LAMP (Loop-Mediated Isothermal Amplification) detection primer combination for camellia anthracnose, kit and application

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) detection primer combination, a kit and application of the LAMP detection primer combination and the kit. Six specific LAMP primer combinations are designed by utilizing a section of specific gene sequence of camellia anthracnose, and an LAMP rapid detection method of camellia anthracnose is established on the basis and is applied to field detection. The method has the advantages of rapidness, high efficiency, high accuracy, high sensitivity, capability of observing detection results by naked eyes and the like.

Description

(1) Technical field

[0001] The present invention relates to a LAMP detection primer combination, a kit and an application of Colletotrichum camelliae. (2) Background technology

[0002] Tea (Camellia sinensis (L.) O. Kuntze) is an important economic crop, widely cultivated in tropical and subtropical regions. Anthracnose, caused by the fungus Colletotrichum camelliae, is a common foliar disease of tea trees. It is particularly severe in tea plantations in southern China, where humidity is high and mountainous areas are often foggy. When it breaks out, it can affect the normal growth and development of tea trees, making the leaves brittle and prone to falling off. This can lead to a decline in tea quality and yield, resulting in severe economic losses.

[0003] In recent years, plant disease detection technology has evolved from traditional, time-consuming field isolation and testing to molecular biological detection. These technologies offer significant advantages: ease of use, rapid detection, and high accuracy. For pathogenic fungi, molecular detection techniques include conventional PCR, multiplex PCR, nested PCR, real-time fluorescence quantitative PCR, PCR-ELISA, molecular hybridization, and gene probes. However, these techniques require specialized operator expertise and sophisticated temperature-controlled equipment, making them unsuitable for grassroots application and widespread adoption. Consequently, the more rapid and convenient isothermal amplification technology has rapidly developed.

[0004] Loop-mediated isothermal amplification (LAMP) is a novel DNA amplification technology developed by Japanese researchers in 2000. It amplifies DNA under isothermal conditions with high specificity, efficiency, and speed. It is not significantly affected by the presence of non-target DNA and does not require sophisticated equipment such as a PCR instrument. Using only a water bath to maintain a constant temperature (60-65°C), LAMP amplification products can be amplified in 30-80 minutes, yielding up to 1010-fold the amount of DNA sample. This reduces both testing time and instrument costs. The technology relies on automated cyclical strand displacement DNA synthesis, using a DNA polymerase and four specially designed primers (two inner and two outer primers) to recognize six specific fragments on the target DNA. The reaction result can be directly determined by observing the color change of the product after adding a nucleic acid dye, making it highly suitable for on-site testing at grassroots testing institutions.

[0005] With the improvement, refinement and development of LAMP technology, its application in the field of molecular detection has become increasingly extensive. There have also been many reports on the detection of plant pathogenic fungi, such as soybean anthracnose (Colletotrichum truncatum), pepper anthracnose (Colletotrichum capsici), strawberry anthracnose (Colletotrichum gloeosporioides), and tea anthracnose (Colletotrichum siamense). However, there are few studies on the detection of camellia anthracnose. (3) Summary of the invention

[0006] The present invention aims to provide a LAMP detection primer combination for Colletotrichum camelliae and its application. The present invention utilizes a specific gene sequence of Colletotrichum camelliae to design six specific LAMP primer combinations. On this basis, a LAMP rapid detection method for Colletotrichum camelliae is established and applied to field detection. The method has the advantages of being rapid, efficient, highly accurate, highly sensitive, and the ability to observe the detection results with the naked eye.

