KASP molecular marker for soybean hundred-grain weight character and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker for a soybean hundred-grain weight character and application of the KASP molecular marker, and belongs to the technical field of soybean agronomic character molecular marker development and molecular marker assisted breeding. The KASP molecular marker for the soybean hundred-grain weight character is located at the 7354533bp position of the No.6 chromosome of a soybean genome Wm82. A2. V1, and the genotype of the KASP molecular marker is A or T. The invention provides a novel and simple molecular marker and an auxiliary selection method through the obtained KASP marker for regulating the hundred-grain weight character gene of the soybean, and is suitable for rapid screening of the relative height of the hundred-grain weight of the soybean and molecular marker auxiliary breeding. The molecular marker can detect genotypes of materials with different hundred-grain weights in natural populations, can also be used for molecular-assisted selective breeding of soybean materials with different hundred-grain weights, replaces large-scale phenotypic screening, reduces field workload, and greatly improves screening accuracy and efficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of soybean agronomic trait molecular marker development and molecular marker-assisted breeding, and more particularly to a KASP molecular marker for soybean 100-grain weight trait and application thereof. Background Art

[0002] As an important economic grain and oil crop in my country, soybeans are highly sought after worldwide for their rich nutritional value and extensive medicinal applications. Soybeans not only contain essential nutrients such as isoflavones, high-quality protein, multiple essential amino acids, and unsaturated fatty acids, but are also rich in a variety of bioactive compounds, including isoflavones, peptides, phospholipids, oligosaccharides, and saponins. Modern medical research has confirmed that these active ingredients possess significant anti-tumor, lipid-lowering, and cardiovascular disease prevention benefits, demonstrating their enormous potential for development in functional foods and pharmaceuticals. Notably, as early as ancient times, wild soybeans were documented in medical texts such as the Compendium of Materia Medica as a precious medicinal herb used to treat a variety of diseases, demonstrating their long history of medicinal use. As the world's most important dual-purpose grain and oil crop, increasing soybean yield is directly linked to national food security and economic benefits. However, soybean yield traits are genetically complex, controlled by multiple quantitative trait loci (QTLs). Traditional breeding methods suffer from inherent drawbacks such as long breeding cycles, low efficiency, and limited yield gains. With breakthroughs in molecular biology technologies, particularly high-throughput sequencing and gene editing, fine-tuning gene regulation has provided a new approach for the precise aggregation and efficient utilization of superior alleles. This technological breakthrough is considered a key technology for developing breakthrough soybean varieties and a necessary step for improving soybean breeding capabilities in the future. To achieve this goal, systematic efforts must be made to identify and accumulate superior alleles, accompanied by the development of high-precision molecular markers. These foundational efforts are prerequisites for fine-tuning gene regulation and multi-gene aggregation. Specifically, these efforts require the establishment of a comprehensive genotype-phenotype association database using techniques such as genome-wide association studies (GWAS) and transcriptomics; the development of a high-density SNP marker system covering the entire genome; and the construction of a novel breeding system that combines marker-assisted selection (MAS) and genomic selection (GS). Through these systematic efforts, the shift from empirical breeding to precision breeding will be achieved, providing strong scientific and technological support for the high-quality development of my country's soybean industry.

[0003] Soybean 100-grain weight is not only a key factor affecting yield but also an important morphological quality trait (Liang et al., 2005). As a typical domestication trait, 100-grain weight has undergone significant changes during the evolution of wild soybeans to cultivated soybeans. Genetic analysis of this trait not only helps to reveal the domestication history and genetic diversity of soybeans but also provides an important basis for the breeding of high-yield, high-quality soybean varieties. Currently, the Soybase database contains over 297 quantitative trait loci (QTLs) for 100-grain weight. These QTLs are derived from 47 different hybrid combinations and are widely distributed across 20 soybean chromosomes, indicating that 100-grain weight is a complex trait regulated by multiple genes. Chen et al. (2016) identified five stable 100-grain weight QTLs on chromosomes 2, 6, 8, and 17 through linkage analysis. They further analyzed the allelic variation of these QTLs in soybean landraces and developed varieties, providing important theoretical support for the study of genetic diversity in soybean germplasm resources.

