Application of KASP molecular marker in identification of melon downy mildew resistance
Through the use of KASP molecular marker CmPcu9.6, high-density genetic maps and SNP site design, the problems of long cycle and low efficiency in melon downy mildew resistance breeding were solved, and rapid, accurate identification and early screening of melon downy mildew resistance were achieved.
Patent Information
- Application Number
- CN202511182252.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-22
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-08-22
AI Technical Summary
In the existing technology, the breeding of melon downy mildew resistance relies on traditional phenotypic observation, which has the problems of long cycle and low efficiency.
Using the KASP molecular marker CmPcu9.6, a high-density genetic map was constructed to locate the major QTL related to melon downy mildew resistance. Primers based on the polymorphic SNP site at chr09:22824300 were designed for PCR amplification and fluorescence detection, achieving efficient identification of melon downy mildew resistance.
It has achieved rapid and accurate identification of melon downy mildew resistance, reduced manpower and material costs, shortened the breeding cycle, and improved breeding efficiency.
Smart Images

Figure CN120666111A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the field of molecular marker technology, involving melon genetics, molecular marker technology and plant protection, and specifically relates to the application of a KASP molecular marker in identifying melon downy mildew resistance. Background Art
[0002] melon( Cucumis melo L) is Cucurbitaceae ( Cucurbitaceae ) Cucumis ( Cucumis Melon is an annual creeping herb with advantages such as a short cultivation cycle, high market demand, good economic returns, high land utilization rate, and a high multiple cropping index. It is an important horticultural crop in my country. However, during cultivation, melons are highly susceptible to pathogens. For example, melon downy mildew is a major disease in melon production. Infection with melon downy mildew can cause yellowing and withering of crop leaves, and even plant death. Melon downy mildew spreads rapidly and is difficult to control, severely impacting melon yield and quality, thus hindering the sustainable development of the melon industry.
[0003] Downy mildew resistance is an important commercial trait in melons, and understanding its regulatory mechanisms is crucial for variety improvement, market segmentation, and germplasm resource utilization. Currently, breeding for downy mildew resistance in melons relies primarily on traditional phenotypic observations, which suffer from long cycles and low efficiency. Summary of the Invention
[0004] The purpose of this application is to provide an application of the KASP molecular marker in identifying melon downy mildew resistance, aiming to use molecular marker-assisted selection breeding to accurately identify the genotype of melon downy mildew-resistant materials, thereby efficiently screening and cultivating melon varieties with downy mildew resistance.
[0005] To achieve the above-mentioned objectives, the present application provides an application of a KASP molecular marker in identifying melon downy mildew resistance. When the KASP molecular marker is applied to identifying melon downy mildew resistance, the identification method comprises the following steps: extracting genomic DNA of a target melon, performing PCR amplification using the genomic DNA of the target melon as a template, and performing fluorescence detection based on primers of the KASP molecular marker CmPcu9.6 to obtain the genotype of the target melon; judging the traits of the target melon based on the detected genotype; the KASP molecular marker CmPcu9.6 is designed based on the polymorphic SNP site at chr09:22824300.
[0006] In the above scheme, the KASP molecular marker CmPcu9.6 was obtained by constructing a high-density genetic map, locating a major QTL related to melon downy mildew resistance, and searching for SNP sites with polymorphisms between the parents using the Melon (DHL92) v4 Genome as the reference genome.
[0007] As some optional embodiments of the present application, the nucleotide sequence of the SNP site is as shown in SEQ ID NO.1, the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1, and the base of the SNP site is mutated from T to A.
[0008] As some optional embodiments of the present application, the polymorphism of the KASP molecular marker is A or T, the AA genotype is a homozygous disease-resistant type, the TT genotype is a homozygous disease-susceptible type, and the AT genotype is a heterozygous disease-susceptible type.
[0009] As some optional embodiments of the present application, the gene type is obtained based on the following reaction system: Kaspar 2×reaction mix 10 μL, primer F1 and primer F2 with a concentration of 100 μM each 0.02 μL, primer R 0.06 μL and DNA 1 μL.
