Antisense RNA (asRNA) technology and application thereof
By introducing deoxyribonucleotide spacers into single-stranded antisense RNA, the gene silencing efficacy is enhanced, solving the problems of insufficient efficacy and poor stability in existing technologies, and achieving a more efficient and safe gene regulation effect.
Patent Information
- Application Number
- CN202380084470.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-08
- Filing Date
- 2023-12-08
- Publication Date
- 2025-09-19
AI Technical Summary
Existing single-stranded antisense RNA has limited efficacy in gene silencing and suffers from dose-dependent toxicity, off-target effects, and insufficient stability.
The introduction of deoxyribonucleotide spacers (ISDs) enhances the gene silencing efficacy of single-stranded antisense RNA (asRNA), which is achieved by antisense oligonucleotides that are essentially complementary to the target RNA sequence and contain natural or modified nucleomonomers and deoxynucleomonomers.
It significantly enhances gene silencing effects, reduces dose-dependent toxicity, improves tissue penetration and stability, reduces synthesis costs, and reduces off-target effects, making it suitable for research, diagnosis, disease prevention, and treatment.
Smart Images

Figure CN120676949A_ABST
Abstract
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to and benefits of U.S. Provisional Patent Application No. 63 / 431,309, filed on December 8, 2022, the entire contents of which are incorporated herein by reference. Technical Field
[0002] The present invention relates to a novel designed short single-stranded antisense RNA oligonucleotide as a gene regulation technology, and related compositions and methods, which can be used for biological or medical research, disease treatment and prevention, and gene silencing applications in other biological fields. Background Art
[0003] Single-stranded antisense RNA (asRNA), naturally occurring in both prokaryotes and eukaryotes, is a noncoding RNA transcript typically 19-23 nucleotides long, transcribed from the lagging strand of a gene and complementary to and antisense to the mRNA transcript (see Xu, J. et al., 2018). Despite its potential regulatory role in complex biological networks, asRNAs have yet to be fully elucidated—the underlying mechanisms of their function remain poorly understood, and to date, only a few in vivo functions of asRNAs have been identified in known organisms (see Xu, J. et al., supra). Since the first observation of antisense activity in noncoding RNAs over 30 years ago, new breakthroughs are needed to unlock their regulatory potential as research tools and therapeutic agents.
[0004] The citation of references herein is not to be construed as an admission that they are prior art to the claimed invention. SUMMARY OF THE INVENTION
[0005] The present invention is based on the surprising discovery that naturally occurring single-stranded antisense RNAs, consisting solely of RNA, have limited gene silencing efficacy, but their efficacy is enhanced by the introduction of an interspersed segment of deoxyribonucleotides (ISD). Therefore, the present invention provides a novel gene regulation technology using short, single-stranded antisense RNAs (asRNAs) containing at least one ISD.
[0006] This novel asRNA having one or more ISDs is a short single-stranded molecule composed of linked nucleotide monomers, each of which is independently selected from the group consisting of naturally occurring nucleotides, their analogs, and modified nucleotides (hereinafter collectively referred to as "nucleotide monomers").
[0007] The "ribonucleotide monomers" contained in the asRNA molecules of the present invention are selected from the group consisting of naturally occurring ribonucleotides, their analogs, and modified ribonucleotides. Furthermore, the addition of one or more deoxynucleotide spacer monomers can significantly enhance or achieve the gene silencing function of the asRNA. The "deoxynucleotide monomers" can be selected from the group consisting of naturally occurring deoxynucleotides, their analogs, and modified deoxynucleotides.
[0008] In one embodiment, the powerful gene silencing effect of the novel asRNA-based platform technology included in the present disclosure is achieved through antisense oligonucleotides that are substantially complementary to the target RNA sequence. Our data show that the asRNA molecules of the present invention, due to their unique and novel composition, can induce more powerful gene silencing than existing gene silencing technologies, and thus can achieve reduced dose-dependent toxicity. Compared with existing gene silencing technologies, the asRNA molecules of the present invention are expected to have at least one of the following advantages, including better tissue penetration; gene silencing can be achieved in the cytoplasm as well as in the nucleus and mitochondria; reduced off-target effects; better stability; lower synthesis costs and other improved pharmaceutical properties. Therefore, the asRNA molecules of the present invention have great potential for solving the various challenges faced by existing gene silencing technologies. The asRNA molecules of the present invention can be used in all areas where current gene silencing oligonucleotides are being used or expected to be used, including research, diagnosis, disease prevention and treatment, and other applications in the biological field, as well as the field of pesticides and veterinary drugs.
[0009] In a first aspect, the present invention provides a composition comprising a short antisense RNA (asRNA) molecule having a single strand composed of linked ribonucleotide monomers, wherein the single strand is substantially complementary to a target segment of a target RNA through at least one targeting region. Furthermore, the asRNA molecule comprises at least one deoxynucleomonomer spacer (ISD), wherein the ISD comprises at least one deoxynucleomonomer. The ribonucleotide monomers in the asRNA molecule are selected from the group consisting of naturally occurring ribonucleotides, their analogs, and modified ribonucleotides; and the deoxynucleomonomer spacer is selected from the group consisting of naturally occurring deoxynucleotides, their analogs, and modified deoxynucleotides. In one embodiment, the ISD in the asRNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxynucleomonomers. In one feature, the ISD in the asRNA molecule comprises at least 2, 3, 4, 5, 6, 7, or 8 consecutive deoxynucleomonomers. In one embodiment, the ISD comprises at least 2 deoxynucleomonomers. There may be more than one ISD in an asRNA molecule. In one feature, each ISD is independently composed of a deoxynucleoside monomer, or includes at least 2, 3, 4, 5, or more consecutive deoxynucleoside monomers. In one feature, the ISD is distributed in at least one targeting region. In certain embodiments, the ISD may be distributed at any position in the asRNA molecule. In some embodiments, the ISD is located in the more central portion of the asRNA molecule (at least 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides from either end, i.e., at position 2 or more central from either end of the chain). In certain embodiments, the ISD includes at least one deoxynucleoside monomer located at the 5' end and / or the 3' end of the asRNA molecule.
[0010] In one feature, when the single-stranded antisense RNA includes at least one ISD, at least one gene regulatory or pharmaceutical property is enhanced or more desirable; the property is selected from the group consisting of efficacy, potency, speed of onset, durability, economical synthesis, off-target effects, non-specific immune stimulation, stability, and delivery. More specifically, the improved gene regulatory or pharmaceutical properties of the asRNA molecules of the present invention compared to the corresponding single-stranded antisense RNA without an ISD include, for example, one or more of the following: enhanced efficacy and / or potency, faster onset of action, improved pharmacokinetic properties, longer duration of effect, fewer off-target effects, less typical dose-dependent toxicity, avoidance of non-specific interferon-like reactions, lower manufacturing costs, improved stability, and improved delivery.
[0011] The present invention provides a composition for regulating gene expression or function in eukaryotic cells, wherein an asRNA having an ISD (asRNA-ISD) is contacted with the cells or administered to a subject.
[0012] In one feature, the asRNA molecule includes a plurality of linked nucleotide monomers to form a nucleobase sequence, and the sequence is at least 70%, 80%, 85%, 90%, 95% complementary or fully complementary to the target segment of the target RNA. In certain embodiments, the target RNA is mRNA, pre-mRNA, mt-mRNA and / or non-coding RNA, wherein these RNAs encode proteins associated with a disease or regulate part of a biological pathway associated with a disease, such as a mammalian disease. In this disclosure, the terms "target" and "targeted" are used interchangeably and have the same meaning.
[0013] In various embodiments, the asRNA molecule has a backbone length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 linked nucleomonomers, or the equivalent thereof, or a range of lengths encompassed by any two of the foregoing values (both endpoints of the range are inclusive). For example, some length ranges of asRNA include: 8-48 nucleotide monomers; 8-44 nucleotide monomers; 8-42 nucleotide monomers; 8-40 nucleotide monomers; 8-36 nucleotide monomers; 8-33 nucleotide monomers; 10-48 nucleotide monomers; 10-44 nucleotide monomers; 10-42 nucleotide monomers; 10-40 nucleotide monomers; 10-36 nucleotide monomers; 10-30 nucleotide monomers; 10-29 nucleotide monomers; 12-48 nucleotide monomers; 12-44 nucleotide monomers; 12-42 nucleotide monomers; 12-40 nucleotide monomers; 12-36 nucleotide monomers; 12-34 nucleotide monomers; 12-32 nucleotide monomers; 12-30 nucleotide monomers; 12-29 nucleotide monomers; 8 nucleotide monomers; 12-26 nucleotide monomers; 12-25 nucleotide monomers; 13-48 nucleotide monomers; 13-44 nucleotide monomers; 13-42 nucleotide monomers; 13-40 nucleotide monomers; 13-36 nucleotide monomers; 13-34 nucleotide monomers; 13-32 nucleotide monomers; 13-30 nucleotide monomers; 13-28 nucleotide monomers; 13-26 nucleotide monomers; 13-25 nucleotide monomers; 13-24 nucleotide monomers; 13-23 nucleotide monomers; 14-36 nucleotide monomers; 15-23 nucleotide monomers; 20-36 nucleotide monomers; 21-36 nucleotide monomers; 24-36 nucleotide monomers; at least 21 nucleotide monomers; at least 24 nucleotide monomers and at least 8 nucleotide monomers.
[0014] In one feature of the asRNA molecules of the present invention, at least one nucleotide monomer in the chain is a modified nucleotide or nucleotide analog, for example, a sugar-modified, backbone-modified, and / or base-modified nucleotide. In one embodiment, the backbone-modified nucleotide has a modification in at least the internucleoside bond, for example, including at least one of a nitrogen heteroatom or a sulfur heteroatom. In certain embodiments, the modified internucleoside bond is or comprises: a phosphorothioate group (P=S), a phosphotriester, a methylphosphonate, or a phosphoramidate.
[0015] In certain embodiments, the asRNA molecule includes at least one modified internucleoside bond, and the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, each internucleoside bond of the asRNA molecule is a phosphorothioate internucleoside bond. In different embodiments, the internucleoside bond is a mixture of a phosphorothioate bond and a phosphodiester bond.
[0016] In one feature, the asRNA molecule of the present invention has at least one modified nucleotide or nucleotide analog, wherein the modified nucleotide or nucleotide analog comprises a modified sugar portion. In certain embodiments, the 2' position of the modified sugar portion is substituted by a group selected from the following: OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, wherein each R is independently C1-C6 alkyl, alkenyl or alkynyl, and halo is F, Cl, Br or I. In some embodiments, the 2' position of the modified sugar portion is substituted by a group selected from the following: allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n )、O-CH2-C(=O)-N(R m )(R n ), or O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n ), where each R1, R m and R n are independently H or substituted or unsubstituted C1-C 10 alkyl.
