Indel molecular marker closely linked with hedychium coronarium piebald color and primer and application of Indel molecular marker

By developing Indel molecular markers and primers that are closely linked to the color of ginger flower spots, and using BSA-seq and Indel-PCR methods, the problems of long breeding time and high cost in existing technologies were solved, and early selection and genetic improvement of ginger flower color were achieved.

CN120666109AActive Publication Date: 2025-09-19SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511157836.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-09-19
Estimated Expiration
2045-08-19

AI Technical Summary

Technical Problem

In the existing technology, there is no Indel molecular marker used for variegated color-assisted selection breeding of ginger flower, which leads to long breeding time and high cost.

Method used

Indel molecular markers and primers closely linked to the piebald color of ginger flower were developed, the CHR04-49592150-Indel site was mined and verified using BSA-seq technology, and the Indel-PCR method was combined for early selection of piebald color.

Benefits of technology

It greatly shortens the breeding time, saves manpower and planting costs, and realizes the early selection and genetic improvement of ginger flower color traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120666109A_ABST
    Figure CN120666109A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an Indel molecular marker closely linked with a hedychium coronarium mottle color, and a primer and application thereof. The Indel molecular marker is developed mainly through a BSA-seq technology, and it is found that deletion of seven basic groups exists at the 49592150 bp position on the hedychium coronarium chromosome 4. Based on upstream and downstream sequences of the site, a corresponding primer pair is developed, and the primer pair can be used for identifying hedychium coronarium plants with dark mottles and light mottles. Specific bands can be obtained through PCR (Polymerase Chain Reaction) amplification, and the sizes of the specific bands are 221 bp and 228 bp respectively; in the hedychium coronarium plants with light-color mottled spots, only 228 bp bands can be obtained through amplification. The Indel molecular marker developed by the invention can assist in identifying the shade of the piebald color of the hedychium coronarium petals, and has a wide application prospect in the aspects of early selection and genetic improvement of the hedychium coronarium flower color.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an Indel molecular marker tightly linked to the piebald color of ginger flowers, a primer thereof, and an application thereof. Background Art

[0002] Gingerflower Hedychium ) is a perennial herbaceous plant in the Zingiberaceae family. BSA-seq analysis is an important method for developing molecular marker-assisted breeding. Currently, molecular markers developed for ginger flowers include SSR, SRAP, and RAPD. However, these markers are very limited, making it difficult to locate QTLs for important traits, identify relevant loci, or develop molecular markers.

[0003] In the prior art, SRAP markers were used to construct the first genetic map of ginger flower (Gao Lixia, Liu Nian, Huang Banghai. Construction of SRAP molecular marker linkage map of ginger flower [J]. Yunnan Plant Research, 2009, 31 (04): 317-325), and SSR molecular markers were used for genetic analysis of flower color of the hybrid F1 generation of 'White Ginger Flower' and 'Golden Ginger Flower' (Zhou Yiwei, Xu Guoyu, Wang Qin, Yan Fulong, Yu Yunyi, Yu Rangcai, Fan Yanping. Genetic analysis of flower color of the hybrid F1 generation of 'White Ginger Flower' × 'Golden Ginger Flower' and development of related SSR molecular markers [J]. Acta Horticulturae Sinica, 2021, 48 (10): 1921-1933.). At present, there is no report on the development of Indel molecular marker technology and its application in assisted selection breeding of ginger flower variegation.

[0004] Based on this, we proposed an Indel molecular marker closely linked to the color of ginger flower spots, its primers and applications, hoping to solve the shortcomings of the existing technology. Summary of the Invention

[0005] As there are currently no reports on the development of Indel molecular marker technology and its application in variegated color-assisted selection breeding of ginger flowers, the present invention aims to provide an Indel molecular marker tightly linked to the variegated color of ginger flowers, as well as primers and applications thereof. Utilizing this Indel molecular marker, flower color traits can be selected at the seedling stage in large populations of hybrid offspring of different ginger flowers, greatly shortening breeding time and saving manpower and planting costs.

[0006] One of the objectives of the present invention is to provide an Indel molecular marker that is tightly linked to the color of the Zingiber officinale. The Indel molecular marker site is located at the position 49592150 bp on chromosome 4 of Zingiber officinale and is named CHR04-49592150-Indel. The primers for the Indel molecule marker include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; Forward primer sequence SEQ ID NO. 1: TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC; Reverse primer sequence SEQ ID NO. 2: AATAAAGGCTCGGGCTGACC.