[0010] As some optional embodiments of the present application, the PCR amplification includes the following steps: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds; Annealing and extension at 65°C-57°C for 45s; 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; Denature at 94°C for 20 seconds; Annealing and extension at 57°C for 60 s were repeated for 30 cycles.
[0011] As some optional embodiments of the present application, the primer pair for the KASP molecular marker CmPcu9.6 includes the allelic primer CmPcu9.6-F1 as shown in SEQ ID NO.2, the allelic primer CmPcu9.6-F2 as shown in SEQ ID NO.3 and the universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0012] As some optional embodiments of the present application, the primer pair of the KASP marker CmPcu9.6 can be used to prepare a kit for identifying KASP molecular markers for melon downy mildew resistance.
[0013] As some optional embodiments of the present application, the primer pair of the KASP marker CmPcu9.6 can be used for breeding melon downy mildew-resistant germplasm.
[0014] In summary, this application has the following advantages: 1. The molecular marker CmPcu9.6, obtained in this application and tightly linked to melon downy mildew resistance, is a KASP molecular marker developed by constructing a highly homozygous RIL population and integrating it with whole-genome sequencing data. This marker is tightly linked to melon downy mildew resistance and is stably inherited. Compared to other molecular markers, it offers advantages such as batch production, automation, and standardization, making it suitable for high-throughput population testing.
[0015] 2. The KASP marker developed in this application, which is tightly linked to the downy mildew resistance trait, provides a highly efficient technical means for genotyping melon germplasm resources. This marker can be rapidly detected using a high-throughput genotyping system, significantly reducing the labor and material costs of traditional identification methods. Furthermore, the detection process is unaffected by environmental factors, ensuring the accuracy and reliability of the identification results. Finally, this technology enables early screening of melon varieties resistant to downy mildew, effectively shortening the breeding cycle and significantly improving breeding efficiency, providing an important molecular marker-assisted selection tool for disease-resistant melon breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The phenotypes of the disease-resistant muskmelon material "PI390452", the susceptible muskmelon material Huangdanzi "HDZ" and the F1 generation plants at different time points after infection with downy mildew are shown in the examples of this application. Figure 1 (a) is the phenotypic diagram of "PI390452" at 0 dpi after downy mildew infection. Figure 1 (b) is the phenotype of "HDZ" at 0 dpi after downy mildew infection. Figure 1 (c) is the phenotype of the F1 generation plants at 0 dpi after infection with downy mildew. Figure 1 (d) is the phenotype of "PI390452" 7dpi after downy mildew infection. Figure 1 (e) in the figure is the phenotype of "HDZ" 7 dpi after downy mildew infection. Figure 1 (f) in the figure is the phenotype of F1 plants 7 dpi after infection with downy mildew. Figure 1 (g) is the phenotype of "PI390452" 15dpi after downy mildew infection. Figure 1 (h) is the phenotype of "HDZ" 15dpi after downy mildew infection. Figure 1 (i) in the figure is the phenotype of F1 plants 15 dpi after downy mildew infection.
[0017] Figure 2Shown is a disease level distribution diagram of the BC population and F2 population of the disease-resistant melon material "PI390452" and the susceptible melon material "HDZ" involved in the examples of the present application after infection with downy mildew.
[0018] Figure 3 Shown are the preliminary mapping results of the melon downy mildew resistance QTL involved in the examples of this application.
[0019] Figure 4 Shown is a map of the melon KASP molecular marker CmPcu9.6 SNP site involved in the examples of the present application, wherein PI390452.bam.Coverage and HDZ.bam.Coverage represent the resequencing data of PI390452 and HDZ, respectively.
[0020] Figure 5 The figure shows the genotyping diagram of the KASP marker CmPcu9.6 in the "PI390452", "HDZ" and RIL populations involved in the examples of this application. Figure 5 (a) is the RIL population DNA sample distribution plate, Figure 5 (b) shows the genotyping results of the RIL population under the KASP marker CmPcu9.6. DETAILED DESCRIPTION
[0021] The principles and features of the present invention are described below in conjunction with the examples. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Where specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.
