Rice leaf width gene locus OsLwid9.13 and molecular marker and application thereof
By developing the rice leaf width gene locus OsLwid9.13 and its molecular markers and using KASP molecular markers for genotyping, the problem of difficulty in effectively regulating the rice leaf width trait in existing technologies has been solved, and efficient and accurate leaf width gene detection and accelerated breeding process have been achieved.
Patent Information
- Application Number
- CN202511060276.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-09-19
AI Technical Summary
Existing technologies make it difficult to effectively establish the gene regulatory network for rice leaf development, making it difficult to better reveal the molecular mechanism of leaf development, and there is a lack of sufficient gene loci for regulating rice leaf width traits.
The rice leaf width gene locus OsLwid9.13 and its corresponding molecular markers were developed, and KASP molecular markers were used for rapid gene typing and identification, which were applied to rice molecular breeding to achieve early molecular marker-assisted selection.
It has improved the efficiency of phenotypic selection of rice leaf width traits, achieved rapid and accurate leaf width gene detection, reduced breeding costs, shortened breeding years, and accelerated the breeding process of wide-leaf rice varieties.
Smart Images

Figure CN120666104A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of rice breeding, and in particular to a rice leaf width gene locus OsLwid9.13, a molecular marker thereof, and an application thereof. Background Art
[0002] Rice ( Oryza sativa Rice (L.) is the most important food crop in my country and globally, with nearly half of the world's population relying on rice as their staple food. Rice leaves are the primary site of photosynthesis and respiration, and are also the primary regulator of stress tolerance and transpiration (Donald et al., 1968; Matsushima Shozo et al., 1981; Khush et al., 1990). Leaf width directly influences plant morphology. A suitable leaf width is crucial for optimizing light absorption, harvest index, and ultimately yield.
[0003] In recent years, many new advances have been made in the research on genes related to the regulation of rice leaf width, such as NAL1 、 NAL7 、 ZYY1 、 GHD7 Genes have been used to control rice traits such as leaf width, photosynthetic efficiency, and yield (Wang Di et al., 2021). However, the number of genes controlling leaf development in rice that have been isolated is relatively small. Furthermore, progress in functional research has been slow, making it difficult to establish an effective gene regulatory network and better understand the molecular mechanisms of leaf development.
[0004] Rice flag leaf width is a typical QTL-controlled trait, controlled by multiple genes. Therefore, it is necessary to identify more leaf width genes to facilitate the breeding of wide-leaf rice varieties. Molecular marker-assisted selection (MAS) is a modern breeding technique that utilizes markers tightly linked to trait genes to select for target traits based on genotype during the seedling stage. This method not only significantly shortens breeding years and improves breeding efficiency, but also saves significant manpower and material costs. Molecular markers have great application value in improving rice flag leaf width, enhancing rice photosynthetic efficiency, and thus increasing rice yield. The development of new leaf width-controlling genes and their associated molecular markers is of great significance for improving rice leaf width and increasing rice yield. Summary of the Invention
[0005] The present invention provides a rice leaf width gene locus OsLwid9.13 and its molecular marker and application. The locus can be used for commercial molecular breeding of broad-leaf rice. The molecular marker-assisted selection has high efficiency and can be performed in the early stages of breeding, thereby reducing breeding costs and accelerating the breeding process of broad-leaf rice.
[0006] In order to achieve the above-mentioned object, the present invention provides, on one hand, a molecular marker for controlling rice leaf width, which is the gene locus OsLwid9.13 located at the 101st nucleotide of SEQ ID No.1, and the nucleotide type is T or C. The gene locus OsLwid9.13 is a SNP site in the rice genome. When its genotype is CC, the rice has wide leaves or is a candidate for wide leaves, wherein the CC genotype indicates that the nucleotide type of the OsLwid9.13 site in the rice genome is homozygous for C.
[0007] SEQ ID No. 1: TTTCAACGAAAGAGAAAAGAGAAGCAAGGTGGCCGGGATGCGTGTGACGACCGACGGCTGAAATAACTGCAGAAAGTCCGGCAGAATGTCCGTAATACTTNTCTCATGTCAAAATGCAATGCATATATAGGGCGCCGCCGGACGCGTGTCTGGCT CCGCGATTCGATCGCATGTTCATCCAGCAGGCAAAAAAAAGCACATCTGCACACATGGGCGGTACTGTACATGATCTCGAGCTGTCCGTGTGGATTGCCCGGCTTTCGGCGCCTTGGGATTGATTGATCGATCGATCGATCAATT, where N is [T / C].
[0008] The second aspect of the present invention provides a primer for detecting the above-mentioned molecular marker, which includes a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2 at positions 22-42, a single-stranded DNA with a nucleotide sequence of SEQ ID No. 3 at positions 22-42, and a single-stranded DNA with a nucleotide sequence of SEQ ID No. 4.