[0007] A second object of the present invention is to provide an application of the indel molecular marker in the qualitative breeding of ginger flower piebaldness color, comprising the following steps: (1) Extract genomic DNA from the plant to be tested; (2) Using the genomic DNA of the plant to be tested as a template, PCR amplification was performed using primers labeled with Indel molecules, and the PCR amplification products were detected by fluorescent capillary electrophoresis; (3) Identify the depth of the color of the mottle of the plant to be tested based on the results of the electrophoresis detection strips.

[0008] The total volume of the PCR amplification reaction system was 15 μL, including 2× Taq PCR Master Mix7.5, forward primer (1 μM), 0.2 μL, reverse primer (1 μM), (1.2 μL), M13 sequence-fluorescent tag (1 μM, 1.2 μL), 20 ng-30 ng DNA template of the plant to be tested, supplemented with ddH2O to 15 μL.

[0009] The PCR amplification reaction procedure is as follows: first, pre-denaturation is performed at 94°C for 5 min; then, the first cycle stage is entered, denaturation is performed at 94°C for 30 s, followed by annealing at 58°C for 30 s, and then extension at 72°C for 60 s, and this step is repeated for 30 cycles; then, the second cycle stage is entered, denaturation is performed at 94°C for 30 s, followed by annealing at 53°C for 30 s, and then extension at 72°C for 60 s, and this step is repeated for 13 cycles; finally, a final extension is performed at 72°C for 10 min and then stored at 4°C.

[0010] Furthermore, the PCR amplification products were detected using an ABI 3730 DNA analyzer, and the data were analyzed using GeneMapper 2.2.0 software.

[0011] Furthermore, in step (3), if both 221 bp and 228 bp bands appear in the PCR amplification product, the color of the spotted pattern of the plant to be tested is dark (orange-red or orange-yellow); if only the 228 bp band appears in the amplification product, the color of the spotted pattern of the plant to be tested is light (yellow or light yellow).

[0012] The third object of the present invention is to provide a kit for distinguishing the color depth of ginger flower spots, the kit comprising a forward primer and a reverse primer of the Indel molecule marker.

[0013] Compared with the prior art, the present invention has the following advantages: 1. The present invention uses BSA-seq technology to discover Indel markers that are closely linked to the piebald color in ginger flowers, and uses the Indel-PCR method combined with hybrid offspring from different populations to verify the stability of the association between the CHR04-49592150-Indel site and the depth of the piebald color of ginger flowers. The Indel molecular marker developed by the present invention can assist in identifying the depth of the piebald color of ginger flower petals, and has broad application prospects in the early selection and genetic improvement of ginger flower color.

[0014] 2. This invention combines BSA-seq and Indel molecular marker technologies for the first time to develop molecular markers that are closely linked to the color of ginger flower spots. The developed Indel molecular markers can be used to select flower color traits at the seedling stage in large populations of hybrid offspring of different ginger flowers, greatly shortening breeding time, saving manpower and planting costs, and providing new molecular markers for the directional breeding of ginger flower color.

[0015] 3. The primer pair of the present invention can be used to identify the depth of the color of ginger flower spots. In ginger flower plants with dark spots (orange-red or orange-yellow), 221 bp and 228 bp bands can be amplified by PCR, while in ginger flower plants with light spots (yellow or light yellow), only the 228 bp band can be amplified. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The hybrid offspring used for BSA-seq analysis in the examples (obtained by hybridizing 'Bai Jiang Hua' and 'Jin Jiang Hua' as parents); Figure 2 The results of the Indel molecular marker linkage analysis based on BSA-seq analysis in the examples are shown; Figure 3 The results of partial amplification of light-colored mottled F1 hybrid offspring plants obtained with 'Bai Tai' ginger flower and 'Jin Jiang Hua' as parents for verifying the accuracy of the markers in the examples are shown; Figure 4The results of partial amplification of dark-spotted F1 hybrid offspring plants obtained with 'Bai Tai' ginger flower and 'Jin Jiang Hua' as parents for verifying the accuracy of the markers in the examples are shown. DETAILED DESCRIPTION

[0017] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0018] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0019] The embodiment of the present invention provides an Indel molecular marker closely linked to the piebald color of ginger flower, its primers and applications. The Indel molecular marker site is located at the 49592150 bp position of ginger flower chromosome 4 and is named CHR04-49592150-Indel.

[0020] Forward primer sequence SEQ ID NO. 1: TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC; Reverse primer sequence SEQ ID NO. 2: AATAAAGGCTCGGGCTGACC; The expected product sizes are 221 bp and 228 bp.