[0004] In 2014, China's total soybean production reached 11.7 million tons. However, facing the demands of a large population and economic development, further increasing soybean yield per unit area remains a core goal of soybean breeding. Using marker-assisted selection (MAS) and genomic selection (GS) techniques to precisely locate QTLs for 100-grain weight can significantly improve breeding efficiency and accelerate the development of high-yield soybean varieties. Furthermore, further exploration of the regulatory genes for 100-grain weight will not only help to elucidate the molecular mechanisms of soybean seed development but also provide new insights into the genetic regulatory networks underlying soybean yield traits. Therefore, soybean 100-grain weight is not only an important breeding target but also an ideal entry point for studying soybean domestication, genetic evolution, and molecular regulatory mechanisms. In the future, further elucidation of the genetic basis of 100-grain weight, combined with multi-omics analysis and gene editing technologies, will provide important scientific evidence for molecular design breeding and the development of breakthrough varieties.

[0005] Therefore, providing a KASP molecular marker for soybean 100-grain weight trait and its use is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a KASP molecular marker for soybean 100-grain weight trait and its use.

[0007] The molecular marker obtained by the present invention is a molecular marker closely linked to the soybean 100-grain weight trait and can be used for screening soybean materials with different 100-grain weights and assisted selection breeding of their progeny.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] In order to achieve the screening function, the present invention provides a KASP molecular marker for locating the soybean 100-grain weight trait gene based on BSA mixed pool sequencing for identifying different soybean 100-grain weights. The molecular marker is a SNP mutation marker located at 7354533bp on chromosome 6 of the soybean genome Wm82.a2.v1, and the sequence of the 50bp before and after is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0010] The KASP molecular marker genotype is A or T; the sequence of 50 bp before and after the A genotype is shown in SEQ ID NO.1, and the corresponding phenotype is high 100-kernel heavy; the sequence of 50 bp before and after the T genotype is shown in SEQ ID NO.2, and the corresponding phenotype is low 100-kernel heavy.

[0011] CCGGAACCGTCGCTAACGTTACGCTCCGTCAACCTTCTACTACTCC CGGC A CAACCGTTACTTTTCACGGCCGTTTCGATATCCTTTCTGTTTCCG CCACC; SEQ ID NO.1.

[0012] CCGGAACCGTCGCTAACGTTACGCTCCGTCAACCTTCTACTACTCC CGGC T CAACCGTTACTTTTCACGGCCGTTTCGATATCCTTTCTGTTTCCG CCACC; SEQ ID NO.2.

[0013] In addition, the present invention also provides a KASP molecular marker primer combination for identifying the soybean 100-grain weight trait, and the primer sequences are as follows:

[0014] Forward primer F-FAM:

[0015] 5'-GAAGGTGACCAAGTTCATGCT GCCGTGAAAAGTAACGGTTGT -3';SEQ ID NO.3;

[0016] Forward primer F-HEX:

[0017] 5'-GAAGGTCGGAGTCAACGGATT GCCGTGAAAAGTAACGGTTGA -3';SEQ ID NO.4;

[0018] Reverse primer R:

[0019] 5'-GTTACGCTCCGTCAACCTTCT-3'; SEQ ID NO. 5.

[0020] The present invention also provides a use of a KASP molecular marker for the soybean 100-grain weight trait, which is used for molecular-assisted selection breeding of soybean materials with different 100-grain weights or their progenies.

[0021] Specifically, the KASP molecular marker or the KASP molecular marker primer combination is used in identifying or assisting in identifying the soybean 100-grain weight trait.

[0022] The present invention also provides a method for developing a KASP molecular marker for the soybean 100-grain weight trait, comprising the following steps:

[0023] (1) The soybean material Qihuang 34 with high 100-grain weight and the soybean material Dongsheng 16 with low 100-grain weight were hybridized and then self-fertilized to obtain F 2:5 Recombinant inbred lines (RIL);

[0024] (2) The DNA of the recombinant inbred line population was extracted using the CTAB (hexadecyl trimethyl ammoniumbromide) method; a genetic map was constructed using the SLAF tag.