[0009] SEQ ID No. 2: 5'-GAAGGTCGGAGTCAACGGATT GCAGAATGTCCGTAATACTTT -3' SEQ ID No.3: 5'-GAAGGTGACCAAGTTCATGCT GCAGAATGTCCGTAATACTTC -3' SEQ ID No.4: 5'-ATGCATTGCATTTTGACATGAG-3'.
[0010] The third aspect of the present invention provides the use of the above-mentioned primers in detecting the above-mentioned molecular markers.
[0011] The fourth aspect of the present invention provides PCR reagents and kits using the above-mentioned primers.
[0012] The fifth aspect of the present invention provides the use of the above-mentioned PCR reagent or kit in detecting the above-mentioned molecular markers.
[0013] Through the above technical solution, the present invention achieves the following beneficial effects: The present invention has developed a new rice leaf width gene locus OsLwid9.13 and a corresponding KASP molecular marker for rapid gene typing and identification, which is applied to rice molecular breeding. This locus has high phenotypic selection efficiency and can quickly and accurately detect the rice leaf width gene. In addition, the detection process is simple, efficient, and safe, without aerosol pollution or the use of toxic substances such as ethidium bromide. Molecular marker-assisted selection can be carried out in the early stages of breeding, improving breeding efficiency and accelerating the breeding process of wide-leaf rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This is the phenotype diagram of materials with different leaf widths, where a is a wide-leaf variety and b is a narrow-leaf variety. The scale bar is 1 cm. Figure 2 It is the linkage map of genome-wide marker QTLs in the mapping population; Figure 3 This is a primer amplification diagram with different typing effects, where a, b, and c are primers with poor typing, and d is a primer with good typing; Figure 4 is an alignment diagram of the sequencing results of the OsLwid9.13 site and the reference sequence; Figure 5 is the genotyping diagram of the segregating population. DETAILED DESCRIPTION
[0015] The following is a detailed description of the specific embodiments of the present invention in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.
[0016] Example 1 Identification of leaf width phenotypes of different rice materials and preparation of gene mapping populations In order to obtain rice materials with different leaf widths, 16 rice variety materials were first planted in the field. Each variety was repeated in 3 plots, and 8 rows were planted in each plot. Conventional cultivation and management were carried out at the field test base. The leaf width of the 16 rice variety materials was measured, and the measurement method was as follows: after the plants matured, 15 plants of each variety were selected for measurement. In order to reduce the measurement error, 5 leaves were selected from each plant for measurement each time. The leaf width was repeated 3 times, and the average value was taken as the leaf width of the plant. The judgment threshold of leaf width is: less than 15 mm (excluding 15 mm) is narrow leaves, 15-20 mm is medium width, and greater than 20 mm (excluding 20 mm) is wide leaves. The leaf width measurement results of the 16 test materials are shown in Table 1. Among them, the variety with the widest leaves is Zhongzao 39, and the variety with the narrowest leaves is Xu 444, see Figure 1 .
[0017] Table 1 Leaf width data of 16 tested rice varieties
[0018] To prepare a gene mapping population, Zhongzao 39 was used as the male parent and Xu 444 as the female parent. A hybrid population of 351 individual plants was obtained. Continuous self-pollination to the F2 generation yielded an F2 generation mapping population. Planting and hybridization were carried out at a field trial base, using conventional cultivation and management.
[0019] Example 2 Linked gene loci mapping and molecular marker development and optimization To identify a gene locus linked to rice leaf width, the F2 generation mapping population from Example 1 was planted in the field and its leaf width was measured. Field planting was conducted at a field trial base, and the leaf width measurement method was similar to that in Example 1. Using map-based cloning, DNA was first extracted and genotyped from 351 individual plants. The DNA extraction and genotyping methods were as follows: 1) DNA extraction: Genomic DNA was extracted from rice leaves using the conventional CTAB method; 2) KASP reaction test uses Douglas Scientific's ArrayTape platform The 1.6 μL PCR ArrayTape platform detection reaction system includes: 0.8 μL of genomic DNA 50 ng / μL, 0.03 μL of primer mixture (preferred primer mixture ratio: forward primer Primer X, Primer Y 100 pmol·L -1 12 μL each, reverse primer Primer R 100 pmol·L -130 μL, ddH2O 46 μL (other reasonable primer mixture ratios can also achieve the same detection purpose), LGC 2× KASP Mix (Std Rox) 0.8 μL, according to the ArrayTape platform instrument operation manual, prepare the sample table, run the program, and read the data.
[0020] Among them, 2×KASP Mix consists of fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, as well as high-fidelity Taq enzyme, dNTP, Mg 2+ The nucleotide sequence of fluorescent probe A is 5'-GAAGGTCGGAGTCAACGGATT-3', with a VIC fluorescent group attached to its 5' end; the nucleotide sequence of fluorescent probe B is 5'-GAAGGTGACCAAGTTCATGCT-3', with a FAM fluorescent group attached to its 5' end; the nucleotide sequence of quencher probe A is 5'-AATCCGTTGACTCCGACCTTC-3', with a quencher BHQ attached to its 3' end; the nucleotide sequence of quencher probe B is 5'-AGCATGAACTTGGTCACCTTC-3', with a quencher BHQ attached to its 3' end. The amplification procedure was as follows: 1 cycle of initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 20 s and annealing at 55-62°C (preferably 55°C) for 60 s.