[0007] The technical solution adopted in the present invention is:

[0008] In a first aspect, the present invention provides a LAMP detection primer combination for Colletotrichum camelliae, wherein the LAMP detection primer combination comprises a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, a reverse inner primer BIP, a forward loop primer LF, and a reverse loop primer LB, and the sequences of the primers are as follows:

[0009] Forward outer primer F3: 5'GGTGTCACATCGTACCCTCT3' (SEQ ID NO. 1),

[0010] Reverse outer primer B3: 5'CGTTGCTACCTGGTCATTGG3' (SEQ ID NO. 2);

[0011] Forward inner primer FIP:

[0012] 5'CATCAGACACGTGCCGGAGCTTCAAATGACCCTCAGGACG 3' (SEQ ID NO.3),

[0013] Reverse inner primer BiP:

[0014] 5'AGTCTGGAAAGCAGGCGCAGGACAGAAAGACCGAAACCCA3' (SEQ ID NO. 4);

[0015] Forward loop primer LF: 5'GCCGCTGACCCAAATGCT 3' (SEQ ID NO. 5),

[0016] Reverse loop primer LB: 5'AGTGCGGGACTCACTTTCGAT 3' (SEQ ID NO. 6).

[0017] In a second aspect, the present invention provides an application of the primer combination in detecting Colletotrichum camelliae.

[0018] In a third aspect, the present invention provides a LAMP kit for detecting Colletotrichum camelliae constructed using the primer combination.

[0019] Furthermore, the kit includes a LAMP detection primer combination, a reaction solution and a dye; the reaction solution includes BstDNA polymerase, Bst buffer, MgSO4, and dNTP Mixture; and the dye includes SYBR GreenⅠ.

[0020] Furthermore, the kit consists of 10×ThermoPol Buffer, 100 mM MgSO4, 10 mM dNTPMixture, 10 mM forward outer primer F3, 10 mM reverse outer primer B3, 10 mM forward inner primer FIP, 10 mM reverse inner primer BIP, 10 mM forward loop primer LF, 10 mM reverse loop primer LB, 8 U / μL Bst DNA polymerase and 2 μL SYBR Green I.

[0021] Furthermore, the 10×ThermoPol Buffer is composed of the following components at the following concentrations: 200 mM Tris-HCl, 10 mM KCl, 100 mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100, pH 8.8, and the solvent is water.

[0022] In a fourth aspect, the present invention provides use of the above-mentioned LAMP kit in detecting Colletotrichum camelliae.

[0023] In a fifth aspect, the present invention provides a LAMP method for Colletotrichum camelliae, comprising:

[0024] The total DNA of the sample to be tested was extracted as a template, and LAMP amplification was performed using the LAMP primer combination. After the reaction was completed, 0.2 μL of SYBR Green I was added to the reaction tube. If the liquid in the tube changed from orange to yellow-green, it was positive, indicating that the sample contained camellia anthracnose; if it turned orange, it was negative, indicating that the sample did not contain camellia anthracnose.

[0025] Furthermore, the conditions for LAMP amplification were as follows: incubation at 65°C for 30 min and termination of the reaction at 95°C for 2 min.

[0026] Furthermore, the LAMP amplification system was as follows: 10×ThermoPol Buffer 2.5 μL, 100 mM MgSO4 1.5 μL, 10 mM dNTP Mix 3.5 μL, 10 mM forward outer primer F3 0.5 μL, 10 mM reverse outer primer B3 0.5 μL, 10 mM forward inner primer FIP 4 μL, 10 mM reverse inner primer BIP 4 μL, 10 mM forward loop primer LF 2 μL, 10 mM reverse loop primer LB 2 μL, 8 U / μL Bst DNA polymerase 1 μL, 1 ng / μL template 1 μL, and sterile ultrapure water to 25 μL.

[0027] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0028] 1. Low cost, simple operation, and good applicability: The biggest advantage of this invention is that it does not require expensive professional instruments such as PCR instruments, but only requires a constant temperature instrument such as a water bath. This invention does not require the cumbersome operating steps of PCR testing, is simple and easy to use, and is convenient for grassroots promotion and use.

[0029] 2. Rapid detection: Using the detection method of the present invention, the test results can be obtained in about 30 minutes, which greatly shortens the operation time and is convenient and fast.