[0017] In some embodiments, the modified sugar moiety has a substituent group selected from the group consisting of 5'-vinyl, 5'methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, 2'-O-aminopropylated (2'-AP), and 2'-O(CH2)2OCH3. In some embodiments, the modified sugar moiety is substituted with a bicyclic sugar selected from the group consisting of 4′-(CH2)—O-2′(LNA), 4′-(CH2)—S-2′, 4′-(CH2)2—O-2′(ENA), 4′-CH(CH3)—O-2′(cEt), and 4′-CH(CH2OCH3)—O-2′, 4′-C(CH3)(CH3)—O-2′, 4′-CH2—N(OCH3)-2′, 4′-CH2—O—N(CH3)-2′, 4′-CH2—N(R)—O-2′ (where R is H, C1-C 12In some embodiments, the modified sugar moiety is selected from the group consisting of 2'-O-methoxyethyl modified sugar (MOE), 4'-(CH2)-O-2' bicyclic sugar (LNA), 2'-deoxy-2'-fluoroarabinose (2'-F arabinose, FANA), and methyl(methyleneoxy)(4'-CH(CH3)-O-2) bicyclic sugar (cEt).
[0018] In one feature of the asRNA molecules of the invention, the sugar moiety of the deoxyribonucleotide monomer is a naturally occurring deoxyribonucleotide sugar moiety (2-H) or 2'-deoxy-2'-fluoroarabinose (FANA).
[0019] In one feature of the asRNA molecules of the present invention, the sugar portion of the ribonucleotide monomer is selected from the group consisting of naturally occurring ribonucleotides (2-OH), 2'-F modified sugars, 2'-OMe modified sugars, 2'-O-methoxyethyl modified sugars (MOE), 4'-(CH2)—O-2' bicyclic sugars (LNA) and methyl(methyleneoxy) (4'-CH(CH3)—O-2) bicyclic sugars (cEt).
[0020] In another feature, the asRNA molecule of the present invention includes at least one modified nucleobase nucleotide monomer. In some embodiments, the modified nucleobase is selected from the group consisting of 5-methylcytosine (5-Me-C), hypoxanthine nucleoside bases, tritylated bases, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 1-methylpseudouracil, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6- In some embodiments, the modified nucleobase is 5-methylcytosine, 5-nitro-1, 1-nitro-2, 1-nitro-1-oxo-1-oxo-2 ...
[0021] In one feature of the invention, asRNA molecules are used to modulate gene expression or function in a cell (eg, a eukaryotic cell, such as a mammalian cell).
[0022] In certain embodiments, the RNA targeted by the asRNA molecules of the present invention is selected from mRNA, pre-mRNA, mt-mRNA and non-coding RNA. In one feature, these target RNAs either encode proteins associated with the disease or regulate part of the biological pathway associated with the disease. In different embodiments, such target RNAs can be, but are not limited to, selected from: mRNA, pre-mRNA, mt-mRNA, non-coding RNA or lncRNA of genes associated with diseases or conditions of humans or animals; mRNA or pre-mRNA of pathogenic microorganism genes; viral RNA; and RNA associated with diseases selected from the group consisting of autoimmune diseases, inflammatory diseases, degenerative diseases, infectious diseases, proliferative diseases, metabolic diseases, immune-mediated disorders, allergic diseases, skin diseases, malignancies, gastrointestinal diseases, respiratory diseases, cardiovascular diseases, kidney diseases, rheumatoid diseases, nervous system diseases, endocrine disorders, and aging-related diseases or disorders.
[0023] In one feature, the asRNA molecules of the present invention are conjugated to a ligand or moiety. In certain embodiments, the ligand or moiety is selected from the group consisting of a polypeptide / protein, an antibody, a polymer, a polysaccharide, a lipid, a hydrophobic moiety or molecule, a cationic moiety or molecule, a lipophilic compound or oligonucleotide moiety, cholesterol, GalNAc, and a nucleic acid aptamer.
[0024] In a second aspect, the present invention provides a pharmaceutical composition comprising the composition of the first aspect as an active agent, and a pharmaceutically acceptable excipient, carrier, or diluent thereof. Examples of such carriers include, but are not limited to, drug carriers, positively charged carriers, lipid nanoparticles, liposomes, protein carriers, hydrophobic moieties or molecules, cationic moieties or molecules, GalNAc, polysaccharide polymers, nanoparticles, nanoemulsions, cholesterol, lipids, lipophilic compounds or moieties, and lipids.
[0025] In a third aspect, the present invention provides a method for treating or preventing a disease or condition using the composition of the first aspect or the pharmaceutical composition of the second aspect, by administering a therapeutically effective amount of an asRNA molecule of the present invention or a pharmaceutical composition comprising the asRNA molecule to a subject in need thereof. The administration method is selected from the following routes: intravenous injection (iv), subcutaneous injection (sc), oral administration (po), intramuscular injection (im), oral administration, inhalation, topical, intrathecal, and other administration methods.
[0026] In one feature, the disease or condition being treated prophylactically or therapeutically is selected from the group consisting of cancer, autoimmune diseases, inflammatory diseases, degenerative diseases, infectious diseases, proliferative diseases, metabolic diseases, immune-mediated disorders, allergic diseases, skin diseases, malignancies, gastrointestinal diseases, liver diseases, respiratory diseases, cardiovascular diseases, skin diseases, kidney diseases, rheumatoid diseases, neurological diseases, psychiatric diseases, endocrine disorders, and diseases or disorders associated with aging.
[0027] In a fourth aspect, the present invention provides a method for regulating or modulating gene expression or gene function in eukaryotic cells using the composition of the first aspect or the pharmaceutical composition of the second aspect. The method comprises the following steps: contacting the cells with an effective amount of any asRNA molecule of the present invention or a pharmaceutical composition comprising the asRNA molecule.
[0028] In one embodiment, the contacting step comprises the step of introducing a composition comprising the asRNA molecule into a target cell or organism in culture where selective gene silencing can occur. In another embodiment, the introducing step is selected from the group consisting of simple mixing, transfection, lipid infection, electroporation, infection, injection, oral administration, intravenous injection (iv), subcutaneous injection (sc), oral (po), intramuscular injection (im), inhalation, topical, intrathecal and other regional administration. In another embodiment, the introducing step comprises the use of a pharmaceutically acceptable excipient, carrier or diluent, wherein the pharmaceutically acceptable excipient, carrier or diluent is selected from the group consisting of a drug carrier, a positively charged carrier, a lipid nanoparticle, a liposome, a protein carrier, a hydrophobic moiety or molecule, a cationic moiety or molecule, GalNAc, a polysaccharide polymer, a nanoparticle, a nanoemulsion, cholesterol, a lipid, a lipophilic compound or moiety, and a lipid.
[0029] In certain embodiments, the target gene is mRNA. In certain embodiments, the target gene is pre-mRNA. In certain embodiments, the target gene is mt-mRNA. In certain embodiments, the target gene is non-coding RNA such as microRNA and lncRNA.
[0030] In one embodiment, the target gene is associated with a disease, pathological condition, or adverse condition in a mammal. In another embodiment, the target gene is a gene of a pathogenic microorganism. In a further embodiment, the target gene is a viral gene. In another embodiment, the target gene is a tumor-related gene. In another embodiment, the target gene is a gene associated with a disease selected from the group listed in the third aspect.
[0031] Other features and advantages of the present invention are apparent from the additional description (including different embodiments) provided herein. The embodiments provided illustrate different components and methods useful in implementing the present invention. The embodiments do not limit the claimed invention. According to the content of this disclosure, those skilled in the art can confirm and adopt other components and methods useful for implementing the present invention. Several embodiments have been shown and described, but any modification can be made without departing from the spirit and scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 Shown are exemplary structures of some embodiments of asRNAs having various interspersed deoxyribonucleotide monomers (ISD) motifs and corresponding ISD-free antisense single-stranded RNAs (ASRs), and exemplary sequences of asRNAs and ASRs for targeting the APOCIII gene having the illustrated exemplary structures.
[0033] Figure 2 Shows the Figure 1 Comparison of gene silencing efficacy between asRNA targeting the APOCIII gene and the corresponding ASR. HepaRG cells were transfected with 10 nM asRNA and the corresponding ASR, and the relative mRNA levels of the APOIIIC gene were measured.
[0034] Figure 3 Shown are exemplary structures and exemplary sequences of some embodiments of asRNAs with different ISD positions for targeting the APOCIII gene.
[0035] Figure 4 Shows the Figure 3 The gene silencing efficacy of asRNA targeting the APOCIII gene sequence was investigated by transfecting HepaRG cells with 10 nM asRNA and then measuring the relative mRNA levels of the APOIIIC gene.
[0036] Figure 5A Exemplary sequences of some examples of asRNAs with different lengths are shown. Figure 5B and 5C Shows Figure 5A The gene silencing efficacy of asRNA targeting APOCIII gene at different concentrations is shown in Figure 1. The gene silencing efficacy of APOCIII gene relative to mRNA level was detected after HepaRG cells were transfected with 100 pM and 10 nM asRNA. Detailed Description of the Invention
[0037] The present invention relates to gene or RNA regulation / silencing technology using a novel short, single-stranded antisense RNA with spacer DNA monomers. This new technology utilizes short, single-stranded antisense RNA compositions with deoxynucleotide spacers for regulating gene expression or function in vitro and in vivo. The present invention also provides methods for using these compositions to regulate target gene expression or function, treat or prevent disease, and for biomedical research and other biological applications. 1. Definition
[0038] As used herein, unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" include plural forms thereof. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.
[0039] When the term "about" is used in conjunction with a numerical range, it defines the range by extending the upper and lower boundaries of these numerical values. Generally speaking, the term "about" is used herein to define the numerical value with a variation of 20%, 10%, 5% or 1% above and below the set value. In some embodiments, the term "about" is used to define the numerical value with a variation of 10% above and below the set value. In some embodiments, the term "about" is used to define the numerical value with a variation of 5% above and below the set value. In some embodiments, the term "about" is used to define the numerical value with a variation of 1% above and below the set value.
[0040] As used herein, the terms "analog" or "analogue" interchangeably refer to functionally or structurally equivalent. For example, nucleoside and nucleotide analogs have been used in the clinical treatment of cancer and viral infections for decades, and researchers and the pharmaceutical industry are constantly synthesizing and evaluating new compounds, see, for example, Jordheim LP et al., Nat Rev Drug Discov 12, 447-464 (2013).
[0041] As used herein, the term "deoxyribonucleoside monomer" refers to a nucleoside monomer including naturally occurring deoxyribonucleosides, their analogs, and modified deoxyribonucleosides. The term "deoxyribonucleotide monomer" refers to a nucleotide monomer including naturally occurring deoxyribonucleotides, their analogs, and modified deoxyribonucleotides.
[0042] As used herein, the term "ribonucleoside monomer" refers to a nucleoside monomer including naturally occurring ribonucleosides, their analogs, and modified ribonucleosides. The term "ribonucleotide monomer" refers to a nucleotide monomer including naturally occurring ribonucleotides, their analogs, and modified ribonucleotides.
[0043] As used herein, the term "nucleoside" refers to a compound comprising a core base moiety and a sugar moiety. Nucleoside monomers include, but are not limited to naturally occurring nucleosides (e.g., deoxyribonucleosides and ribonucleosides found in DNA and RNA, respectively), analogs thereof, and modified nucleosides. Nucleoside monomers can be deoxyribonucleoside monomers or ribonucleoside monomers. For example, a nucleoside monomer can be linked to a phosphate moiety to form a nucleotide monomer.