[0021] The above reaction system is the preferred reaction system for Douglas Scientific's ArrayTape platform. Other reasonable reaction systems can also achieve the same detection purpose.
[0022] Note: The above are recommended detection methods. Other detection methods that can achieve the same detection purpose can also be applied to the molecular marker-assisted breeding process of the above markers.
[0023] The leaf width phenotype was measured and found that among the 351 F2 population plants, 51 plants were wide-leaved, 227 plants were medium-wide, and 73 plants were narrow-leaved. The Kolmogorov-Smirnov test showed that the phenotypic data were in line with the normal distribution. The Windows QTLcartographer was used to locate the phenotypic values and genotypes of leaf width. The composite interval mapping method was used for genome-wide scanning, with the window size set to 10 cM. Model 6 (the standard model) was selected for forward and reverse regression operations. P = 0.05 level, the LOD value threshold of the locus controlling leaf width trait was determined to be 0.181 ( Figure 2Four loci, OsLwid4.19, OsLwid5.08, OsLwid5.57, and OsLwid9.13, were identified. These loci demonstrate high genetic linkage with rice leaf width genes and are therefore suitable for detecting rice leaf width genes. Phenotypic contribution analysis of these four loci revealed that OsLwid9.13 had a high phenotypic contribution, indicating that it is the main locus controlling rice leaf width.
[0024] To better apply the gene locus OsLwid9.13 in rice leaf width breeding, the molecular marker of this locus was optimized. The method is as follows: the flanking sequence of the OsLwid9.13 gene locus was downloaded from the NCBI database (Reference genome GCF_034140825.1), and primers were designed using Primer6.0 software and detected using the Douglas platform. Figure 3 As can be seen, although the primers in Figure a can type products, the amplification efficiency of the primers varies between different samples; the primers in Figure b do not have typing ability; and although the primers in Figure c can type products, due to insufficient primer specificity, the typing results are incorrect and mostly concentrated in heterozygous sites. The primers in Figure d are well-typed, with consistent amplification efficiency across different samples and strong primer specificity, resulting in accurate typing results and suitable for subsequent genetic testing. The SNP marker primers for detecting the rice leaf width gene locus OsLwid9.13 are shown in SEQ ID No. 2 to SEQ ID No. 4.
[0025] To confirm the specificity of the nucleic acid composition, the PCR amplification products were cloned and sequenced, and the cloning sequencing was commissioned to Sangon Biotech (Shanghai) Co., Ltd. The sequencing results were compared with the rice reference genome (Reference genome GCF_034140825.1). Figure 4 ) showed that the amplification product of the two primer-probe combination was indeed a fragment of the rice locus OsLwid9.13, which was in line with expectations.
[0026] Example 3 Application of SNP markers linked to the rice leaf width gene locus OsLwid9.13 in marker-assisted selection of broad-leaved rice plants To test the utility of the OsLwid9.13 locus of the present invention, an F1 population was obtained by crossing the wide-leafed Zaoxiandang with the narrow-leafed Suxiangjing 3. Natural self-pollination of the F1 population generated 116 F2 segregating plants. SNP marker detection and leaf width measurement were performed on the segregating population, as described in Example 1. Leaf width phenotypic data were compared with genotypic data (Table 2, Figure 5) were analyzed for consistency. A total of 31 plants with the CC genotype at the OsLwid9.13 locus were found, of which 27 showed wide-leafed individual plants by leaf width measurement, with a screening efficiency of 87.10%. These results demonstrate that screening individual plants for leaf width using the OsLwid9.13 locus is highly efficient and stable, and also demonstrates the high practicality of the OsLwid9.13 locus in screening rice plants for leaf width.
[0027] Table 2 Leaf width phenotypic data and genotypic information of the population
[0028] Note: * indicates no detection signal.
[0029] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.
[0030] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.
[0031] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.
Claims
1. A molecular marker for controlling rice leaf width, characterized in that: It is the gene site OsLwid9.13 located at the 101st nucleotide of SEQ ID No. 1, the nucleotide type is T or C, and when its genotype is CC, the rice has broad leaves or the candidate has broad leaves.
2. A primer for detecting the molecular marker according to claim 1, characterized in that The single-stranded DNA comprises a single-stranded DNA having a nucleotide sequence of SEQ ID No. 2 at positions 22 to 42, a single-stranded DNA having a nucleotide sequence of SEQ ID No. 3 at positions 22 to 42, and a single-stranded DNA having a nucleotide sequence of SEQ ID No.
4.
3. Use of the primers according to claim 2 in detecting the molecular markers according to claim 1.
4. A PCR reagent or kit comprising the primers according to claim 2.
5. Use of the PCR reagent or kit according to claim 4 in detecting the molecular marker according to claim 1.