[0030] 3. High Specificity and Reliable Results: The primers designed in this invention are key to this technology. These primers are based on a specific gene sequence in Colletotrichum camelliae. The primers contain six specific primers (including a loop primer) that recognize six independent regions of the target sequence. A mismatch between any of these six regions prevents nucleic acid amplification. This significantly improves specificity and sensitivity compared to the two independent regions of a PCR reaction. The LAMP primers and reaction system of this invention have been repeatedly validated indoors on tea leaves inoculated with Colletotrichum camelliae and exhibiting symptoms of tea anthracnose, yielding reliable results.

[0031] 4. High sensitivity: The detection sensitivity of the present invention to camellia anthracnose can reach 100ag / μL at the DNA level, which is very sensitive.

[0032] 5. The test results are intuitive and can be judged by the naked eye: the amplified product of the present invention can be stained by adding the nucleic acid dye SYBR Green I. If the liquid in the tube changes from orange to yellow-green, it is a positive result, that is, the sample contains camellia anthracnose; if it turns orange, it is a negative result, that is, the sample does not contain camellia anthracnose. The test result can be judged by the naked eye. (IV) Description of the accompanying drawings

[0033] Figure 1The specific detection of the LAMP detection primers for Colletotrichum camelliae of the present invention is shown in Figure 1. A shows the agarose gel electrophoresis results of LAMP detection of Colletotrichum camelliae and other fungi, and B shows the color change of the reaction product after adding SYBR Green I after LAMP amplification. Among them, 1-10 are Colletotrichum camelliae YCW698, YCW1250, YCW1315, YCW1331, YCW1377, YCW1390, YCW1409, YCW1417, YCW1426 and YCW1450, 11 is Co.aenigma JS1A29, 12 is Co.cliviae AH1A2, 13 is Co.endophytica YN1A3, 14 is Co.fioriniae FJ1A1, 15 is Co.fructicola JS1A13, 16 is Co.siamense YN2A9, 17 is Co.wuxiense JS1A32, 18 is Cladosporium angulosum YCW2169, 19 is Didymella segeticola YCW109, and 20 is Epicoccum mackenziei YCW1965, 21 is Neoascochyta mortariensis YCW1346, 22 is Paraboeremia litseae YCW1363, and 23 is a no-template control. 1-10 are yellow-green.

[0034] Figure 2 This is a LAMP sensitivity test for Colletotrichum camelliae of the present invention. A shows the agarose gel electrophoresis results of LAMP detection of Colletotrichum camelliae YCW1331 and the color change of the reaction product after adding SYBR Green I after LAMP amplification. B shows Colletotrichum camelliae YCW1401. The DNA template concentrations of 1-10 are 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, 100 ag / μL, 10 ag / μL, and 1 ag / μL, respectively. 11 is a no-template control. 1-8 displays yellow-green.

[0035] Figure 3This is the present invention's LAMP assay for Colletotrichum camelliae in leaves of four tea varieties 72 hours after indoor inoculation with the fungus. A shows the symptoms of diseased leaves in the four tea varieties 72 hours after artificial inoculation with Colletotrichum camelliae. B shows the agarose gel electrophoresis results of the LAMP assay and the color change of the reaction product after adding SYBR Green I after LAMP amplification. Figures 1-10 represent Colletotrichum camelliae strains YCW698, YCW1250, YCW1315, YCW1331, YCW1377, YCW1390, YCW1409, YCW1417, YCW1426, and YCW1450, and 11 is a negative control (DNA from healthy leaves). Figures 1-10 appear yellow-green.