[0044] As used herein, the term "nucleotide" refers to a nucleoside further comprising a phosphate linking group. Nucleoside monomers include, but are not limited to, naturally occurring nucleotides (e.g., deoxyribonucleotides and ribonucleotides found in DNA and RNA, respectively), analogs thereof, and modified nucleotides. Nucleoside monomers can be deoxyribonucleotide monomers or ribonucleotide monomers. Modified nucleotides can be modified at one or more of the following: a nitrogenous core base moiety, a five-carbon sugar moiety, and a phosphate linking group that causes changes in the internucleoside bond.
[0045] As used herein, the term "oligonucleotide (abbreviated as oligo)" or "oligonucleotide" refers to a compound comprising a plurality of linked nucleoside monomers. In certain embodiments, one or more nucleoside monomers are modified, or one or more internucleoside bonds are modified.
[0046] The terms "deoxynucleoside" and "deoxyribonucleoside" are used interchangeably herein. The terms "deoxynucleotide" and "deoxyribonucleotide" are also used interchangeably herein. As used herein, a "deoxynucleoside" or "deoxynucleotide" is a nucleoside or nucleotide, respectively, that contains a deoxy sugar moiety.
[0047] As used herein, the term "motif" is a pattern of chemically distinct regions, for example in an oligonucleotide chain.
[0048] As used herein, the term "immediately adjacent" refers to the absence of intervening elements between two elements, such as between regions, fragments, nucleotides and / or nucleosides.
[0049] As used herein, the term "modified nucleotide" refers to a nucleotide having at least one modified sugar moiety, modified internucleoside linkage, and / or modified nucleobase.
[0050] As used herein, the term "modified nucleoside" refers to a nucleoside having at least one modified sugar moiety and / or a modified nucleobase.
[0051] As used herein, the term "modified oligonucleotide" refers to an oligonucleotide comprising at least one modified nucleotide.
[0052] As used herein, the term "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester bond.
[0053] As used herein, the term "modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside linkage. For example, a phosphorothioate linkage is a modified internucleoside linkage.
[0054] As used herein, the term "natural sugar moiety" refers to a sugar that is naturally present in DNA (2-H) or RNA (2-OH).
[0055] As used herein, the term "modified sugar" refers to a substitution or change from a naturally occurring sugar moiety. For example, a sugar modified with a 2'-O-methoxyethyl group is a modified sugar moiety.
[0056] As used herein, the term "bicyclic sugar" refers to a furosyl ring modified by bridging two non-bicyclic atoms. A bicyclic sugar is a modified sugar.
[0057] As used herein, the term "bicyclic nucleic acid," "BNA," "bicyclic nucleoside," or "bicyclic nucleotide" refers to a nucleoside or nucleotide whose furanose portion includes a bridging group connecting two carbon atoms on the furanose ring to form a bicyclic sugar system.
[0058] As used herein, the term "2'-O-methoxyethyl" (also known as 2'-MOE, 2'-O(CH2)2-OCH3, and 2'-O-(2-methoxyethyl)) refers to a furanosyl ring with a 2'-O-methoxyethyl modification. A 2'-O-methoxyethyl-modified sugar is a modified sugar. As used herein, the term "2'-O-methoxyethyl nucleotide" refers to a modified nucleotide comprising a 2'-O-methoxyethyl-modified sugar moiety.
[0059] As used herein, the term "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. For example, 5-methylcytosine is a modified nucleobase. In contrast, as used herein, "unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0060] As used herein, the term "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5' position. 5-Methylcytosine is a modified nucleobase.
[0061] As used herein, "RNA-like nucleotide" refers to a modified nucleotide that adopts a Northern configuration when incorporated into an oligonucleotide and functions like RNA. RNA-like nucleotides include, but are not limited to, bridged nucleic acids (BNA), LNA, cEt, 2'-O-methylated nucleotides, 2'-O-methoxyethylated (2'-MOE) nucleotides, 2'-fluorinated nucleotides, 2'-O-aminopropylated (2'-AP) nucleotides, tricyclic DNA (tcDNA), and RNA surrogates.
[0062] As used herein, "DNA-like nucleotide" refers to a modified nucleotide that functions like DNA when incorporated into an oligonucleotide. DNA-like nucleotides include, but are not limited to, 2'-deoxy-2'-fluoroarabino (FANA) nucleotides and DNA surrogates.
[0063] As used herein, "non-coding RNA" refers to an RNA molecule that is not translated into protein. Examples of non-coding RNA include transfer RNA (tRNA) and ribosomal RNA (rRNA), as well as small non-coding RNA and long ncRNA (lncRNA). As used herein, examples of "small non-coding RNA" include, but are not limited to: microRNA (miRNA), asRNA, pre-miRNA, pri-miRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA and any of the aforementioned mimics (mimic). As used herein, "lncRNA" and "long non-coding RNA" are transcribed RNA molecules that contain more than 200 nucleotides that do not encode proteins. LncRNA can also undergo common post-transcriptional modifications, including 5'-capping, 3'-polyadenylation and splicing. In general, lncRNA is a diverse class of molecules that play various roles in regulating the function of genes and genomes. For example, it is well known that lncRNAs regulate gene transcription, translation and epigenetic regulation. Examples of IncRNA include, but are not limited to: Kcnqlot1, Xlsirt, Xist, ANRIL, NEAT1, NRON, DANCR, OIP5-AS1, TUG1, CasC7, HOTAIR and MALAT1. As used herein, "splicing" or "splicing" refers to the natural process of removing unnecessary RNA regions and transforming RNA. An example of oligonucleotides regulating RNA target function is the regulation of non-coding RNA function. In certain embodiments, asRNA is designed for targeting one of the aforementioned small non-coding RNAs. In certain embodiments, asRNA is designed for targeting miRNA. In certain embodiments, asRNA is designed for targeting pre-miRNA. In certain embodiments, asRNA is designed for targeting pri-miRNA. In certain embodiments, asRNA is designed for targeting lncRNA. In certain embodiments, asRNA is designed for targeted splicing.
[0064] The target RNA in the cell nucleus refers to an RNA molecule that is synthesized and / or functions in the cell nucleus of the cell. According to a preferred embodiment, the target RNA in the cell nucleus of the present invention includes non-coding RNA, lncRNA, pre-mRNA and pre-miRNA. The term "pre-mRNA" used herein refers to an unprocessed or partially processed mRNA precursor, containing introns and exons, which is synthesized by transcription from a cell DNA template. Pre-mRNA needs to splice (remove) introns to produce an mRNA molecule containing only exons. In some embodiments, asRNA is designed for targeting pre-mRNA. The term "mt-mRNA" refers to an mRNA molecule transcribed from mitochondrial DNA. In certain embodiments, asRNA is designed for targeting mt-mRNA in mitochondria.
[0065] As used herein, the term "interval" refers to a segment having different types of adjacent moieties, e.g., different types of nucleotides or nucleotide analogs, or different modifications of the same type of nucleotides or nucleotide analogs. In various embodiments of the present invention, an "interval segment of deoxynucleotide monomers (ISD)" refers to a segment of deoxyribonucleotides in an oligonucleotide chain having one or more deoxynucleotides and connected to at least one segment of a different type than the deoxynucleotide. For example, if the deoxynucleotide is unmodified, the different type of segment can be a ribonucleotide or an analog thereof, a modified ribonucleotide, a modified deoxynucleotide, or a deoxynucleotide analog. If the deoxynucleotide is modified, the different type of segment can be a ribonucleotide or an analog thereof, a modified ribonucleotide, an unmodified deoxynucleotide, a differently modified deoxynucleotide, or a different type of deoxynucleotide analog.
[0066] As used herein, "regulate," "modulate," and their grammatical equivalents refer to an increase or decrease (e.g., silence), in other words, upregulate or downregulate. As used herein, "gene silencing" refers to a decrease in gene expression, and can refer to a decrease in gene expression of a target gene by about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.
[0067] As used herein, the terms "inhibit," "to inhibit," and their grammatical equivalents, when used in the context of a biological activity, refer to the downregulation of a biological activity, which may reduce or eliminate the target function (e.g., production of a protein, or phosphorylation of a molecule). In certain embodiments, inhibition may refer to a reduction in target activity by about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. When used in the context of a disorder or disease, the term refers to successfully preventing the onset of symptoms, alleviating symptoms, or eliminating the disease, condition (disease), or disorder.
[0068] As used herein, the term "substantially complementary" or "complementary" refers to complementarity in the double-stranded region of base pairing between the two chains with linked nucleosides, rather than any single-stranded regions (e.g., overhangs at the ends). Complementarity need not be perfect; for example, there may be any number of base pair mismatches between the two chains with linked nucleosides. However, if the number of mismatches is so great that hybridization does not occur even under the least stringent hybridization conditions, the sequences are not substantially complementary sequences. When two sequences are referred to herein as "substantially complementary," it is meant that the sequences are sufficiently complementary to each other to hybridize under the selected reaction conditions. The relationship between nucleic acid complementarity and hybridization stringency sufficient to achieve specificity is well known in the art. Two substantially complementary chains can be, for example, fully complementary, or can contain one to multiple mismatches, as long as the hybridization conditions are sufficient to allow, for example, to distinguish between paired and unpaired sequences. Thus, substantially complementary sequences can refer to sequences having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% base pair complementarity in the double-stranded region, or any number therebetween.
[0069] As used herein, "fully complementary" or "100% complementary" means that each nucleobase in a nucleobase sequence of a first strand of linked nucleosides has a complementary nucleobase in a second nucleobase sequence of a second strand of linked nucleosides. In certain embodiments, the first strand of linked nucleosides is a target compound and the second strand of linked nucleosides is an antisense compound, or vice versa.
[0070] As used herein, the term "targeting region" refers to a region in an oligonucleotide chain that is substantially or completely complementary to another oligonucleotide chain, such that under appropriate conditions, the two chains hybridize or anneal to each other at the targeting region. For example, the antisense strand can include a targeting region through which it can hybridize to a target mRNA.
[0071] The terms "administer," "administering," and "administration" are used herein in their broadest sense. These terms refer to any method of introducing a compound or pharmaceutical composition described herein to a subject, and can include, for example, introducing the compound to a subject systemically, topically, or in situ. Thus, the production of a compound disclosed herein from a composition (whether or not the composition includes the compound) in a subject is encompassed by these terms. When these terms are used in conjunction with "systemic" or "systemically," they generally refer to systemic absorption or accumulation of a compound or composition in the blood, followed by distribution throughout the body.