[0022] Compared to other control methods, the application and promotion of melon varieties containing downy mildew resistance genes is a safer and more effective measure to reduce the damage caused by downy mildew. In recent years, with the development of molecular biology and related molecular marker technologies, molecular marker-assisted breeding has gradually become a new approach to melon disease resistance breeding.
[0023] Early research on molecular markers primarily utilized random amplified polymorphic DNA markers (RAPD), restriction endonuclease fragment length polymorphisms (RFLP), and PCR-based dominant molecular marker system (SRAP) techniques to screen for multiple linkage markers whose genetic distances to resistance genes ranged from 7.85 cM to 9.9 cM. Later studies turned to simple sequence repeat (SSR) markers and combined them with group segregation analysis (BSA) and genetic linkage map analysis, shortening the linkage distance to 3.6 cM. Although markers such as RFLP, RAPD, and SSR have played an important role in genetic mapping, they are usually still some distance away from the target gene, their universality remains to be verified, and their operation is relatively complicated, limiting the direct application of molecular markers in breeding.
[0024] Therefore, developing new molecular markers with stronger specificity, higher accuracy, and faster and more convenient operation is crucial to accelerating the breeding of melon varieties resistant to downy mildew.
[0025] In the first aspect, the present application provides an application of a KASP molecular marker in identifying downy mildew resistance in melons. The KASP (competitive allele-specific PCR) technology, developed based on functional SNP loci, can quickly, economically, and reliably determine SNP genotypes, and plays a significant role in gene mapping, molecular marker-assisted selection, and germplasm identification. Therefore, the KASP marker developed and applied in the present application for identifying downy mildew resistance in melons is of great significance for the efficient screening and breeding of melon varieties with downy mildew resistance. In addition, the present application also relates to primer pairs related to the KASP molecular marker, as well as a kit containing these specific primer pairs. These kits are designed to efficiently identify downy mildew resistance in melons under laboratory conditions. The present application is not limited to providing these molecular markers and kits, but also further describes the specific application methods of these tools in the process of breeding downy mildew-resistant melon germplasm. At the same time, based on the KASP molecular markers, primer pairs and kits provided above, this application also details a method for identifying melon downy mildew resistance. The method includes extracting DNA from melon samples, performing PCR amplification, and performing genotype analysis using KASP technology, thereby achieving accurate identification of melon downy mildew resistance.
[0026] First, the KASP molecular marker used in this application to identify downy mildew resistance in melons was identified as KASP molecular marker CmPcu9.6. This marker was designed based on a single nucleotide polymorphism (SNP) at position 22824300 on chromosome chr09, using the Melon (DHL92) v4 genome as a reference genome, by mapping a major QTL associated with downy mildew resistance in melons. Further analysis revealed that the SNP at position 22824300 within this QTL, chr09:22824300, mutated from thymine (T) to adenine (A). Based on this SNP, a set of KASP molecular markers tightly linked to downy mildew resistance in melons was developed.
[0027] In a specific embodiment, the nucleotide sequence of the SNP site is shown in SEQ ID NO.1. The sequence identifier SEQ ID NO.1 and its corresponding mutation site (base 51 mutated from T to A) are detailed as follows: >chr09:22824300=CCAGCTGCCAAAGACGTACTGTCTTATCAACAGAAGATGACAGCAGAAGC[T / A]GCATAGAACACAAAATAATAATAAAAAAATTAGTGGCAATTGCAAAAATC.
[0028] In the second aspect, the present application provides a primer pair for the KASP molecular marker CmPcu9.6 for identifying melon downy mildew resistance, comprising an allelic primer CmPcu9.6-F1 as shown in SEQ ID NO.2, an allelic primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and a universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0029] (1) The details of the sequence identifier SEQ ID NO.2 are as follows: 5'-GAAGGTGACCAAGTTCATGCTCAACAGAAGATGACAGCAGAAGCA-3'.