[0036] Figure 4 Figure 1 shows LAMP assays performed on healthy leaves and leaves with anthracnose symptoms from 18 tea varieties grown in the field. A shows the agarose gel electrophoresis results of LAMP assays on healthy leaves and the color change of the reaction product after adding SYBR Green I after LAMP amplification. B shows LAMP assays on leaves with anthracnose symptoms. Among them, 1 is 2018-M89, 2 is 2018-M90, 3 is 2018-M95, 4 is 2018-M86, 5 is 2018-M100, 6 is 2021-WZ-7, 7 is AJ15, 8 is AJ16, 9 is AJ17, 10 is AJ18, 11 is 2021-20M, 12 is 2021-38M, 13 is 2021-19M, 14 is 2021-45M, 15 is 2021-2-2-M, 16 is 2021-01-M, 17 is 2021-2-6-M, 18 is 2021-3-11-M, and 19 is the positive control (DNA of diseased Longjing 43 leaves inoculated with camellia anthracnose fungus YCW1409). (V) Specific implementation methods

[0037] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0038] The following examples are all based on conventional experimental conditions, or the operating technical procedures described in the relevant published literature, or the experimental conditions established by the manufacturer.

[0039] Example 1: Design of specific primers for Colletotrichum camelliae loop-mediated isothermal amplification (LAMP) detection and primer specificity verification

[0040] 1. Extraction of genomic DNA from test strains

[0041] Genomic DNA from tea leaves and the fungal strains tested (Table 1) was extracted using a plant / fungal DNA kit (Cat. No. 3200050, Hangzhou Xinjing Biological Reagent Development Co., Ltd.) according to the following procedures:

[0042] 1) Place 100-500 mg of fresh tea plant leaves in a mortar, add 100-200 μL of 65°C preheated Buffer PD and 2 μL of β-mercaptoethanol, and grind vigorously until a homogenous paste is formed. Alternatively, grind approximately 300-500 mg of the test fungi listed in Table 1 into a powder while submerging the sample in liquid nitrogen.

[0043] 2) After thorough grinding, add 800-900 μL of Buffer PD preheated at 65°C (total volume of Buffer PD added in the previous step is 1 mL) and continue grinding for 1 minute to completely lyse the tissue. Alternatively, for fungal samples, add 1 mL of Buffer PD preheated at 65°C and 2 μL of β-mercaptoethanol and continue grinding for 1 minute to completely lyse the fungi.

[0044] 3) Transfer 800 μL of the lysate to a 2 mL centrifuge tube and place the tube in a 65°C water bath for 30 minutes. Invert the tube several times every 5-10 minutes to help release the DNA.

[0045] 4) Add 800 μL of Buffer EX, mix vigorously, and centrifuge at 12,000 rpm for 5 minutes.

[0046] 5) Carefully aspirate the supernatant (approximately 600 μL) and transfer it to a new 1.5 mL centrifuge tube;

[0047] 6) Add an equal volume of Buffer GP to the supernatant and mix well;

[0048] 7) The mixture from step 6) was added to the nucleic acid purification column (placed in a 2 mL centrifuge tube) in two portions, capped, and centrifuged at 12,000 rpm for 30 seconds;

[0049] 8) Discard the filtrate in the 2 mL centrifuge tube, return the nucleic acid purification column to the 2 mL centrifuge tube, add 500 μL of Buffer WA to the nucleic acid purification column, cover the tube, and centrifuge at 12,000 rpm for 30 seconds;

[0050] 9) Discard the filtrate in the 2 mL centrifuge tube, return the nucleic acid purification column to the 2 mL centrifuge tube, add 500 μL of Buffer WB to the nucleic acid purification column, cover the tube, and centrifuge at 12,000 rpm for 30 seconds;

[0051] 10) Discard the filtrate in the 2 mL centrifuge tube, return the nucleic acid purification column to the 2 mL centrifuge tube, cap the tube, and centrifuge at 14,000 rpm for 1 minute.

[0052] 11) Discard the 2 mL centrifuge tube and place the nucleic acid purification column in a clean 1.5 mL centrifuge tube. Add 100-200 μL of 65°C preheated Buffer TE to the column, cap the tube, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute.

[0053] 12) Discard the purification column. The eluted DNA can be used immediately for various molecular biology experiments or stored at -20°C for later use.