[0021] Example 1: An Indel molecular marker tightly linked to the piebald color of ginger flower, its primers, and application, comprising the following steps: S1, obtain the hybrid F1 population of 'Bai Jiang Hua' and 'Jin Jiang Hua'; S2. Extraction of plant genomic DNA and construction of a gene pool with extreme differences in flower mottle color: According to the observation results of the petal color of the hybrid F1 offspring, 20 dark-colored and 20 light-colored spotted plants were selected ( Figure 1 ), genomic DNA was extracted using a kit method, and comparative DNA pools SS (dark piebald DNA pool) and QS (light piebald DNA pool) for dark / light piebald color traits were constructed; S3, BSA-seq analysis: The two parents and the DNA pools SS and QS were sequenced by BSA-seq and compared with the reference genome, which is Zingiber officinale ( Hedychium coronarium) chromosome-level reference genome (total contig length 921.54Mb, contigN50 1.09Mb), identified Indel markers between DNA pools; used ED and ΔIndex methods to determine the positioning interval, and screened Indel molecular markers closely linked to the color of ginger flower spots based on the positioning interval ( Figure 2 ); S4. Verification of Indel Markers: A hybrid F1 population of 'Bai Tai' ginger flower and 'Jin Jiang Hua' was obtained. Thirty representative plants with different flower pattern colors were selected for genomic DNA extraction. Primer 3 was used to design primers based on the sequences flanking the Indel site (designated CHR04-49592150-Indel) located at position 49592150 bp on chromosome 4. Indel-PCR analysis was performed using the newly extracted DNA as a template. The PCR amplification products were analyzed by fluorescence capillary electrophoresis to confirm the availability of the Indel marker.

[0022] In a preferred embodiment of the present invention, in steps S2 and S4, the genomic DNA extraction method includes: collecting young leaves from the parents and the F1 hybrid offspring, extracting genomic DNA using the Rapid Plant Genomic DNA Extraction Kit (DP321) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd., and evaluating the DNA quality using agarose gel electrophoresis and a NanoDrop 2000 spectrophotometer.

[0023] In a preferred embodiment of the present invention, in step S3, the BSA-seq analysis method includes: (1) The extracted DNA samples (40 strains of 'White Ginger Flower', 'Golden Ginger Flower' and their F1 hybrid offspring) were randomly broken into 350 bp fragments by Covaris crusher after passing the test. The library was constructed using TruSeq Library Construction Kit, and the reagents and consumables recommended in the instructions were strictly used. The DNA fragments were repaired at the end, ployA tailed, sequencing adapter added, purified, and PCR amplified to complete the entire library preparation. The constructed library was then run on Illumina HiSeq TM PE150 was used for sequencing.

[0024] (2) Use FASTP software to filter the raw data obtained by sequencing. The filtering criteria are as follows: 1) Filter out reads pairs containing adapter sequences; 2) When the N content in the single-end sequencing read exceeds 10% of the read length ratio, this pair of paired reads needs to be removed; 3) When the number of low-quality (quality value Q≤5) bases in the single-end sequencing read exceeds 50% of the read length ratio, this pair of paired reads needs to be removed. After the above strict filtering of sequencing data, high-quality clean data is obtained. Statistics are collected for the sequencing data of all samples of parents and offspring, including the number of sequencing reads, data output, sequencing error rate, Q 20 , Q 30 , GC content, etc.

[0025] (3) BWA-mem2 software was used to align valid data to the reference genome sequence. Alignment results were sorted and de-redundant using samtools, and variant detection was performed using GATK software to obtain a large amount of variant detection data. Hard filtering was then performed using QD < 2.0 || MQ < 40.0 || FS > 60.0 || QUAL < 30.0 || MQrankSum < -12.5 || ReadPosRankSum < -8.0 -clusterSize 2 -clusterWindowSize 5. After filtering, high-quality SNP and INDEL data were obtained for downstream analysis. Based on the physical location of the variant detection, SNP and INDEL annotation was performed using snpEff software.

[0026] (4) Linkage analysis between piebald color and Indel markers was performed based on the Euclidean distance (ED) algorithm and the ΔIndex index. The results showed that the 5.26 Mb fragment between 43,600,000 bp and 60,660,000 bp on chromosome 4 was located. Figure 2 shown.