[0072] As used herein, the terms "effective amount" and "therapeutically effective amount" refer to an amount of a compound or pharmaceutical composition described herein that is sufficient to affect a desired outcome, including, but not limited to, disease treatment, as shown below. In some embodiments, a "therapeutically effective amount" refers to an amount that is effective for: detectably killing or inhibiting the growth or spread of cancer cells, the size or number of tumors, and / or other measures of the level, stage, progression, and / or severity of cancer. In some embodiments, a "therapeutically effective amount" refers to an amount that is administered systemically, topically, or in situ (e.g., the amount of a compound produced in situ in a subject). A therapeutically effective amount can vary depending on the intended application (in vitro or in vivo) or the subject and disease condition being treated (e.g., the weight and age of the subject, the severity of the disease condition, the mode of administration, etc.), which can be readily determined by one of ordinary skill in the art. The term also applies to doses that induce a specific response in target cells, for example, reducing cell migration. The specific dosage may vary depending on, for example, the particular pharmaceutical composition, the subject and their age and existing health condition or risk of health condition, the dosage regimen to be followed, the severity of the disease, whether it is administered in combination with other agents, the time of administration, the tissue to which it is administered, and the physical delivery system in which it is carried.
[0073] The term "cancer" refers to the presence of cells in a subject that possess characteristics typical of oncogenic cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rates, and certain morphological characteristics. Typically, cancer cells are present as a tumor or mass, but cancer cells may also be present in isolation within a subject or may circulate in the bloodstream as independent cells, such as leukemia or lymphoma cells. Examples of cancer as used herein include, but are not limited to: lung cancer, pancreatic cancer, bone cancer, skin cancer, head and neck cancer, cutaneous melanoma or intraocular melanoma, breast cancer, uterine cancer, ovarian cancer, peritoneal cancer, colon cancer, rectal cancer, colorectal adenocarcinoma, cancer of the anal region, stomach cancer, gastric cancer, gastrointestinal cancer, gastric adenocarcinoma, adrenocorticoid carcinoma, uterine cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, esophageal cancer, gastroesophageal junction cancer, gastroesophageal adenocarcinoma, chondrosarcoma, small intestine cancer, cancer of the endocrine system, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, Ewing's sarcoma, urethral cancer, penile cancer, prostate cancer, bladder cancer, testicular cancer, Ureteral cancer, renal pelvic cancer, mesothelioma, hepatocellular carcinoma, bile duct cancer, kidney cancer, renal cell carcinoma, chronic or acute leukemia, lymphocytic lymphoma, central nervous system (CNS) tumor, spinal tumor, brain stem glioma, glioblastoma multiforme, astrocytoma, schwannoma, ependymoma, medulloblastoma, meningioma, squamous cell carcinoma, pituitary adenoma, including refractory cases of any of the above cancers, or a combination of one or more of the above cancers. Some example cancers are included in the general terms and are included in this term. For example, the general term urological cancer includes bladder cancer, prostate cancer, kidney cancer, testicular cancer, etc.; while another general term hepatobiliary cancer includes liver cancer (which itself is a general term including hepatocellular carcinoma or bile duct cancer), gallbladder cancer, bile duct cancer, or pancreatic cancer. The content of the present disclosure covers urological cancer and hepatobiliary cancer and is included in the term "cancer".
[0074] The term "pharmaceutical composition" refers to a formulation containing a molecule or composition such as disclosed herein as an active ingredient, typically mixed with other substances (e.g., a pharmaceutical carrier, such as sterile water) to form a form suitable for administration to a subject. In one embodiment, the pharmaceutical composition is in bulk form or in unit dosage form. The unit dosage form is any of a variety of forms, including, for example, capsules, IV bags, tablets, single pumps on aerosol inhalers, or vials. The amount of the active ingredient in a unit dose of the composition is an effective amount and varies depending on the specific treatment involved. Those skilled in the art will understand that it is sometimes necessary to make routine adjustments to the dosage based on the patient's age and condition. The dosage will also depend on the route of administration. Various routes are contemplated, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, intranasal, etc. The dosage forms for topical or transdermal administration of the asRNA of the present invention include powders, sprays, ointments, pastes, creams, emulsions, gels, solutions, patches, and inhalants.
[0075] The term "pharmaceutical agent" refers to a substance that provides a therapeutic benefit when administered to an individual.
[0076] The term "pharmaceutically acceptable carrier" refers to a medium or diluent that does not interfere with the structure of a compound. Certain such carriers enable pharmaceutical compositions to be formulated into, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. Certain such carriers enable pharmaceutical compositions to be formulated for injection, infusion, or topical administration. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution.
[0077] The term "pharmaceutically acceptable derivative" includes derivatives of the compounds described herein, such as solvates, hydrates, esters, prodrugs, polymorphs, isomers, isotopically labeled variations, pharmaceutically acceptable salts, and other derivatives known in the art.
[0078] The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound, i.e., a salt that retains the desired biological activity of the parent compound and does not impart undesirable toxicological effects thereto. The term "pharmaceutically acceptable salt" or "salt" includes salts prepared by reacting the parent compound with a pharmaceutically acceptable non-toxic acid or base (including inorganic or organic acids and bases). Pharmaceutically acceptable salts of the compounds described herein can be prepared by methods well known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Pharmaceutically acceptable salts include, but are not limited to, acid addition salts including hydrochlorides, hydrobromides, phosphates, sulfates, bisulfates, alkylsulfonates, arylsulfonates, acetates, benzoates, citrates, maleates, fumarates, succinates, lactates, and tartrates; alkali metal cation salts such as Na, K, Li, alkaline earth metal salts such as Mg or Ca, or organic amine salts. In particular, sodium salts of oligonucleotides have been shown to be useful and are generally accepted for therapeutic administration to humans. Therefore, in one embodiment, the compounds described herein are in the form of sodium salts.
[0079] As used herein, the term "subject" refers to any animal (e.g., mammal), including, but not limited to, humans, non-human primates, rodents, etc., that is the recipient of a particular treatment. Generally, with respect to human subjects, the terms "subject" and "patient" are used interchangeably herein.
[0080] As used herein, terms such as "treating," "treatment," "to treat," "alleviating," or "to alleviate" refer to (1) therapeutic measures that cure, slow, alleviate symptoms, and / or halt the progression of a diagnosed pathological condition or disorder, and (2) prophylactic or preventative measures that prevent or slow the progression of a targeted pathological condition or disorder. Those in need of treatment therefore include those already suffering from the disorder; those susceptible to developing the disorder; and those in need of prevention of the disorder. A subject is successfully "treated" according to the methods of the present invention if the subject exhibits one or more of the following: a decrease in the number of cancer cells or the complete absence of cancer cells; a decrease in tumor size; an inhibition or absence of cancer cell infiltration into peripheral organs (including spread of cancer into soft tissue and bone); an inhibition or absence of tumor metastasis; an inhibition or absence of tumor growth; amelioration of one or more symptoms associated with a particular cancer; a reduction in morbidity and mortality; and an improvement in quality of life.
[0081] As used herein, the term "carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, e.g., a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, which participates in or is capable of carrying or transporting the subject drug compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Non-limiting examples of pharmaceutically acceptable excipients, carriers and / or diluents include: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffered saline; and other nontoxic, compatible substances used in pharmaceutical formulations. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate, magnesium stearate, and polyethylene oxide-polypropylene oxide copolymers, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions. 2. Certain Implementation Options
[0082] Certain embodiments of the present invention provide an asRNA composition composed of linked ribonucleoside monomers and at least one deoxyribonucleoside monomer spacer (ISD). Some or all of the nucleoside monomers and / or internucleoside bonds contained in the asRNA may be modified, i.e., the nucleoside monomers and / or internucleoside bonds derived from structures found in natural RNA or DNA may be modified. The asRNA of the present invention may contain one or more ISDs. In certain embodiments, each ISD independently consists of one deoxynucleoside monomer or at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive deoxynucleoside monomers. In certain embodiments, an ISD comprises at least two consecutive, linked deoxynucleoside monomers.
[0083] The exemplary structures and sequences of asRNA molecules of the present invention are as follows Figure 1 、 Figure 3 and Figure 5A shown.
[0084] The compositions of the present invention can be used to modulate gene expression or function in eukaryotic cells in at least three ways: (i) contacting a single asRNA molecule with a cell or administering it to a subject; (ii) contacting different types of asRNA molecules with a cell at different times or administering them to a subject at different times; (iii) contacting different types of asRNA molecules with a cell or administering them to a subject simultaneously.
[0085] In certain embodiments, an asRNA comprises a nucleobase sequence region, referred to as a "targeting region," that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target segment of a targeted target gene, wherein the target gene includes both mRNA and non-coding RNA. In certain embodiments, the nucleobase sequence of an asRNA molecule comprises a sequence that is fully complementary to a target segment of a targeted target gene. In certain embodiments, the nucleobase sequence of an asRNA molecule contains no more than one, two, or three mismatches upon hybridization with the target segment of a target gene. In certain embodiments, the target gene is selected from an mRNA or non-coding RNA associated with a mammalian disease. In certain embodiments, at least one ISD is located within the targeting region of the asRNA. In certain embodiments, the ISD is located at or near the 5' end of the asRNA or at or near the 3' end of the strand. In other embodiments, the ISD is located in a more central portion of the asRNA (i.e., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases from either end, i.e., at position 2 or more from the end of the strand). In certain embodiments, at least one ISD can be located at any position in the asRNA.
[0086] In various embodiments, the asRNA has a backbone length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 linked nucleomonomers, or the equivalent thereof, or a range of lengths encompassed by any two of the foregoing values (both endpoints of the range are inclusive). For example, some ranges of asRNA chain lengths include: 8-48 nucleotide monomers; 8-44 nucleotide monomers; 8-42 nucleotide monomers; 8-40 nucleotide monomers; 8-36 nucleotide monomers; 8-33 nucleotide monomers; 10-48 nucleotide monomers; 10-44 nucleotide monomers; 10-42 nucleotide monomers; 10-40 nucleotide monomers; 10-36 nucleotide monomers; 10-30 nucleotide monomers; 10-29 nucleotide monomers; 12-48 nucleotide monomers; 12-44 nucleotide monomers; 12-42 nucleotide monomers; 12-40 nucleotide monomers; 12-36 nucleotide monomers; 12-34 nucleotide monomers; 12-32 nucleotide monomers; 12-30 nucleotide monomers; 12-29 nucleotide monomers; 12- 28 nucleotide monomers; 12-26 nucleotide monomers; 12-25 nucleotide monomers; 13-48 nucleotide monomers; 13-44 nucleotide monomers; 13-42 nucleotide monomers; 13-40 nucleotide monomers; 13-36 nucleotide monomers; 13-34 nucleotide monomers; 13-32 nucleotide monomers; 13-30 nucleotide monomers; 13-28 nucleotide monomers; 13-26 nucleotide monomers; 13-25 nucleotide monomers; 13-24 nucleotide monomers; 13-23 nucleotide monomers; 14-36 nucleotide monomers; 15-23 nucleotide monomers; 20-36 nucleotide monomers; 21-36 nucleotide monomers; 24-36 nucleotide monomers; at least 21 nucleotide monomers; at least 24 nucleotide monomers and at least 8 nucleotide monomers.