[0025] (3) The population was planted in Minzhu Town, northeastern Daowai District, Harbin City, Heilongjiang Province (longitude 126.78934°(N), latitude 45.85749°(E)) from May 2023 to October 2023, and in Hainan Experimental Base, Yazhou District, Sanya (latitude 18.359129°(N), longitude 109.167372°(E)) from October 2023 to May 2024. 100-grain weight data were collected after harvest, and QTL analysis was performed using the QTL Icimapping V4.2 software developed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0026] (4) Identify SNP variants and InDel insertion / deletion variants that are closely linked to soybean 100-grain weight trait;

[0027] (5) Using the parental SNP loci information and the screened SNP loci to design primers, the molecular markers for soybean 100-grain weight were screened using the KASP (competitive allele-specific polymerase chain reaction) method;

[0028] (6) A KASP molecular marker tightly linked to the soybean 100-grain weight trait was developed.

[0029] The specific method of using the above molecular markers to identify different soybean materials is:

[0030] (1) Polymorphism analysis of molecular markers in high 100-grain weight material Qihuang 34 and low 100-grain weight material Dongsheng 16 and their progeny populations:

[0031] The KASP molecular marker was designed and developed to detect genotype polymorphisms in different 100-grain weight parental materials and their progeny. The KASP molecular marker primer combination consists of forward primers F-HEX and F-FAM, and reverse primer R. Note: Primers (molecular markers) were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and amplified on an ABI Step One PCR instrument.

[0032] The PCR reaction system was: 30-50 ng / μl soybean genomic DNA 5.0 μl, KASP MasterMix 5.0 μl, KASPAssayMix (F-HEX:F-FAM:R=2:2:5 molar concentration ratio, primer concentrations were all 10 ng / μl) 0.14 μl, and the total volume was 10.14 μl.

[0033] The PCR program was as follows: 30°C, 1 minute (fluorescence signal reading); 94°C, 15 minutes (pre-denaturation); 94°C, 20 seconds (denaturation); 10 cycles of annealing at 61°C (-0.6°C / cycle) for 60 seconds; 94°C, 20 seconds (denaturation); 31-35 cycles of annealing at 55°C for 60 seconds; 30°C, 1 minute (fluorescence signal reading).

[0034] After amplification, the fluorescence signal is detected and the genotyping results are analyzed. If the genotyping is insufficient, the amplification can be continued, and the fluorescence signal can be read every three cycles to check the genotyping results until the genotyping is complete.

[0035] Genotyping results are as follows Figure 1 As shown in the figure, the molecular marker can clearly differentiate soybean materials with different 100-grain weights. The materials with high 100-grain weight in the population (including the parent Qihuang 34) have an average grain weight of 25.36 g and are homozygous AA genotypes, which are shown in red in the figure; the materials with low 100-grain weight in the population (including the parent Dongsheng 16) have an average grain weight of 24.34 g and are homozygous TT genotypes, which are shown in blue in the figure. The heterozygous materials are green and have an AT genotype.

[0036] (2) The above molecular markers can be used to carry out molecular-assisted selection breeding for soybean high 100-grain weight traits:

[0037] The KASP molecular marker, designed and developed to be tightly linked to the high 100-grain weight trait, can be used for preliminary screening of soybean varieties with high 100-grain weight, enabling molecular marker-assisted breeding and accelerating the breeding process. In production, this molecular marker can also be used to detect plants with high 100-grain weight at the seedling stage, thereby improving soybean photosynthetic efficiency, promoting dry matter accumulation, and ultimately increasing soybean yield per unit area.

[0038] A method for identifying the soybean 100-grain weight trait comprises the following steps:

[0039] (1) extracting genomic DNA of soybean samples to be tested; using the KASP molecular marker primer combination to perform PCR amplification on the genomic DNA of the soybean samples on an ABI Stepone PCR instrument; detecting the fluorescence signal using the ABI Stepone PCR instrument, and analyzing the genotyping;

[0040] (2) Judge based on genotyping results: when the typing results of the sample are consistent with the genotype AA of the high 100-grain weight soybean material, the identified soybean sample exhibits the high 100-grain weight trait; when the typing results of the sample are consistent with the genotype TT of the low 100-grain weight material, the identified soybean sample exhibits the low 100-grain weight trait.