[0054] Table 1 Test strains

[0055]

[0056] 2. Design of LAMP-specific primers for Colletotrichum camelliae

[0057] The genome sequences of Colletotrichum camelliae (GenBank ID: GCA_018853505.1) and other major tea pathogens, including Colletotrichum fructicola (GenBank ID: GCA_025558505.1), Didymellasegeticola (GenBank ID: GCA_004522025.1), and Pseudopestalotiopsis camelliae-sinensis, were aligned using BLAST. A gene sequence encoding a lateembryogenesis abundant (LEA) domain protein specific to Colletotrichum camelliae was identified. A specific LAMP primer set was designed using the online LAMP primer design software Primerexplorer V5 (http: / / primerexplorer.jp / e / ). The primers consisted of one outer primer pair, F3 / B3; one inner primer pair, FIP / BIP; and one loop primer pair, LF / LB. The primer sequences are as follows:

[0058] F3:5'GGTGTCACATCGTACCCTCT3',

[0059] B3:5'CGTTGCTACCTGGTCATTGG3',

[0060] FIP:5'CATCAGACACGTGCCGGAGCTTCAAATGACCCTCAGGACG 3',

[0061] BIP:5'AGTCTGGAAAGCAGGCGCAGGACAGAAAGACCGAAACCCA 3',

[0062] LF:5'GCCGCTGACCCAAATGCT3',

[0063] LB:5'AGTGCGGGACTCACTTTCGAT 3'.

[0064] 3. Establishment of LAMP Detection Method for Colletotrichum camelliae and Verification of Primer Specificity

[0065] Using the DNA of the test strain in Table 1 as a template, LAMP amplification was performed using outer primers F3 / B3, inner primers FIP / BIP, and loop primer LF / LB. The reaction system was 25 μL, including 10× ThermoPol Buffer (200 mM Tris-HCl pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% Triton X-100) 2.5 μL, 100 mM MgSO4 1.5 μL, 10 mM dNTP Mix 3.5 μL, 10 mM outer primers F3 and B3 0.5 μL each, 10 mM inner primers FIP and BIP 4 μL each, 10 mM loop primers LF and LB 2 μL each, 8 U / μL Bst 1 μL DNA polymerase, 1 μL DNA template (1 ng / μL), add sterile water to 25 μL; reaction conditions: constant temperature reaction at 65°C for 30 min, then reaction at 95°C for 2 min to terminate the reaction.

[0066] Determination of reaction results:

[0067] Electrophoresis: After the reaction is completed, take 7 μL of LAMP amplification product and perform electrophoresis on 2% agarose gel. If a ladder-like band is produced, it is judged as positive, that is, the sample contains camellia anthracnose bacteria. If no band is produced, it is judged as negative, that is, the sample does not contain camellia anthracnose bacteria. The results are shown in Figure 1 Middle A.

[0068] LAMP: After the reaction is completed, add 0.2 μL of nucleic acid dye SYBR Green I to the LAMP amplification product. If the liquid in the tube changes from orange to yellow-green, it is positive, that is, the sample contains camellia anthracnose; if it turns orange, it is negative, that is, the sample does not contain camellia anthracnose. The results are shown in the table. Figure 1 Middle B.

[0069] 4. Primer specificity verification results

[0070] The results of LAMP amplification showed that after the genomic DNA of the tested camellia anthracnose fungus was used as a template for amplification, the reaction product showed a ladder-like band after electrophoresis using 2% agarose gel, and the color development result was observed to be yellow-green. The amplification products of the other pathogenic fungi and the no-template control did not show amplification bands after electrophoresis detection, and the color development result was orange ( Figure 1), indicating that the designed outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB can distinguish Colletotrichum camelliae from other tea pathogenic fungi with high specificity, and can be used for rapid and reliable detection and identification of Colletotrichum camelliae.