[0087] In certain embodiments, the length of asRNA is 8 to 36 (both endpoints of the scope are included therein) nucleotide monomers. In other words, asRNA is 8 to 36 (both endpoints of the scope are included therein) connected nucleobase monomers. In certain embodiments, asRNA is composed of 20-36 (both endpoints of the scope are included therein) connected nucleobase monomers. In other embodiments, asRNA comprises the oligonucleotide composed of 8 to 100, 10 to 80, 12 to 50, 14 to 30, 15 to 23, 16 to 22, 16 to 21 or 20 (both endpoints of the scope are included therein) connected nucleobases.
[0088] In the asRNA molecules of the present invention, at least one nucleotide monomer can be a modified nucleotide or nucleotide analog, such as a sugar-modified, backbone-modified, and / or base-modified nucleotide. In one embodiment, the backbone-modified nucleotide has at least one modification in the internucleoside bond, such as at least one of a nitrogen heteroatom or a sulfur heteroatom. In some embodiments, the modified internucleoside bond is or comprises: a phosphorothioate group (P=S), a phosphotriester, a methylphosphonate, or an aminophosphoester.
[0089] In certain embodiments, asRNA comprises at least one modified internucleoside bond.This modified internucleoside bond can be between two deoxyribonucleoside monomers, two ribonucleoside monomers, or a deoxyribonucleoside monomer and a ribonucleoside monomer.Alternatively, the phosphate group on the nucleoside monomer of at least one end can be modified.In certain embodiments, the internucleoside bond is a thiophosphate internucleoside bond.In certain embodiments, the internucleoside bond is a thiophosphoramidate internucleoside bond.In certain embodiments, the internucleoside bond of each oligonucleotide chain is a thiophosphate internucleoside bond.In certain embodiments, the internucleoside bond of all nucleosides in asRNA is a thiophosphate internucleoside bond, or a mixing of a thiophosphate bond and a phosphodiester bond.
[0090] In certain embodiments, the asRNA comprises at least one nucleoside monomer having a modified sugar moiety. Such a nucleoside monomer can be a deoxyribonucleoside monomer or a ribonucleoside monomer.
[0091] In certain embodiments, the 2' position of the modified sugar moiety is substituted with a group selected from the group consisting of OR, R, halogen, SH, SR, NH2, NHR, NR2, or CN, wherein each R is independently C1-C6 alkyl, alkenyl, or alkynyl, and halogen is F, Cl, Br, or I. In some embodiments, the 2' position of the modified sugar moiety is substituted with a group selected from the group consisting of allyl, amino, azido, thio, O-allyl, O-C1-C6 10Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n )、O-CH2-C(=O)-N(R m )(R n ), or O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n ), where each R1, R m and R n are independently H, or substituted or unsubstituted C1-C 10 In some embodiments, the modified sugar moiety has a substituent group selected from the group consisting of 5'-vinyl, 5'methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3. In some embodiments, the modified sugar moiety is substituted with a bicyclic sugar selected from the group consisting of 4′-(CH2)—O-2′(LNA), 4′-(CH2)—S-2′, 4′-(CH2)2—O-2′(ENA), 4′-CH(CH3)—O-2′(cEt), and 4′-CH(CH2OCH3)—O-2′, 4′-C(CH3)(CH3)—O-2′, 4′-CH2—N(OCH3)-2′, 4′-CH2—O—N(CH3)-2′, 4′-CH2—N(R)—O-2′ (wherein R is H, C1-C 12 alkyl or protecting group), 4′-CH2—C(H)(CH3)-2′, and 4′-CH2—C—(═CH2)-2′.
[0092] In some embodiments, the modified sugar moiety is selected from the group consisting of 2'-O-methoxyethyl modified sugars (MOE), 4'-(CH2)-O-2' bicyclic sugars (LNA), 2'-deoxy-2'-fluoroarabinose (FANA), and methyl(methyleneoxy) (4′-CH(CH3)—O-2) bicyclic sugar (cEt).
[0093] In certain embodiments, the asRNA of the present invention comprises at least one nucleoside monomer having a modified nucleobase. Such a nucleoside monomer can be a deoxyribonucleoside monomer or a ribonucleoside monomer.
[0094] In some embodiments, the modified nucleobase is selected from the group consisting of 5-methylcytosine (5-Me-C), hypoxanthine nucleobases, tritylated bases, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and other alkynyl derivatives of cytosine and pyrimidine bases, 6-phenylindole, 2 ... Azauracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 1-methylpseudouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.
[0095] In certain embodiments, the modified nucleobase in the molecules of the invention is 5-methylcytosine. In one embodiment, each cytosine base in the molecules of the invention is 5-methylcytosine. In certain embodiments, the modified nucleobase is 5-methyluracil. In certain embodiments, each uracil is 5-methyluracil.
[0096] In one feature, in the molecules of the present invention, the asRNA comprises linked ribonucleoside monomers and, in addition thereto, further comprises an ISD comprised of one or more linked deoxyribonucleoside monomers. Furthermore, there may be further ISD segments. The ISDs may be located at any position in the asRNA. In certain embodiments, one or more ISDs comprise a terminal nucleoside monomer or a penultimate terminal nucleoside monomer. In certain embodiments, one or more ISDs are inserted into a segment of ribonucleoside monomers, separating the segment into multiple segments. In certain embodiments, each ISD independently comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked ribonucleoside monomers.
[0097] In certain embodiments, at least one or each linked deoxynucleoside monomer of the ISD is a modified deoxynucleotide or deoxynucleotide analog. Deoxynucleotides can be modified in the same or similar manner to have modified internucleoside linkages, modified sugar moieties, and / or modified nucleobases.
[0098] In some embodiments, the asRNA molecules of the present invention may include at least one CpG group that can be recognized by a pattern recognition receptor (PRR), such as a Toll-like receptor.
[0099] In some embodiments, the sugar moiety of the deoxynucleotide monomer in the asRNA molecule is a naturally occurring deoxyribonucleotide sugar moiety (2-H) or 2'-deoxy-2'-fluoroarabinose (FANA).
[0100] In certain embodiments, the sugar portion of the ribonucleotide monomer in the asRNA molecule is selected from the group consisting of naturally occurring ribonucleotides (2-OH), 2'-F modified sugars, 2'-OMe modified sugars, 2'-O-methoxyethyl modified sugars (MOE), 4'-(CH2)—O-2' bicyclic sugars (LNA), and methyl(methyleneoxy) (4'-CH(CH3)—O-2) bicyclic sugars (cEt).
[0101] In certain embodiments, each ribonucleoside monomer of the asRNA molecule has a sugar modified with 2'-O-methoxyethyl, wherein each cytosine is 5-methylcytosine, each uracil is 5-methyluracil or methylpseudouracil, and wherein each internucleoside bond is a phosphorothioate bond. In certain embodiments, each deoxynucleoside monomer in the ISD has a sugar modified with 2'-deoxy-2'-fluoroarabinose (FANA), wherein each cytosine is 5-methylcytosine, and wherein each internucleoside bond is a phosphorothioate bond.
[0102] In certain embodiments, the molecules of the invention can be stabilized against degradation by at least one chemical modification or secondary structure. Not only can any or all nucleotide monomers in the asRNA be chemically modified, but they can also be conjugated to one or more moieties or ligands to enhance their functionality, for example, with moieties or ligands selected from the group consisting of: polypeptides, antibodies, antibody fragments, polymers, polysaccharides, lipids, hydrophobic moieties or molecules, cationic moieties or molecules, lipophilic compounds or oligonucleotide moieties, cholesterol, GalNAc, and nucleic acid aptamers.
[0103] In certain embodiments, the targeting region of molecule of the present invention does not comprise any mispairing or protrusion, and the targeting region and target oligonucleotide are fully complementary.In another embodiment, when asRNA and target RNA hybridize, its targeting region includes mispairing and / or protrusion.In one embodiment, whole asRNA and target RNA are fully complementary.
[0104] As is well known to those skilled in the art, mispairing bases can be introduced without eliminating activity. Similarly, the asRNA of the present invention can include a region of unpaired or mispairing when base pairing with the target RNA. Sometimes mispairing in the asRNA is needed to reduce the effect of missing the target or to realize other features of the asRNA.
[0105] In certain embodiments, the target is an mRNA or non-coding RNA associated with a mammalian disease. In certain embodiments, the target is an mRNA. In certain embodiments, the target is a non-coding RNA, such as a microRNA and a lncRNA. As long as the asRNA is substantially complementary to the target sequence, the asRNA occupies the target by hybridizing with the target sequence, thereby inactivating the target gene. 3. Modification
[0106] Nucleoside monomer is a kind of base-sugar composition.The core base (also referred to as base) part of nucleoside monomer is normally heterocyclic base part.Nucleoside monomer is the nucleoside monomer that further comprises the phosphate group that is covalently attached to the sugar part of nucleoside.For those nucleoside monomers that comprise pentofuranosyl sugar, the phosphate group can be attached to the 2 ', 3 ' or 5 ' hydroxyl part of sugar.Oligonucleotide is formed by adjacent nucleoside monomers being covalently attached to each other, to form linear polymeric oligonucleotide.In oligonucleotide structure, phosphate group is commonly referred to as the internucleoside bond that forms oligonucleotide.
[0107] The modification of asRNA molecule of the present invention comprises the replacement or the change of internucleoside bond, sugar moiety or core base.Modified asRNA is more preferred than its native form in some cases because ideal characteristic, for example the inhibitory activity that increases, the cellular uptake that enhances, the chain affinity, the solubility that increase, reduce non-specific interactions, and the resistance to RNase degradation or the stability that enhances.Therefore, usually can obtain the result similar to the short asRNA with the nucleoside monomer of this type of chemical modification.One or more natural nucleotides in the asRNA of the present invention can be replaced by modified nucleotide or nucleotide analog.Replacement can occur in any site of asRNA.
[0108] Modifications of oligonucleotides have been studied to improve the stability of various oligonucleotides, including antisense oligonucleotides, ribozymes, aptamers, and RNAi (Chiu and Rana, 2003; Czauderna et al., 2003; deFougerolles et al., 2007; Kim and Rossi, 2007; Mack, 2007; Zhang et al., 2006; Schrnidt, 2007; Setten RL et al., 2020; Crooke ST et al., 2018; and Roberts TC et al., 2020).
[0109] Any stabilizing modification known to those skilled in the art can be used to improve the stability of oligonucleotide molecules. Within oligonucleotide molecules, chemical modifications can be introduced into the phosphate backbone (e.g., phosphorothioate linkages), sugars (e.g., locked nucleic acids, glycerol nucleic acids, cEt, 2'-MOE, 2'-fluorouridine, 2'-O-methyl), and / or bases (e.g., 2'-fluoropyrimidine).
[0110] Several examples of such chemical modifications are summarized in the following sections.
[0111] In various embodiments, the modified nucleotide or nucleotide analog is a sugar-modified, backbone-modified, and / or base-modified nucleotide. 3.1 Modified internucleoside bonds or backbone-modified nucleotides
[0112] The naturally occurring internucleoside linkage in RNA and DNA is a 3' to 5' phosphodiester bond. AsRNA molecules of the invention having one or more modified internucleoside linkages (i.e., non-naturally occurring internucleoside linkages) in one or both chains are sometimes selected for desirable properties, such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases, compared to corresponding molecules having only naturally occurring internucleoside linkages.