[0041] As can be seen from the above technical solutions, compared with the prior art, the present invention provides a KASP molecular marker for the soybean 100-grain weight trait and its use. The obtained KASP marker, which regulates the soybean 100-grain weight trait gene, provides a novel and simple molecular marker and assisted selection method suitable for rapid screening of soybean 100-grain weight and molecular marker-assisted breeding. This molecular marker can detect the genotypes of materials with different 100-grain weight in natural populations and can also be used for molecular-assisted selection breeding of soybean materials with different 100-grain weights, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0043] Figure 1 The molecular marker genotyping diagram and phenotypic correlation verification results of the parental materials Qihuang 34 and Dongsheng 16 of the present invention and their progeny;

[0044] Figure 2 These are the molecular marker genotyping diagrams and phenotypic association verification results of different 100-grain soybean natural population materials of the present invention. DETAILED DESCRIPTION

[0045] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0046] Example 1 Mapping of the major QTL for soybean 100-grain weight

[0047] Qihuang 34 and Dongsheng 16 were used as parents, which have significant differences in 100-grain weight. The above parents were crossed and then self-pollinated to construct a recombinant inbred line population F. 2:5 , planted in Harbin and Sanya, and 100-grain weight analysis was performed after harvest.

[0048] The genomic DNA of RIL seedlings was extracted by CTAB method, and QTL analysis was performed. A QTL related to 100-grain weight was located in the interval 6958449-7672612 on chromosome 6.

[0049] Example 2 Development and validation of KASP molecular markers for soybean 100-grain weight

[0050] According to the gene mapping results in Example 1, the SNP and InDel mutations in the chromosome 6 region of the parental materials were extracted and analyzed, and molecular markers were developed using KASP technology for fine positioning.

[0051] The details are as follows:

[0052] (1) DNA extraction

[0053] The genomic DNA of the parents and RIL populations were extracted using the CTAB method.

[0054] (2) PCR amplification

[0055] The PCR reaction system was: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP MasterMix, and 0.14 μl of KASPAssayMix (primer concentrations were all 10 ng / μl and satisfied the molar concentration ratio of F-HEX:F-FAM:R=2:2:5), with a total volume of 10.14 μl.

[0056] The PCR program was as follows: 30°C, 1 minute (fluorescence signal reading); 94°C, 15 minutes (pre-denaturation); 94°C, 20 seconds (denaturation); 10 cycles of annealing at 61°C (-0.6°C / cycle) for 60 seconds; 94°C, 20 seconds (denaturation); 31-35 cycles of annealing at 55°C for 60 seconds; 30°C, 1 minute (fluorescence signal reading).

[0057] PCR amplification was performed on an ABI Step One PCR instrument. Genotyping results were obtained directly after the instrument detected the fluorescence signal. Figure 1 and Table 1, wherein the genotype of Qihuang 34 is AA, shown in red; the genotype of Dongsheng 16 is TT, shown in blue; the black cross represents the negative control with no fluorescent signal.

[0058] The forward primers F-HEX and F-FAM are each equipped with a fluorescent linker (displayed in different colors on the typing diagram, for example, red for the AA genotype, blue for the TT genotype, and green for the AT genotype). If the material being tested is a homozygous genotype, only one of the corresponding primers will be selected for amplification during amplification. The results are displayed by fluorescence difference, making it possible to distinguish whether the material being tested is a homozygous AA genotype or a TT genotype. If the material being tested is a heterozygous genotype, both primers will amplify, generating a third fluorescent signal, thereby distinguishing the heterozygous genotype.

[0059] Through molecular marker screening, we finally obtained the KASP molecular marker that is closely linked to the soybean 100-grain weight trait. The sequence of the molecular marker primer combination is as follows:

[0060] Forward primer F-FAM:

[0061] 5'-GAAGGTGACCAAGTTCATGCT GCCGTGAAAAGTAACGGTTGT -3';SEQ ID NO.3;

[0062] Forward primer F-HEX:

[0063] 5'-GAAGGTCGGAGTCAACGGATT GCCGTGAAAAGTAACGGTTGA -3';SEQ ID NO.4;

[0064] Reverse primer R:

[0065] 5'-GTTACGCTCCGTCAACCTTCT-3'; SEQ ID NO. 5.

[0066] The SNP marker is located at 7354533bp on soybean chromosome 6. The molecular marker is a SNP mutation marker, divided into A genotype and T genotype. The 50bp sequence before and after the molecular marker site is:

[0067] CCGGAACCGTCGCTAACGTTACGCTCCGTCAACCTTCTACTACTCC CGGC A CAACCGTTACTTTTCACGGCCGTTTCGATATCCTTTCTGTTTCCG CCACC; SEQ ID NO.1.