[0071] Example 2: Sensitivity determination of LAMP detection primer combination

[0072] 1. Preparation of Genomic DNA at Different Concentrations

[0073] The genomic DNA (1 ng / μL) of two strains of Colletotrichum camelliae, YCW1331 and YCW1409, was gradiently diluted with sterile water to prepare a series of concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, 100 ag / μL, 10 ag / μL, and 1 ag / μL in 10 times the order of magnitude for use.

[0074] 2. Sensitivity determination of LAMP detection method and observation of results

[0075] LAMP amplification was performed using different concentrations of Colletotrichum camelliae genomic DNA as a template using outer primers F3 / B3, inner primers FIP / BIP, and loop primer LF / LB. The reaction system was 25 μL, including 2.5 μL of 10×ThermoPol Buffer, 1.5 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP Mix, 0.5 μL each of 10 mM outer primers F3 and B3, 4 μL each of 10 mM inner primers FIP and BIP, 2 μL each of 10 mM loop primers LF and LB, 1 μL of 8 U / μL Bst DNA polymerase, and 1 μL of DNA template. The volume was made up to 25 μL with sterile water. The reaction conditions were: constant temperature reaction at 65°C for 30 min, and then the reaction was terminated at 95°C for 2 min.

[0076] Determination of reaction results:

[0077] Electrophoresis: After the reaction is completed, take 7 μL of LAMP amplification product and detect it by 2% agarose gel electrophoresis. If a ladder-like band is produced, it is judged as positive, that is, the sample contains camellia anthracnose bacteria. If no band is produced, it is judged as negative, that is, the sample does not contain camellia anthracnose bacteria.

[0078] LAMP: After the reaction is completed, add 0.2 μL of the nucleic acid dye SYBR Green I to the LAMP amplification product. If the liquid in the tube changes from orange to yellow-green, it is positive, that is, the sample contains Colletotrichum camelliae; if it turns orange, it is negative, that is, the sample does not contain Colletotrichum camelliae.

[0079] The results of LAMP amplification sensitivity test showed that after LAMP amplification with genomic DNA of Colletotrichum camelliae at concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, 100 ag / μL, 10 ag / μL, and 1 ag / μL as template, agarose gel electrophoresis results showed that the LAMP reaction products showed clear ladder-like bands at concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, and 100 ag / μL. After the reaction was completed and SYBR Green I was added to the tube, the color of the liquid in the reaction tube changed from orange to yellow-green. No bands were produced at 10 ag / μL, 1 ag / μL, and the no-template control, and the tubes were all orange ( Figure 2 ), indicating that the designed outer primers F3, B3, inner primers FIP, BIP and loop primers LF, LB can detect the DNA of Colletotrichum camelliae through LAMP amplification with a sensitivity of 100 ag / μL.

[0080] Example 3: LAMP detection of leaves of four tea varieties 72 hours after inoculation with Colletotrichum camelliae

[0081] Camellia anthracnose was selected from the literature (Cheng Kaixin et al. "Study on the pathogenicity of camellia anthracnose to tea trees and its sensitivity to fungicides", Tea Science, 2023, 43: 55-66), as shown in Table 1.

[0082] Sample collection: Healthy leaves of four tea varieties, Longjing 43, Zhongcha 102, Zhongcha 108, and Zhongcha 302, were collected from the Tea Research Institute of the Chinese Academy of Agricultural Sciences. The leaves were scratched and inoculated with 10 strains of Colletotrichum camelliae. The leaves were kept moisturized in the dark at 28°C for 72 hours before sampling.

[0083] Extraction of plant tissue DNA: Genomic DNA was extracted using a plant / fungal DNA kit (3200050, Hangzhou Xinjing Biological Reagent Development Co., Ltd.) according to the operating procedures.