[0113] The asRNA with modified internucleoside bond comprises the internucleoside bond that retains phosphorus atom and the internucleoside bond that does not have phosphorus atom.In one embodiment, the internucleoside bond of phosphodiester is modified to comprise at least one nitrogen heteroatom and / or sulfur heteroatom.Representational phosphorus-containing internucleoside bond includes, but is not limited to: phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramide and thiophosphate.The method for preparing phosphorus-containing and non-phosphorus-containing bond is well-known.
[0114] In one embodiment, the modified nucleotide or nucleotide analog is a modified nucleotide of the backbone. The modified nucleotide of the backbone may have a modification on the phosphodiester internucleoside bond. In another embodiment, the modified nucleotide of the backbone is a thiophosphate internucleoside bond. In certain embodiments, each internucleoside bond is a thiophosphate internucleoside bond. 3.2 Modified sugar moieties
[0115] The asRNA of the present invention may optionally contain one or more nucleoside monomers with modified sugar moieties. These sugar-modified nucleoside monomers can impart enhanced nuclease stability, increased binding affinity, or some other favorable biological properties to the asRNA. In certain embodiments, the nucleoside monomer comprises a chemically modified ribofuranose ring portion. Examples of chemically modified ribofuranose rings include, but are not limited to: the addition of substituents; including 5' and 2' substituents, non-geminal ring atoms bridged to form bicyclic nucleic acids (BNAs), with S, N(R) or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C 12 In some embodiments, the ribosyl ring oxygen atom is replaced by an alkyl or protecting group, and a combination thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (for other disclosed 5', 2'-disubstituted nucleosides, see PCT International Application WO2008 / 101157, published on August 21, 2008), or ribosyl ring oxygen atom is replaced by S and further substituted at the 2'-position (see U.S. Patent Application US2005-0130923, published on June 16, 2005), or optional 5'-substituted BNA (see PCT International Application WO2007 / 134181, published on November 22, 2007, wherein LNA is, for example, 5'-methyl or 5'-vinyl substituted).
[0116] Examples of nucleoside monomers with modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3 substituents. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(Rm)(Rn), O-CH2-C(=O)-N(Rm)(Rn) and O-CH2-C(=O)-N(R1)-(CH2)2-N(Rm)(Rn), wherein each R1, Rm and Rn are independently H, or substituted or unsubstituted C1-C 10 alkyl.
[0117] Bicyclic nucleosides are modified nucleosides having a bicyclic sugar moiety. Examples of bicyclic nucleic acids (BNAs) include, but are not limited to, nucleosides comprising a bridging group between the 4' and 2' ribosyl ring atoms. In certain embodiments, the asRNA provided herein comprises one or more BNA nucleosides, wherein the bridging group in the BNA nucleoside comprises one of the following formulae: 4′-(CH2)—O-2′(LNA), 4′-(CH2)—S-2, 4′-(CH2)2—O-2′(ENA), 4′-CH(CH3)—O-2′ and 4′-CH(CH2OCH3)—O-2′ (and the like, see U.S. Pat. No. 7,399,845, issued on July 15, 2008); 4′-C(CH3)(CH3)—O-2′ (and the like, see U.S. Pat. No. WO / 2009 / 0064, published on January 8, 2009); 78); 4′-CH2—N(OCH3)-2′ (and analogs thereof, see PCT / US2008 / 064591 published as WO / 2008 / 150729 on December 11, 2008); 4′-CH2—O—N(CH3)-2′ (see U.S. patent application US2004-0171570 published on September 2, 2004); 4′-CH2—N(R)—O-2′, wherein R is H, C1-C 12 alkyl or protecting groups (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008); 4′-CH2—C(H)(CH3)-2′ (see, Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2—C-(═CH2)-2′ (and the like, see PCT / US2008 / 066154, published Dec. 8, 2008, and disclosed as W2008 / 154401).
[0118] In certain embodiments, bicyclic nucleosides include, but are not limited to: (A) α-L-methyleneoxy (4′-CH2-O-2) BNA, (B) β-D-methyleneoxy (4′-CH2-O-2) BNA, (C) vinyloxy (4′-(CH2)2—O-2′) BNA, (D) aminooxy (4′-CH2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH2—N(R)—O-2) BNA, (F) methyl (methyleneoxy) (4′-CH(CH3)—O-2) BNA (also known as constrained ethyl) ethyl) or cEt), (G) methylenethio (4′-CH2—S-2′) BNA, (H) methyleneamino (4′-CH2-N(R)-2′) BNA, (I) methyl carbocycle (4′-CH2-CH(CH3)-2) BNA, (J) propylene carbocycle (4′-(CH2)3-2′) BNA and (K) vinyl BNA.
[0119] In certain embodiments, the modified nucleotide or nucleotide analog is a sugar-modified ribonucleotide, wherein the 2'-OH group is substituted with a group selected from the group consisting of H, OR, R, halogen, SH, SR, NH2, NHR, NR2, and CN, wherein each R is independently selected from the group consisting of C1-C6 alkyl, alkenyl, or alkynyl, and halogen selected from the group consisting of F, Cl, Br, or I. In certain embodiments, the sugar-modified ribonucleotide is selected from the group consisting of 2'-OMe-modified nucleotides, 2'-F-modified nucleotides, 2'-O-methoxyethyl (2'MOE)-modified nucleotides, LNA (locked nucleic acid)-modified nucleotides, GNA (glycerol nucleic acid)-modified nucleotides, and cEt (constrained ethyl)-modified nucleotides.
[0120] Chemical modifications at the 2' position of the ribose sugar can stabilize the molecules of the present invention. For example, 2'-O-methylpurines and 2'-fluoropyrimidines can increase their resistance to endonuclease activity in serum. The site of introduction of the modification should be carefully selected to avoid significantly reducing the silencing / regulatory capacity of the molecule. In certain embodiments, the first nucleomonomer adjacent to the 5'-terminal nucleomonomer of the chain is a 2'-fluororibonucleotide. 3.3 Modified nucleobases
[0121] asRNA can also have modified or substituted nucleobases (or bases). Although nucleobase (or base) modifications or substitutions are structurally different from naturally occurring or synthetic unmodified nucleobases, they are functionally interchangeable therewith. Both natural and modified nucleobases are capable of participating in hydrogen bonding. The nucleobase modifications can confer nuclease stability, binding affinity, or some other favorable biological properties on the asRNA molecule. Modified nucleobases include synthetic and natural nucleobases, such as, for example, 5-methylcytosine (5-Me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for improving the binding affinity of antisense strands. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
[0122] Other modified nucleobases include, but are not limited to: 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 1-methylpseudouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine Pyrimidine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0123] Heterocyclic base moieties can include those in which a purine or pyrimidine base is substituted with another heterocycle, such as 7-deazaadenine, 7-deazaguanine, 2-aminopyridine, and 2-pyridone. Nucleobases particularly useful for increasing antisense strand binding affinity include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.
[0124] In certain embodiments, the modified nucleotide or nucleotide analog is a base-modified nucleotide. In one embodiment, the modified nucleotide or nucleotide analog has a rare base or a modified base. In certain embodiments, the modified base is 5-methylcytosine (5'-Me-C). In certain embodiments, each cytosine is 5-methylcytosine. In certain embodiments, the modified base is 5-methyluracil (5'-Me-U). In certain embodiments, each uracil is 5-methyluracil.
[0125] Any modified nucleotide or analog that may be advantageous for stability or affinity may be prepared without departing from the spirit and scope of the present invention. Several examples of such chemical modifications are the same as summarized above. 4. Pharmaceutical Compositions
[0126] In some embodiments, the present invention also provides a pharmaceutical formulation comprising an asRNA of the present invention or a pharmaceutically acceptable derivative thereof and at least one pharmaceutically acceptable excipient or carrier. As used herein, "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. that are compatible with pharmaceutical administration. Suitable carriers are described in "Remington: The Science and Practice of Pharmacy, Twentieth Edition," Lippincott Williams & Wilkins, Philadelphia, PA," which is incorporated herein by reference. Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous carriers, such as fixed oils, may also be used. It is well known in the art that such media and agents can be used in pharmaceutically active substances. Unless any conventional media or agents are incompatible with the asRNA molecules, they are considered for use in the composition.
[0127] Examples of pharmaceutically acceptable carriers that can be used with the molecules of the invention include, but are not limited to, pharmaceutical carriers, positively charged carriers, liposomes, lipid nanoparticles, protein carriers, hydrophobic moieties or molecules, cationic moieties or molecules, GalNAc, polysaccharide polymers, nanoparticles, nanoemulsions, cholesterol, lipids, lipophilic compounds or moieties, and lipids.
[0128] In certain embodiments, the present invention provides a method of treating a subject in need thereof, comprising administering a therapeutically effective amount of a pharmaceutical composition. In one embodiment, the pharmaceutical composition is administered by a route selected from the group consisting of intravenous injection (iv), subcutaneous injection (sc), oral administration (po), intramuscular (im), oral administration, inhalation, topical, intrathecal, and other site administration. In another embodiment, the therapeutically effective amount is 1 ng to 1 g per day, 100 ng to 1 g per day, or 1 μg to 1000 mg per day.
[0129] Formulation methods are disclosed in PCT International Application PCT / US02 / 24262 (WO03 / 011224), US Patent Application Publication No. 2003 / 0091639, and US Patent Application Publication No. 2004 / 0071775, each of which is incorporated herein by reference.
[0130] The asRNA molecules of the present invention are administered in a suitable dosage form prepared by combining a therapeutically effective amount (e.g., an effective level sufficient to achieve the desired therapeutic effect by inhibiting tumor growth, killing tumor cells, treating or preventing cell proliferative diseases, etc.) of the asRNA molecules of the present invention (as active ingredients) with a standard pharmaceutical carrier or diluent according to conventional procedures (i.e., producing a pharmaceutical composition of the present invention).
[0131] These steps may involve appropriately mixing, granulating and compressing or dissolving the ingredients to obtain the desired formulation. In another embodiment, a therapeutically effective amount of the asRNA molecule is administered in a suitable dosage form without a standard pharmaceutical carrier or diluent. In some embodiments, a therapeutically effective amount of the molecule of the present invention is administered in a suitable dosage form. Pharmaceutically acceptable carriers include solid carriers such as lactose, terra alba, sucrose, talc, gelatin, agar, pectin, gum arabic, magnesium stearate, stearic acid, etc. Exemplary liquid carriers include syrup, peanut oil, olive oil, water, etc. Similarly, carriers or diluents may include time delay materials known in the art, such as monostearate or distearate, used alone or in combination with wax, ethyl cellulose, hydroxypropyl methylcellulose, methyl methacrylate, etc. Other fillers, excipients, flavorings, and other additives as known in the art may also be included in pharmaceutical compositions according to the present invention.