[0030] (2) The details of the sequence identifier SEQ ID NO.3 are as follows: 5'-GAAGGTCGGAGTCAACGGATTCAACAGAAGATGACAGCAGAAGCT-3'.
[0031] (3) The details of the sequence identifier SEQ ID NO. 4 are as follows: 5'-CCACTAATTTTTTTTATTATTATTTTGTGTT-3'.
[0032] In the third aspect, the present application provides a kit for identifying the KASP molecular marker CmPcu9.6 for melon downy mildew resistance, comprising the primer pair of the KASP molecular marker CmPcu9.6 as described above, namely, the allelic primer CmPcu9.6-F1 as shown in SEQ ID NO.2, the allelic primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and the universal primer CmPcu9.6-R as shown in SEQ ID NO.4.
[0033] In a fourth aspect, a KASP molecular marker for identifying melon downy mildew resistance in the present application is developed by the following method: (1) A RIL population (F2S6) was constructed using the highly resistant downy mildew material “PI390452” (P1) as the female parent and the highly susceptible downy mildew material “HDZ” (P2) as the male parent (both resistant and susceptible materials were provided by the Biobreeding Laboratory of the Xinjiang Academy of Agricultural Sciences).
[0034] (2) Whole-genome sequencing was performed on 106 individuals in the RIL population using the Illumina platform. A high-density genetic map was constructed based on the whole-genome sequencing data to locate the QTL for downy mildew resistance in melon. Using the Melon (DHL92) v4 Genome as the reference genome, the IGV software (IGV-2.11.9) was used to screen for SNP sites that differed between the parents within the mapping interval. 50 bp of sequence before and after the SNP site was extracted. The SNP site sequences were aligned using the Cucurbitaceae Genome Database Alignment Tool, and KASP primers were designed based on the specific SNP site flanking sequences.
[0035] (3) Two allele-specific upstream primers and one universal downstream primer were designed based on the flanking sequences around the SNP using the online software Primer3Plus; the polymorphic SNP primers were converted into KASP markers.
[0036] In a fifth aspect, the present invention provides a method for identifying melon downy mildew resistance using a KASP molecular marker for identifying melon downy mildew resistance. When the KASP molecular marker is used to identify melon downy mildew resistance, the identification method comprises the following steps: The genomic DNA of the target melon is extracted, PCR amplification is performed using the genomic DNA of the target melon as a template, and fluorescence detection is performed based on primers of the KASP molecular marker CmPcu9.6 to obtain the genotype of the target melon; based on the detected genotype, the traits of the target melon are determined.
[0037] In a specific embodiment, genotyping is determined based on the following reaction system: 10 μL of Kaspar 2× reaction mix, 0.02 μL each of 100 μM primers F1 and F2, 0.06 μL of primer R, and 1 μL of DNA. The Kaspar 2× reaction mix contains 50 mM glucose, 25 mM Tris-HCl (pH 8.0), and 10 mM EDTA (pH 8.0). Tris-HCl is tris(hydroxymethyl)aminomethane hydrochloride, and EDTA is ethylenediaminetetraacetic acid.
[0038] In a specific embodiment, PCR amplification includes the following steps: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds; Annealing and extension at 65°C-57°C for 45s; 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; Denature at 94°C for 20 seconds; Annealing and extension at 57°C for 60 s were repeated for 30 cycles.
[0039] In a specific embodiment, if the detected gene type is AA, it is a homozygous disease-resistant type and is disease-resistant after being infected by downy mildew; If the detected gene type is AT, it will show a heterozygous susceptible type and will show susceptible to disease after downy mildew infection; If the detected gene type is TT, it will show a homozygous susceptible type, and all individual plants will show susceptibleness after being infected by downy mildew.
