.
9. A method for controlling weeds in a field of corn plants, characterized in that The method comprises applying an effective dose of glufosinate herbicide and / or glyphosate herbicide to a field where transgenic corn plants comprising corn event LE4 are planted. The seeds of the corn event LE4 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202508.