[0132] The pharmaceutical composition of the present invention can be prepared in a well-known manner, for example, by conventional mixing, dissolving, granulating, sugar coating, grinding, emulsifying, encapsulating, embedding or lyophilizing processes. Pharmaceutical compositions can be prepared in a conventional manner using one or more physiologically acceptable carriers comprising excipients and / or adjuvants that promote the processing of antisense oligonucleotides into pharmaceutically acceptable formulations. Of course, suitable formulations depend on the selected route of administration.
[0133] The compositions, compounds, combinations or pharmaceutical compositions of the present invention can be applied to subjects using many well-known methods currently used for chemotherapy. For example, to treat cancer, the asRNA molecules of the present invention can be injected directly into a tumor, injected into the bloodstream or body cavity, or administered orally or through a skin patch. For the treatment of psoriatic conditions, systemic administration (e.g., oral administration) or topical administration to the affected skin area are preferred routes of administration. The selected dosage should be sufficient to constitute an effective treatment, but not so high as to cause unacceptable side effects. During and after treatment, the disease condition (e.g., cancer, psoriasis, etc.) and the patient's health should be closely monitored within a reasonable period of time. 5. Use 5.1 Usage
[0134] The present invention also provides a method for regulating gene expression or function in a cell or organism. The cell can be a eukaryotic cell, such as a mammalian cell. The method comprises the following steps: contacting the cell or organism with an asRNA molecule disclosed herein, and, under conditions conducive to selective gene silencing, mediating selective gene silencing of a target nucleic acid having a sequence portion substantially complementary to the antisense strand of the asRNA molecule via the asRNA molecule. The target nucleic acid can be RNA, such as mRNA or non-coding RNA, wherein the RNA encodes a protein associated with a disease or regulates a portion of a biological pathway associated with the disease.
[0135] In one embodiment, the contacting step includes introducing the asRNA molecule into a target cell or organism in a culture in which selective gene silencing can occur. In another embodiment, the introducing step includes mixing, transfection, lipofection, infection, electroporation or other delivery technology. In another embodiment, the introducing step includes using a pharmaceutically acceptable excipient, carrier or diluent to administer intravenously, subcutaneously, intrathecally, orally, by suction, topically or by other clinically acceptable administration methods, wherein the pharmaceutically acceptable excipient, carrier or diluent is selected from a pharmaceutical carrier, a positively charged carrier, a liposome, a lipid nanoparticle, a protein carrier, a polymer, a nanoparticle, a nanoemulsion, a lipid, N-acetylgalactosamine (GalNAc), a lipophilic compound or part, and a lipid.
[0136] In one embodiment, the silencing method is used to determine the function or utility of a gene in a cell or organism.
[0137] In one embodiment, the gene or RNA targeted by the compositions of the present invention is associated with a disease (e.g., a human disease or an animal disease), a pathological condition, or an adverse condition. In a further embodiment, the target gene or target RNA is a gene or RNA of a pathogenic microorganism. In an even further embodiment, the target gene or target RNA is a gene or RNA of viral origin. In another embodiment, the target gene or target RNA is a tumor-associated gene or RNA.
[0138] In an optional embodiment, the gene or RNA targeted by the composition of the present invention is a gene or RNA associated with the following diseases: cancer, autoimmune diseases, inflammatory diseases, degenerative diseases, infectious diseases, proliferative diseases, metabolic diseases, immune-mediated disorders, allergic diseases, skin diseases, malignancies, gastrointestinal diseases, liver diseases, respiratory disorders, cardiovascular disorders, skin diseases, kidney diseases, rheumatoid diseases, nervous system disorders, mental disorders, endocrine disorders, or diseases or disorders associated with aging. 5.2 Treatment
[0139] The present invention also provides methods for treating or preventing various diseases or conditions, including those that can be treated or prevented by ASOs and siRNAs (Czech, 2006; de Fougerolles et al., 2007; Dykxhoorn et al., 2003; Kim and Rossi, 2007; Mack, 2007; Crooke ST et al., 2018; Setten RL et al., 2019; Roberts TC et al., 2020). The method comprises administering an effective amount of an asRNA molecule to a subject in need thereof under conditions in which the desired gene inhibition (described in Section 5.1 above) occurs.
[0140] In an exemplary embodiment, a therapeutically effective amount of a pharmaceutical composition having an asRNA molecule and a pharmaceutically acceptable excipient, carrier, or diluent is administered to a subject in need thereof to treat or prevent a disease or adverse condition.
[0141] In some embodiments, the present invention can be used to treat or prevent cancer. AsRNA compositions can be used to silence or knock down genes associated with cell proliferation or other cancer phenotypes. Examples of these genes are k-Ras, β-catenin, and Stat3. These oncogenes are associated with many types of cancer.
[0142] The novel compositions of the present invention can also be used to treat or prevent ocular diseases (e.g., age-related macular degeneration (AMD) and diabetic retinopathy (DR)); infectious diseases (e.g., HIV / AIDS, hepatitis B virus (HBV), hepatitis C virus (HCV), human papillomavirus (HPV), herpes simplex virus (HSV), RCV, cytomegalovirus (CMV), dengue fever, West Nile virus); respiratory diseases (e.g., respiratory syncytial virus (RSC), asthma, cystic fibrosis); neurological diseases (e.g., Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), spinal cord injury, Parkinson's disease, Alzheimer's disease, pain); cardiovascular diseases; metabolic disorders (e.g., hyperlipidemia, hypercholesterolemia, and diabetes); genetic diseases; and inflammatory conditions (e.g., inflammatory bowel disease (IBD), arthritis, rheumatoid disease, autoimmune diseases), and skin diseases.
[0143] In another embodiment, the method of administration is selected from the group consisting of intravenous injection (iv), subcutaneous injection (sc), oral (po), intrathecal, inhalation, topical and regional administration. Example
[0144] The following examples are provided to further illustrate various features of the present invention. The examples also illustrate useful methods for practicing the present invention. These examples do not limit the claimed invention. Methods and Materials Cell culture
[0145] HepaRG cells were grown in William's Medium supplemented with 10% FBS, 10 mg / ml hydrocortisone, and 4 mg / ml human recombinant insulin.Other suitable commercially available cell lines known to those skilled in the art can be purchased and used. asRNA transfection cells
[0146] 24 hours before transfection, HepaRG cells or other commonly used cell lines were seeded into 6-well plates (1x10 5 cells / 2 mL / well). As described in the preparation method, RNAiMAX (Thermo Fisher, USA) was used to transfect asRNA at different final concentrations, such as 100 pM or 10 nM. Briefly, asRNA and RNAiMAX were incubated in serum-free OPTI-MEM (Thermo Fisher) for 20 minutes and then added to cells containing culture medium. Quantitative PCR
[0147] Transfected cells were harvested 48 hours after transfection with the asRNAs. RNA was isolated using TRIZOL and subjected to qRT-PCR using TaqMan One-Step RT-PCR Reagents and APOCIII mRNA detection using the APOCIII assay. GAPDH mRNA levels were used as an internal control.
[0148] Target sequence
[0149] In order to study the gene silencing effect of the asRNA disclosed in the present invention, asRNAs targeting different genes were designed and produced. Table 1 below lists the target genes, target sequences, and sequences of exemplary asRNAs designed and used. Table 1 Target sequences and exemplary asRNA sequences used in the following examples target genes Accession# Target sequence (5' to 3') SEQ ID NO. Antisense sequence (5' to 3') SEQ ID NO. APOCIII NM_000040 ATAAAGCTGGACAAGAAGCT 36 AGCUUCUUGUCCAGCUUUAU 37 Example 1: Structure-Activity Relationship (SAR) of asRNAs with Various ISDs
[0150] Figure 1 Various structural designs of a series of embodiments of asRNAs with different ISDs are shown (labeled asRNA_1-13). asRNA_1-13 targeting the APOCIII gene were designed. Corresponding antisense single-stranded RNAs (ASRs) without ISDs were also designed for comparison (structure and sequence as shown in FIG. Figure 1 The gene silencing activities of these asRNAs and corresponding ASRs at 10 nM concentration were tested in HepaRG cells ( Figure 2 ).
[0151] exist Figure 1 In the illustrated structures, the letter "D" represents a DNA residue or a deoxynucleotide monomer; the letter "R" represents an RNA residue or a ribonucleotide monomer. The letters "dA, dT, dG, dC" in the sequence represent a DNA residue; the letters "mA, mU, mG, mC" in the sequence represent a 2'-MOE-modified RNA residue; and the "*" in the illustrated structures and sequences represents a PS (phosphorothioate internucleoside linkage).
[0152] The results showed that all designed asRNAs containing at least one ISD exhibited stronger and more effective gene silencing activities compared with the corresponding ASRs without ISD. Example 2: SAR of asRNAs with different ISD positions
[0153] Figure 3Different structural designs of another series of embodiments of asRNA are shown, in which the length of the asRNA and the number of deoxynucleotide monomers in the ISD are kept constant while the position of the ISD is varied (labeled as D10-SH1 to D10-SH11). Figure 3 The exemplary sequences of asRNAs targeting APOCIII gene are also shown. The gene silencing activity of these asRNAs D10-SH1 to D10-SH11 targeting APOCIII gene at a concentration of 10 nM was detected in HepaRG cells. Figure 4 shown.
[0154] exist Figure 3 In the structures and sequences shown, all letters “D”, “R”, “dA, dT, dG, dC”, “mA, mU, mG, mC” and all “*” are the same as Figure 1 Mean the same thing.
[0155] The results showed that all designed asRNAs with different ISD positions exhibited potent gene silencing activity. Example 3: SAR of asRNAs of different lengths
[0156] Figure 5A Shown the different structural designs of another series of embodiments of asRNA. In these asRNA, designed the asRNA molecules with different lengths of targeting APOCIII gene (labeled as AS-8nt to AS-36nt, structure and sequence as Figure 5A The gene silencing activity of the designed asRNAs with a length of 8-36 nt was directed against the APOCIII gene they targeted. The gene silencing activity of these asRNAs at concentrations of 100 pM and 10 nM was tested in HepaRG cells ( Figure 5B and Figure 5C ).
[0157] exist Figure 5A In the figure, all lowercase letters "a, c, g, t" represent DNA residues; all uppercase letters "A, C, G, U" represent 2'-MOE-modified RNA residues, wherein all "U" are 5-methyluracil 2'-MOE RNA residues; wherein all "C" and "c" are 5-Me-C; all "*" represent PS (phosphorothioate internucleoside linkages).
[0158] The results showed that all asRNAs designed to be at least 10 linked nucleotides in length exhibited robust gene silencing activity. A surprising finding was that longer asRNAs had stronger gene silencing activity, particularly asRNAs 20 nt or longer. In comparison, the typical length of an ASO is 16-20 nt. The gene silencing activity of asRNAs longer than 20 nt was even stronger than that of typical ASOs optimized using state-of-the-art technology.
[0159] The results in Examples 1-3 strongly suggest that asRNAs with ISD designed according to the principles of the present invention can achieve powerful gene silencing efficacy. Equivalent
[0160] The representative examples are intended to help illustrate the present invention and are not intended to, and should not be construed to, limit the scope of the present invention. Indeed, various modifications of the present invention and numerous further embodiments thereof, in addition to those shown and described herein, will be apparent to those skilled in the art from the entire contents of this document, including the examples and the citations to the scientific and patent literature contained herein. The examples contain important additional information, illustrations, and guidance that can be applied in practicing the various embodiments of the present invention and their equivalents.