[0040] In a specific embodiment, the identification of melon downy mildew resistance specifically includes the following steps: (1) Inoculate the parents and RIL population with downy mildew and perform phenotypic identification; (2) Genomic DNA of muskmelon from both parents and the RIL population was extracted, and PCR amplification was performed on the Matrix Cycler and Matrix Scanner of the Gene Matrix™ high-throughput genotyping system (HC Scientific, Chengdu) using the genomic DNA of the target muskmelon as a template and the KASP marker CmPcu9.6 as a primer; (3) Genotype data analysis using Matrix Master software; (4) Determine the properties of the target melon based on the detected base types.
[0041] The KASP marker CmPcu9.6 in this application is polymorphic between the parents and can accurately distinguish the genotypes of the parents and F1 plants; in the RIL population, the KASP marker CmPcu9.6 is co-segregated with downy mildew resistance, which indicates that the KASP marker CmPcu9.6 is closely linked to downy mildew resistance in melon and can be further used to identify whether melon has downy mildew resistance.
[0042] The reagents used in this application are: ultrapure water, Tween 20, Kaspar 2× reaction mix, and the commonly used reagents are domestic analytical grade reagents.
[0043] Instruments used in this application: brush, beaker, filter paper, blood cell counting chamber, L-shaped sprayer, nucleic acid detector, pipette, centrifuge, disposable pipette tip, centrifuge tube, Illumina HiSeqTM PE150 sequencing platform, GeneMatrixTM high-throughput genotyping system.
[0044] The technical solutions described in this application are further described below with reference to specific examples. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.
[0045] Example 1 This example mainly provides further details on the identification of melon downy mildew resistance genes and the development of KASP markers: Step 1. In this study, a hybrid was performed using the highly downy mildew-resistant material PI 390452 (P1) as the female parent and the highly downy mildew-susceptible material "HDZ" (P2) as the male parent (both resistant and susceptible materials were provided by the Biobreeding Laboratory of the Xinjiang Uygur Autonomous Region Academy of Agricultural Sciences). Six generations of genetic populations (P1, P2, F1, F2, BC1P1, and BC1P2) were obtained. These six generations of genetic populations were inoculated with downy mildew and phenotypes were investigated. Resistance was determined based on the disease index of the plants.
[0046] Identification results such as Figure 1 (a) in Figure 1 (b) and Figure 1 As shown in (c), on the 0th day of inoculation, there were no lesions or mechanical damage on the leaf surfaces of the disease-resistant parent "PI390452", the susceptible parent "HDZ" and the F1 generation plants.
[0047] like Figure 1 As shown in (d), 7 days after inoculation, the leaf surface of the disease-resistant parent "PI390452" did not show obvious symptoms, and the disease level was level 0, indicating high resistance to downy mildew. Figure 1As shown in (e), 7 days after inoculation, large yellow spots appeared on the leaf surface of the susceptible parent "HDZ", and the area of downy mildew spots accounted for 75% of the total leaf area. The disease level was level 5, indicating high susceptibility to downy mildew. Figure 1 As shown in (f), 7 days after inoculation, the area of lesions on the leaf surface of the F1 plant accounted for 60% of the total leaf area, and the disease level was level 4, indicating that it was susceptible to downy mildew.
[0048] like Figure 1 As shown in (g), 15 days after inoculation, the leaf surface of the disease-resistant parent "PI390452" still showed no obvious symptoms. Figure 1 As shown in (h), 15 days after inoculation, the lesions on the leaves of the susceptible parent "HDZ" have dried up. Figure 1 As shown in (i), 15 days after inoculation, the F1 plants had the same phenotype as the susceptible parent, with large areas of lesions appearing on the leaf surface, and the lesions had turned yellow and dried up.
[0049] like Figure 2 As shown, in the F2 generation segregating population, the disease levels of all plants were continuously normally distributed between 0 and 5.
[0050] The disease level distribution of BC1P1 offspring plants conforms to the normal distribution.
[0051] The disease level of BC1P2 offspring plants tends to be susceptible, that is, the disease level of BC1P2 is close to that of the father "HDZ", and tends to be closer to the backcross parent (such as Figure 2 shown).