[0084] LAMP amplification detection and observation: Using the above-extracted DNA as a template, LAMP amplification was performed using outer primers F3 / B3, inner primers FIP / BIP, and loop primers LF / LB. The reaction system was 25 μL, including 2.5 μL of 10×ThermoPol Buffer, 1.5 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP Mix, 0.5 μL each of 10 mM outer primers F3 and B3, 4 μL each of 10 mM inner primers FIP and BIP, 2 μL each of 10 mM loop primers LF and LB, 1 μL of 8 U / μL Bst DNA polymerase, and 1 μL of DNA template (1 ng / μL). The volume was made up to 25 μL with sterile water. Reaction conditions: constant temperature reaction at 65°C for 30 min, and then the reaction was terminated by reaction at 95°C for 2 min.

[0085] Determination of reaction results:

[0086] Electrophoresis: After the reaction is completed, take 7 μL of LAMP amplification product and detect it by 2% agarose gel electrophoresis. If a ladder-like band is produced, it is judged as positive, that is, the sample contains camellia anthracnose bacteria. If no band is produced, it is judged as negative, that is, the sample does not contain camellia anthracnose bacteria.

[0087] LAMP: After the reaction is completed, add 0.2 μL of the nucleic acid dye SYBR Green I to the LAMP amplification product. If the liquid in the tube changes from orange to yellow-green, it is positive, that is, the sample contains Colletotrichum camelliae; if it turns orange, it is negative, that is, the sample does not contain Colletotrichum camelliae.

[0088] Test results ( Figure 3 ) showed that after amplification using the genomic DNA of diseased leaves of four varieties as a template, the reaction products showed ladder-like bands after electrophoresis using 2% agarose gel, and the color development results showed yellow-green. No bands were produced in the negative control, and the tubes were all orange, indicating that the LAMP method can produce positive amplification in diseased tea leaves after inoculation with camellia anthracnose, and accurately detect camellia anthracnose. This technology can be used for rapid molecular detection of camellia anthracnose in tea leaves.

[0089] Example 4: LAMP detection of healthy leaves and leaves with anthracnose symptoms of 18 tea varieties in the field

[0090] Sample collection: Leaves with typical symptoms of anthracnose and healthy leaves of 18 tea tree varieties were collected from the Tea Research Institute of the Chinese Academy of Agricultural Sciences.

[0091] Extraction of plant tissue DNA: Genomic DNA was extracted using the Plant / Fungus DNA Kit (3200050, Hangzhou Xinjing Biological Reagent Development Co., Ltd.) according to the operating procedures.

[0092] LAMP amplification detection and observation: Using the above-extracted DNA as a template, LAMP amplification was performed using outer primers F3 / B3, inner primers FIP / BIP, and loop primers LF / LB. The reaction system was 25 μL, including 2.5 μL of 10×ThermoPol Buffer, 1.5 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP Mix, 0.5 μL each of 10 mM outer primers F3 and B3, 4 μL each of 10 mM inner primers FIP and BIP, 2 μL each of 10 mM loop primers LF and LB, 1 μL of Bst DNA polymerase, and 1 μL of DNA template (1 ng / μL). The volume was filled to 25 μL with sterile water. Reaction conditions: constant temperature reaction at 65°C for 30 min, and then the reaction was terminated at 95°C for 2 min.

[0093] Determination of reaction results:

[0094] Electrophoresis: After the reaction is completed, take 7 μL of LAMP amplification product and detect it by 2% agarose gel electrophoresis. If a ladder-like band is produced, it is judged as positive, that is, the sample contains camellia anthracnose bacteria. If no band is produced, it is judged as negative, that is, the sample does not contain camellia anthracnose bacteria.

[0095] LAMP: After the reaction is completed, add 0.2 μL of the nucleic acid dye SYBR Green I to the amplified product of the LAMP reaction. If the liquid in the tube changes from orange to yellow-green, it is positive, that is, the sample contains Colletotrichum camelliae; if it turns orange, it is negative, that is, the sample does not contain Colletotrichum camelliae.