[0161] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. The methods described herein can be performed in any order that is logically possible, except in the specific order disclosed. Incorporated by Reference
[0162] References and citations have been made to other documents in this disclosure, such as patents, patent applications, patent publications, periodicals, books, papers, and online content. All such documents are incorporated herein by reference in their entirety for all purposes. Any material or portion thereof incorporated herein by reference that conflicts with existing definitions, statements, or other public materials explicitly set forth herein is incorporated only to the extent that the incorporated material does not conflict with the present disclosure. In the event of a conflict, the material or portion thereof supporting the present disclosure will be used as the preferred disclosure to resolve the conflict. References 1.Xu JZ,Zhang JL,Zhang WG.Antisense RNA:the new favorite in geneticresearch.J Zhejiang Univ Sci B.2018 Oct.;19(10):739-749.doi:10.1631 / jzus.B1700594.PMID:30269442;PMCID:PMC6194357. 2.C.Frank Bennett and Eric E.Swayze,RNA Targeting Therapeutics:Molecular Mechanisms of Antisense Oligonucleotides as a Therapeutic Platform.Annu.Rev.Pharmacol.Toxicol.2010.50:259–93. 3.C.Frank Bennett.Therapeutic Antisense Oligonucleotides Are Comingof Age.Annu Rev Med.2019 Jan 27;70:307-321.doi:10.1146 / annurev-med-041217-010829.PMID:30691367. 4.Crooke ST,Witztum JL,Bennett CF,Baker BF.RNA-TargetedTherapeutics.Cell Metab.2018 Apr 3;27(4):714-739.doi:10.1016 / j.cmet.2018.03.004.Erratumin:Cell Metab.2019 Feb 5;29(2):501.PMID:29617640. 5.Roberts TC,Langer R,Wood MJA.Advances in oligonucleotide drugdelivery.Nat Rev Drug Discov.2020 Oct;19(10):673-694.doi:10.1038 / s41573-020-0075-7.Epub 2020 Aug 11.PMID:32782413;PMCID:PMC7419031. 6.de Fougerolles A,Vornlocher HP,Maraganore J,Lieberman J.Interferingwith disease:a progress report on siRNA-based therapeutics.Nature Rev DrugDiscov.2007;6:443–453.[PubMed:17541417]
Claims
1. A short antisense RNA (asRNA) molecule comprising a single strand of linked nucleotide monomers, wherein the strand is substantially complementary to a target segment of a target RNA through at least one targeting region, and The asRNA molecule comprises at least one deoxynucleoside monomer spacer (ISD), and the ISD comprises at least one deoxynucleoside monomer.
2. The asRNA molecule of claim 1, wherein the asRNA has at least one improved gene regulatory property or pharmaceutical property compared to a corresponding single-stranded antisense RNA without an ISD.
3. The asRNA molecule of claim 1, wherein the at least one ISD comprises at least one deoxynucleoside monomer, or at least 2, 3, 4, 5, 6, 7 or 8 consecutive deoxynucleoside monomers.
4. The asRNA molecule of claim 1, wherein the ISD comprises at least 2 consecutive deoxynucleotide monomers.
5. The asRNA molecule according to any one of claims 1 to 4, wherein at least one ISD is distributed in at least one targeting region.
6. The asRNA molecule of any one of claims 1-5, wherein the strand is at least 70%, 80%, 85%, 90%, 95% complementary or fully complementary to the target segment of the target RNA.
7. The asRNA molecule of any one of claims 1 to 6, wherein the asRNA has a length selected from the group consisting of: 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nucleomonomers.
8. The asRNA molecule of claim 7, wherein the asRNA has a length selected from the group consisting of: a) 8-50 nucleotide monomers, b) 10-48 nucleotide monomers, c) 10-36 nucleotide monomers, d) 12-36 nucleotide monomers, e) 12-25 nucleotide monomers, and f) 21-36 nucleotide monomers.
9. The asRNA molecule according to any one of claims 1-8, wherein at least one nucleotide monomer is a modified nucleotide or nucleotide analog.
10. The asRNA molecule of claim 9, wherein the modified nucleotide or nucleotide analog is a sugar-modified, backbone-modified, and / or base-modified nucleotide.
11. The asRNA molecule of claim 10, wherein the backbone modified nucleotides have modifications on the internucleoside linkages, wherein: (a) the internucleoside linkage is modified to include at least one of a nitrogen heteroatom or a sulfur heteroatom; (b) the modified internucleoside linkage is selected from the group consisting of a phosphorothioate group (P=S), a phosphotriester, a methylphosphonate, and a phosphoramidate; and / or (c) The asRNA comprises at least one modified internucleoside linkage, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
12. The asRNA molecule of claim 11(c), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
13. The asRNA molecule of claim 9, wherein the modified nucleotide or nucleotide analog comprises a modified sugar moiety, wherein: (a) The 2' position of the modified sugar moiety is substituted with a group selected from the group consisting of OR, R, halogen, SH, SR, NH2, NHR, NR2 and CN, wherein each R is independently C1-C6 alkyl, alkenyl or alkynyl, and halogen is F, Cl, Br or I. (b) The 2' position of the modified sugar moiety is substituted with a group selected from the group consisting of allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n )、O-CH2-C(=O)-N(R m )(R n ) and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n ), where each R1, R m and R n are independently H, or substituted or unsubstituted C1-C 10 alkyl. (c) The modified sugar moiety is selected from the group consisting of 5'-vinyl, 5'methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F and 2'-O(CH2)2OCH3 substituents. (d) the modified sugar moiety is substituted with a bicyclic sugar selected from the group consisting of 4′-(CH2)—O-2′(LNA), 4′-(CH2)—S-2′, 4′-(CH2)2—O-2′(ENA), 4′-CH(CH3)—O-2′(cEt) and 4′-CH(CH2OCH3)—O-2′, 4′-C(CH3)(CH3)—O-2′, 4′-CH2—N(OCH3)-2′, 4′-CH2—O—N(CH3)-2′, 4′-CH2—N(R)—O-2′ (wherein R is H, C1-C 12 alkyl or protecting group), 4′-CH2—C(H)(CH3)-2′, and 4′-CH2—C—(═CH2)-2′; and / or (e) The modified sugar moiety is selected from the group consisting of: a 2'-O-methyl modified sugar, a 2'-O-methoxyethyl modified sugar (MOE), a 4'-(CH2)-O-2' bicyclic sugar (LNA), a 2'-deoxy-2'-fluoroarabinose (FANA), and a methyl(methyleneoxy)(4'-CH(CH3)-O-2) bicyclic sugar (cEt).
14. The asRNA molecule of claim 9, wherein the modified nucleotide or nucleotide analog comprises a modified nucleobase, wherein: (a) The modified nucleobase is selected from the group consisting of: 5-methylcytosine (5-Me-C), hypoxanthine nucleobases, tritylated bases, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 1-methyl-pseudouracil, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and other alkynes of cytosine and pyrimidine bases and / or d-uracil, ... (b) The modified nucleobase is 5-methylcytosine.
15. The asRNA molecule of any one of claims 1-14, wherein the asRNA is used to regulate gene expression or function in a cell; wherein the cell is a eukaryotic cell; wherein the eukaryotic cell is a mammalian cell.
16. The asRNA molecule according to claim 1, wherein the target RNA is mRNA, pre-mRNA, mt-mRNA or non-coding RNA, which either encodes a protein associated with the disease or regulates a portion of a biological pathway associated with the disease.
17. The asRNA molecule of claim 1, wherein the target RNA is selected from the group consisting of: a) mRNA, pre-mRNA or mt-RNA of a gene associated with a human or animal disease or condition, b) mRNA or pre-mRNA of pathogenic microorganism genes, c) viral RNA, d) lncRNA, e) miRNA, and f) RNA associated with a disease or disorder selected from the group consisting of autoimmune diseases, inflammatory diseases, degenerative diseases, infectious diseases, proliferative diseases, metabolic diseases, immune-mediated disorders, allergic diseases, skin diseases, cachexia, gastrointestinal diseases, respiratory disorders, cardiovascular disorders, renal diseases, rheumatoid diseases, nervous system disorders, endocrine disorders, and diseases associated with aging.
18. The asRNA molecule of any one of claims 1-17, wherein the asRNA is conjugated to a ligand or moiety.
19. The asRNA molecule of claim 18, wherein the ligand or moiety is selected from the group consisting of a polypeptide, an antibody, a polymer, a polysaccharide, a lipid, a hydrophobic moiety or molecule, a cationic moiety or molecule, a lipophilic compound or moiety, an oligonucleotide, cholesterol, GalNAc, and a nucleic acid aptamer.
20. A pharmaceutical composition comprising asRNA molecule according to any one of claims 1 to 19 as an active agent and a pharmaceutically acceptable excipient, carrier or diluent.
21. The pharmaceutical composition of claim 20, wherein the carrier is selected from the group consisting of a drug carrier, a positively charged carrier, a lipid nanoparticle, a liposome, a protein carrier, a hydrophobic moiety or molecule, a cationic moiety or molecule, GalNAc, a polysaccharide polymer, a nanoparticle, a nanoemulsion, cholesterol, a lipid, a lipophilic compound or moiety, and a lipid.
22. A method for treating or preventing a disease or condition, wherein the method comprises administering to a subject in need thereof a therapeutically effective dose of the asRNA molecule of any one of claims 1-19 or the pharmaceutical composition of claim 20 or claim 21.
23. The method of claim 22, wherein the disease or condition is selected from the group consisting of cancer, autoimmune diseases, inflammatory diseases, degenerative diseases, infectious diseases, proliferative diseases, metabolic diseases, immune-mediated disorders, allergic diseases, skin diseases, malignancies, gastrointestinal diseases, liver diseases, respiratory disorders, cardiovascular disorders, skin diseases, kidney diseases, rheumatoid diseases, nervous system disorders, psychiatric disorders, endocrine disorders, and disorders or diseases associated with aging.
24. The method of claim 23, wherein the asRNA molecule or pharmaceutical composition is administered by a route selected from the group consisting of intravenous injection (iv), subcutaneous injection (sc), oral administration (po), intramuscular injection (im), oral administration, inhalation, topical, intrathecal, and other sites of administration.
25. A method for regulating gene expression or gene function in a eukaryotic cell, wherein the method comprises contacting the cell with an effective amount of the asRNA molecule of any one of claims 1-19 or the pharmaceutical composition of claim 20 or 21.
Citation Information
Patent Citations
Pharmaceutical compositions containing beta-lapachone, or derivatives or analogs thereof, and methods of using same
US20030091639A1
Pharmaceutical compositions containing beta-lapachone, or derivatives or analogs thereof, and methods of using same
US20040071775A1
Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040171570A1
4'-thionucleosides and oligomeric compounds
US20050130923A1
6-modified bicyclic nucleic acid analogs
US7399845B2