[0052] Based on these data, it can be concluded that the downy mildew resistance trait of melon is controlled by a recessive polygene. This discovery is of great significance for the genetic breeding of melon, as it reveals the genetic mechanism controlling downy mildew resistance in melon and provides a theoretical basis for future breeding work.
[0053] Step 2: To further identify SNP sites closely linked to melon downy mildew resistance, a recombinant inbred line (F2S6) was constructed using the highly resistant material "PI390452" (P1) as the female parent and the highly susceptible material "HDZ" (P2) as the male parent. The RIL population was inoculated with downy mildew and phenotypes were identified. The parental and RIL population samples were sent to Beijing Biomark Biotechnology Co., Ltd. for whole-genome sequencing. A high-density genetic map was constructed based on the whole-genome sequencing data. QTL mapping was performed in combination with the individual phenotypic data of the RIL population, and the main effect QTL for melon downy mildew resistance was finally identified. qDM9.1 Located on chromosome 9 (e.g. Figure 3 shown).
[0054] Step 3: Based on the obtained QTL for melon downy mildew resistance qDM9.1 , KASP molecular markers were further developed within the localization interval region.
[0055] Specifically, the KASP marker CmPcu9.6 was developed based on the SNP site at chr09:22824300 on chromosome 9 (e.g. Figure 4 Three sets of primers were designed in this application, namely CmPcu9.6-F1 (45 base pairs in length), CmPcu9.6-F2 (45 base pairs in length), and CmPcu9.6-R (30 base pairs in length).
[0056] Subsequently, young tissues of the parents, F1 generation plants and RIL population were taken and placed in a 96-well PCR plate. 70 μL of Buffer A (containing the following ingredients: 50 mM glucose, 25 mM Tris-HCl, pH 8.0, 10 mM EDTA, pH 8.0) was added and heated at 99 degrees Celsius for 2 minutes using a PCR instrument.
[0057] After cooling to room temperature, an equal volume of Buffer B (containing 0.2 M NaOH and 1% SDS) was added and centrifuged at 12,000 rpm for 1 min to thoroughly mix Buffer A and Buffer B to obtain an AB mixture.
[0058] The AB mixture was diluted 20 times for KASP labeling detection.
[0059] This application uses the KASP marker CmPcu9.6 for PCR amplification in order to further screen and confirm the target gene.
[0060] Step 4: Genotype "PI390452", "HDZ" and the RIL population containing 106 strains using the KASP marker CmPcu9.6.
[0061] The KASP reaction is performed in a reaction plate. The reaction system includes 10 μL of Kaspar 2× reaction mix, 0.02 μL each of 100 μM primers F1 and F2, 0.06 μL of primer R, and 1 μL of DNA. The Kaspar 2× reaction mix contains Taq DNA polymerase, dNTPs, MgCl2, probes labeled with FAM and HEX / VIC fluorescent reporters, ROX reference dye, and stabilizer.
[0062] The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds; Annealing and extension at 65°C-57°C for 45s; 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; Denature at 94°C for 20 seconds; Annealing and extension at 57°C for 60 s were repeated for 30 cycles.
[0063] Through testing, such as Figure 5 As shown in (a), the KASP marker CmPcu9.6 divides "PI390452", "HDZ" and F1 into three different genotypes, such as Figure 5 As shown in (b), the present application successfully detected three base types in the RIL population.
[0064] Specifically: (1) When the genotype detected in the melon is consistent with the base type of the disease-resistant parent, which is AA, the target melon is resistant to the disease after being infected by downy mildew because it carries the homozygous recessive disease-resistant allele (A). Therefore, the trait of the target melon can be determined to be a homozygous disease-resistant type; (2) When the base type detected in the melon is consistent with the base type of the susceptible parent, which is TT, the target melon is susceptible to the disease after being infected by downy mildew because it carries the homozygous dominant susceptible allele (T). It can be determined that the trait of the target melon is a homozygous susceptible type; (3) When the detected base type is TA, the target melon, after infection with downy mildew, carries a recessive disease-resistant allele (A) and the susceptible allele (T) is dominant in the heterozygote (TA), resulting in a phenotype similar to that of the F1 plant and being susceptible to the disease. Therefore, the target melon can be determined to be a heterozygous susceptible type. NO CALL indicates that the sample has no fluorescent signal and serves as a blank control.