[0027] In a preferred embodiment of the present invention, in step S4, the method for verifying the Indel marker includes: (1) According to the BSA-seq analysis results in step S3, based on the sequences on both sides of the Indel marker (CHR04-49592150-Indel) located at the 49592150 bp position on chromosome 4, Primer 3 was used to design primer sequences, and the M13 sequence fragment TGTAAAACGACGGCCAGT was added to the 5' of the forward primer. The final forward primer sequence SEQ ID NO.1 was TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC, and the reverse primer sequence SEQ ID NO.2 was AATAAAGGCTCGGGCTGACC; (2) After the extracted DNA samples (30 F1 hybrid offspring obtained by crossing 'Jin Jiang Hua' as the male parent and 'Bai Tai' ginger flower as the female parent) passed the test, PCR amplification was performed using the above DNA as a template and primer pair (SEQ ID NO.1 and SEQ ID NO.2). The total volume of the PCR amplification system was 15 μL, including 2× Taq PCR Master Mix 7.5, 0.2 μL of forward primer (1 μM), 1.2 μL of reverse primer (1 μM), 1.2 μL of M13 sequence-fluorescent tag (1 μM), 20 ng-30 ng of DNA template from the plant to be tested, and ddH2O added to 15 μL. The PCR amplification reaction procedure was as follows: initial denaturation at 94°C for 5 min; followed by a first cycle of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s, repeated for 30 cycles; a second cycle of denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 60 s, repeated for 13 cycles; and a final extension at 72°C for 10 min before storage at 4°C.

[0028] (3) The PCR amplification products obtained in (2) were detected and analyzed using an ABI 3730 DNA analyzer, and the data were then analyzed using GeneMapper 2.2.0 software. It was found that the band sizes amplified from the 30 plants tested were consistent with the expected fragment sizes, including bands of 221 bp and 228 bp. Among them, 11 plants had a genotype of 228 / 228, and 19 plants had a genotype of 221 / 228. Some representative plant flower color pictures and genotypes are shown below. Figure 3 and Figure 4 As shown. Using Tassel 4.0 software, we performed an association analysis on the genotype data and the piebald color data, and found that the genotype of the Indel site was highly significantly positively correlated with the piebald color data ( p<0.001), further verifying the association between the CHR04-49592150-Indel site and the depth of piebald color.

[0029] In summary, the present invention discovered the Indel markers that are closely linked to the piebald color in ginger flowers through BSA-seq technology, and used the Indel-PCR method combined with the hybrid offspring of different populations to verify the stability of the association between the CHR04-49592150-Indel site and the depth of the piebald color of ginger flowers. This invention has good application potential in molecular marker-assisted selection breeding of ginger flower color traits.

[0030] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An Indel molecular marker tightly linked to the piebald color of ginger flower, characterized in that: The Indel molecular marker site is located at the 49592150 bp position of chromosome 4 of Zingiber officinale and is named CHR04-49592150-Indel; The primers for the Indel molecule marker include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

2. The application of the Indel molecular marker according to claim 1 in the qualitative breeding of Zingiber officinale color, characterized in that: The following steps are involved: (1) Extract genomic DNA from the plant to be tested; (2) Using the genomic DNA of the plant to be tested as a template, PCR amplification was performed using primers labeled with Indel molecules, and the PCR amplification products were detected by fluorescent capillary electrophoresis; (3) Identify the depth of the color of the mottle of the plant to be tested based on the results of the electrophoresis detection strips.

3. The use according to claim 2, characterized in that The total volume of the PCR amplification reaction system was 15 μL, including 2× Taq PCR Master Mix 7.5, forward primer 1 μM, 0.2 μL, reverse primer 1 μM, 1.2 μL, M13 sequence-fluorescent label 1 μM, 1.2 μL, DNA template of the plant to be tested 20 ng-30 ng, supplemented with ddH2O to 15 μL.

4. The use according to claim 2, characterized in that The PCR amplification reaction procedure is as follows: first, pre-denaturation is performed at 94°C for 5 min; then, the first cycle stage is entered, denaturation is performed at 94°C for 30 s, followed by annealing at 58°C for 30 s, and then extension at 72°C for 60 s, and this step is repeated for 30 cycles; then, the second cycle stage is entered, denaturation is performed at 94°C for 30 s, followed by annealing at 53°C for 30 s, and then extension at 72°C for 60 s, and this step is repeated for 13 cycles; finally, a final extension is performed at 72°C for 10 min and then stored at 4°C.

5. The use according to claim 2, characterized in that The PCR amplification products were detected using an ABI 3730 DNA analyzer, and the data were analyzed using GeneMapper 2.2.0 software.

6. The use according to claim 2, characterized in that In step (3), if both 221 bp and 228 bp bands appear in the PCR amplification product, the color of the flower spots of the test plant is orange-red or orange-yellow; if only the 228 bp band appears in the amplification product, the color of the flower spots of the test plant is yellow or light yellow.

7. A kit for distinguishing the color depth of ginger flower spots, characterized in that: The kit comprises a forward primer and a reverse primer for the Indel molecule marker according to claim 1.

Citation Information

Patent Citations

  • Major QTL and SNP molecular marker for controlling Nelumbo nucifera color traits as well as detection primer and application thereof

    CN111979349A

  • Method for identifying authenticity of Hedychium coronarium and Hedychium coronarium interspecific hybridization F1 hybrid by using SSR marker

    CN115044656A