[0068] or

[0069] CCGGAACCGTCGCTAACGTTACGCTCCGTCAACCTTCTACTACTCCCGGC T CAACCGTTACTTTTCACGGCCGTTTCGATATCCTTTCTGTTTTCCGCCACC; SEQ ID NO.2.

[0070] according to Figure 1 As shown in the figure, the materials with high 100-grain weight in the population (including the parent Qihuang 34) have an average grain weight of 25.36 g, which is a homozygous AA genotype and is shown in red in the figure; the materials with low 100-grain weight in the population (including the parent Dongsheng 16) have an average grain weight of 24.34 g, which is a homozygous TT genotype and is shown in blue in the figure; the heterozygous materials are green and have an AT genotype.

[0071] Table 1 RIL population genotyping and 100-grain weight data

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079] The 100-grain weight of soybean germplasm in the natural population was measured with reference to Example 1, and detection was performed according to the method described in Example 2 and the developed molecular markers. The results of the natural population are shown in Table 2.

[0080] Table 2 Genotyping and 100-grain weight data of natural population

[0081]

[0082]

[0083]

[0084]

[0085] like Figure 2 (Red indicates the AA genotype consistent with the high 100-grain weight material Qihuang 34; blue indicates the TT genotype consistent with the low 100-grain weight material Dongsheng 16; the black cross indicates the negative control with no fluorescent signal) and as shown in Table 2, the results of 100-grain weight and molecular marker identification of 117 natural soybean germplasm materials are as follows:

[0086] According to theoretical speculation, soybeans with the AA genotype should have high 100-grain weight, while soybeans with the TT genotype should have low 100-grain weight. This theoretical result is generally consistent with the measured 100-grain weight results. Molecular markers can detect different genotypes of materials with different 100-grain weights in natural populations, further confirming that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with different 100-grain weights.

[0087] like Figure 2 Analysis of the data in Table 2 shows that the 100-kernel weight of soybeans with the homozygous AA genotype (21.33 g) is significantly higher than that of soybeans with the TT genotype (17.71 g). Therefore, the molecular markers of the present invention are mainly used for the initial screening of soybean varieties with high 100-kernel weight, so as to achieve the purpose of molecular marker-assisted breeding.

[0088] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A KASP molecular marker for soybean 100-grain weight trait, characterized in that: The KASP molecular marker genotype is A or T, and is located at 7354533 bp on chromosome 6 of the soybean genome Wm82.a2.v1.

2. The KASP molecular marker for soybean 100-grain weight trait according to claim 1, characterized in that: When the KASP molecular marker genotype is A, the sequence of 50 bp before and after is shown as SEQ ID NO.1, and the corresponding phenotype is high 100-kernel heavy; when the KASP molecular marker genotype is T, the sequence of 50 bp before and after is shown as SEQ ID NO.2, and the corresponding phenotype is low 100-kernel heavy.

3. The KASP molecular marker primer combination for identifying soybean 100-grain weight trait is characterized by: The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTGCCGTGAAAAGTAACGGTTGT-3'; SEQ ID NO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTGCCGTGAAAAGTAACGGTTGA-3'; SEQ ID NO.4; Reverse primer R: 5'-GTTACGCTCCGTCAACCTTCT-3'; SEQ ID NO.

5.

4. Use of the KASP molecular marker according to any one of claims 1 to 2 or the KASP molecular marker primer combination according to claim 3 in identifying or assisting in identifying the soybean 100-grain weight trait.

5. A method for identifying soybean 100-grain weight, characterized in that: The following steps are involved: (1) extracting genomic DNA of the soybean sample to be tested; using the KASP molecular marker primer combination described in claim 3 to perform PCR amplification on the genomic DNA of the soybean sample on an ABI Stepone PCR instrument; detecting the fluorescence signal using the ABI Stepone PCR instrument, and analyzing the genotyping; (2) Judge based on genotyping results: when the typing results of the sample are consistent with the genotype AA of the high 100-grain weight soybean material, the identified soybean sample exhibits the high 100-grain weight trait; when the typing results of the sample are consistent with the genotype TT of the low 100-grain weight material, the identified soybean sample exhibits the low 100-grain weight trait.

Images