[0065] The genotypes of individual RIL plants were analyzed in conjunction with the phenotypic data from the RIL population. The results showed that plants with the TT genotype (i.e., homozygous susceptible genotypes) all became susceptible to downy mildew infection; plants with the AA genotype (i.e., homozygous resistant genotypes) all became resistant; and plants with the TA genotype (i.e., heterozygous susceptible genotypes) all became susceptible. These results indicate that the KASP marker CmPcu9.6 is linked to downy mildew resistance and can be used to identify downy mildew resistance in melon.
[0066] Figure 5 In the figure, blue triangles represent sample "PI390452," red triangles represent sample "HDZ," blue dots represent homozygous resistant plants, red dots represent homozygous susceptible plants, and green dots represent heterozygous susceptible plants. NO CALL indicates a sample with no fluorescence signal, serving as a blank control.
[0067] Depend on Figure 4 It can be seen that the KASP marker CmPcu9.6 is separated in the RIL population, where the FAM channel corresponds to the "HDZ" genotype, which is TT; the HEX channel corresponds to the "PI390452" genotype, which is AA; and the middle channel corresponds to the heterozygous genotype, which is TA.
[0068] Although the specific embodiments of the present application have been described in detail, this should not be construed as limiting the scope of protection of the present application. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of the present application.
Claims
1. Application of a KASP molecular marker in identifying resistance to downy mildew in melon, characterized in that: When the KASP molecular marker is applied to identify melon downy mildew resistance, the identification method comprises the following steps: Extracting genomic DNA from a target melon, performing PCR amplification using the genomic DNA from the target melon as a template, and performing fluorescence detection based on primers for the KASP molecular marker CmPcu9.6 to obtain the genotype of the target melon; and determining the traits of the target melon based on the detected genotype; The KASP molecular marker CmPcu9.6 was designed based on the polymorphic SNP site at chr09:22824300; The nucleotide sequence of the SNP site is shown in SEQ ID NO.
1. The SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.
1. The base of the SNP site is mutated from T to A.
2. The use according to claim 1, characterized in that The polymorphism of the KASP molecular marker is A or T, the AA genotype is a homozygous disease-resistant type, the TT genotype is a homozygous disease-susceptible type, and the AT genotype is a heterozygous disease-susceptible type.
3. The use according to claim 1, characterized in that The genotype was obtained based on the following reaction system: 10 μL of Kaspar 2×reaction mix, 0.02 μL each of primer F1 and primer F2 at a concentration of 100 μM, 0.06 μL of primer R, and 1 μL of DNA.
4. The use according to claim 1, characterized in that The PCR amplification comprises the following steps: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds; Annealing and extension at 65°C-57°C for 45s; 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; Denature at 94°C for 20 seconds; Annealing and extension at 57°C for 60 s were repeated for 30 cycles.
5. The use according to claim 1, characterized in that The primer pair for the KASP molecular marker CmPcu9.6 includes an allele primer CmPcu9.6-F1 as shown in SEQ ID NO.2, an allele primer CmPcu9.6-F2 as shown in SEQ ID NO.3, and a universal primer CmPcu9.6-R as shown in SEQ ID NO.
4.
6. The use according to claim 1, characterized in that The primer pair of the KASP marker CmPcu9.6 can be used to prepare a kit for identifying KASP molecular markers of melon downy mildew resistance.
7. The use according to claim 1, characterized in that The primer pair of the KASP marker CmPcu9.6 can be used for breeding melon downy mildew-resistant germplasm.
Citation Information
Patent Citations
KASP marker related to downy mildew resistance character of muskmelon and development and application of KASP marker
CN116606949A
Downy mildew resistance in cucurbitaceae plants
US20220275393A1
Cited By
KASP marker related to downy mildew resistance character of muskmelon and development and application of KASP marker
CN116606949A