[0096] Test results ( Figure 4 ) showed that when LAMP amplification was performed using the genomic DNA of diseased leaves showing symptoms of tea anthracnose as a template, the reaction products showed ladder-like bands after 2% agarose gel electrophoresis, and the color development results were observed to be yellow-green, indicating that camellia anthracnose was present in the diseased leaves. When LAMP amplification was performed using the genomic DNA of healthy leaves as a template, no amplification bands appeared in the reaction products after 2% agarose gel electrophoresis, and the color development results were orange, indicating that camellia anthracnose was not present in the healthy leaves. This LAMP method can produce positive amplification in anthracnose leaves of tea trees in the field and accurately detect camellia anthracnose. This technology can be used for rapid molecular detection of camellia anthracnose in tea leaves.

[0097] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A LAMP primer combination for detection of Colletotrichum camelliae, characterized in that: The LAMP detection primer combination includes a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, a reverse inner primer BIP, a forward loop primer LF, and a reverse loop primer LB. The sequences of the primers are as follows: Forward outer primer F3: 5'GGTGTCACATCGTACCCTCT3', Reverse outer primer B3: 5′CGTTGCTACCTGGTCATTGG3′; Forward inner primer FIP: 5'CATCAGACACGTGCCCGGAGCTTCAAATGACCCTCAGGACG 3', Reverse inner primer BiP: 5'AGTCTGGAAAGCAGGCGCAGGACAGAAAGACCGAAACCCA3'; Forward loop primer LF: 5'GCCGCTGACCCAAATGCT 3', Reverse loop primer LB: 5'AGTGCGGGACTCACTTTCGAT 3'.

2. Use of the primer combination according to claim 1 in detecting Colletotrichum camelliae.

3. A LAMP kit for detecting Colletotrichum camelliae constructed using the primer combination of claim 1.

4. The LAMP kit according to claim 3, wherein The kit includes a LAMP detection primer combination, a reaction solution and a dye; the reaction solution includes Bst DNA polymerase, Bst buffer, MgSO4, and dNTP Mixture; and the dye includes SYBR Green I.

5. The LAMP kit according to claim 4, wherein The kit consists of 10×ThermoPolBuffer, 100mM MgSO4, 10mM dNTP Mixture, 10mM forward outer primer F3, 10mM reverse outer primer B3, 10mM forward inner primer FIP, 10mM reverse inner primer BIP, 10mM forward loop primer LF, 10mM reverse loop primer LB, 8U / μL Bst DNA polymerase and 2μL SYBR GreenⅠ.

6. The LAMP kit according to claim 5, wherein The 10×ThermoPol Buffer is composed of the following components: 200 mM Tris-HCl, 10 mM KCl, 100 mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100, pH 8.8, and the solvent is water.

7. Use of the LAMP kit according to any one of claims 3 to 6 in detecting Colletotrichum camelliae.

8. A LAMP method for Colletotrichum camelliae, characterized in that: The method is: The total DNA of the sample to be tested was extracted as a template, and LAMP amplification was performed using the LAMP primer combination described in claim 1. After the reaction was completed, 0.2 μL of SYBR Green I was added to the reaction tube. If the liquid in the tube changed from orange to yellow-green, it was positive, indicating that the sample contained camellia anthracnose; if it turned orange, it was negative, indicating that the sample did not contain camellia anthracnose.

9. The method according to claim 8, wherein The conditions for LAMP amplification were as follows: incubation at 65°C for 30 min and termination of the reaction at 95°C for 2 min.

10. The method according to claim 8, wherein The LAMP amplification system is: 10×ThermoPol Buffer 2.5μL, 100mM MgSO4 1.5μL, 10mM dNTP Mix 3.5μL, 10mM forward outer primer F3 0.5μL, 10mM reverse outer primer B3 0.5μL, 10mM forward inner primer FIP 4μL, 10mM reverse inner primer BIP 4μL, 10mM forward loop primer LF 2μL, 10mM reverse loop primer LB 2μL, 8U / μL Bst DNA polymerase 1μL, 1ng / μL template 1μL, and sterile ultrapure water to 25μL.

Images