Glycosyl transferase genes and application thereof in preparation of mogroside

By discovering and developing novel mogroside glycosyltransferase genes UGT153033 and UGT30033 and their mutants, the problem of insufficient number of mogroside biosynthesis genes has been solved, achieving efficient synthesis and increased yield of mogroside.

CN121759487APending Publication Date: 2026-03-31GUANGXI ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-24
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

In existing technologies, there are few genes related to the biosynthesis of mogrosides, the molecular synthesis mechanism is unclear, and the content of mogrosides in the whole fruit is extremely low, making it difficult to achieve large-scale production.

Method used

By integrating functional genomics, transcriptomics, metabolomics and bioinformatics technologies, novel glycosyltransferase genes UGT153033 and UGT30033 were discovered. Through sequence alignment and conserved domain analysis, a gene library of glycosyltransferase family was constructed, and mutants of these genes were developed for catalyzing the glycosylation reaction of mogroside.

Benefits of technology

The method achieves efficient synthesis of mogrosides, increases the yield of mogrosides, specifically recognizes C3-OH, C3-O-Glc and C24-O-Glc sites to achieve sugar chain elongation, and improves the synthetic pathway and yield of mogrosides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759487A_ABST
    Figure CN121759487A_ABST
Patent Text Reader

Abstract

The invention discloses a group of glycosyl transferase genes and application of the glycosyl transferase genes in preparation of mogroside, the glycosyl transferase genes are two new glycosyl transferase genes obtained by mining in a siraitia grosvenorii genome for the first time, are respectively named as UGT153033 and UGT30033, and have nucleotide sequences as shown in SEQ ID NOs: 1 and 2; meanwhile, the invention discloses glycosyl transferase coded by the glycosyl transferase gene and a mutant of the glycosyl transferase, wherein the glycosyl transferase and the mutant are respectively shown as SEQ ID NOs: 3-11; meanwhile, the invention also discloses a nucleic acid construct or an expression vector containing the gene or expressing the glycosyl transferase, and a host cell transformed by the nucleic acid construct or the expression vector. A new gene is provided for artificially synthesizing mogroside monomers, and the defects that the number of genes related to existing mogroside biosynthesis is small, and the molecular synthesis mechanism of most mogroside compounds is not clear yet are overcome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a group of glycosyltransferase genes and their application in the preparation of mogrosides. Background Technology

[0002] Natural products are bioactive substances that have been selected and optimized by nature over a long period of time, and are the most important source of drug discovery. Mogrosides are a general term for saponins isolated from *Siraitia grosvenorii*, a plant in the Cucurbitaceae family, and are a class of triterpenoid compounds. Mogrosides are the main bioactive components of *Siraitia grosvenorii* and possess numerous pharmacological activities, including antitussive and expectorant effects, anticancer properties, antioxidant effects, and blood sugar regulation. Currently, about 20 types of mogrosides have been isolated. However, the total saponin content in *Siraitia grosvenorii* is low, only 0.8%–1.3% (w / w) in the whole fruit, and the complex structure of these substances makes purification difficult. Therefore, large-scale production cannot be achieved by relying on extraction from *Siraitia grosvenorii*.

[0003] The synthesis and yield enhancement of mogrosides using biotechnology has become a research hotspot. In recent years, researchers have conducted studies on the biosynthesis of mogrosides through tissue culture and biotransformation, providing basic components for the production of mogrosides through synthetic biology techniques. Itkin et al. identified glycosyltransferase UGT720-269-1, which acts on the C3-OH and C24-OH sites of mogroside derived from monk fruit, and glycosyltransferase UGT94-289-3, which acts on the C3-O-Glc and C24-O-Glc sites of mogroside IIe. In addition, the glycosyltransferase UGT74AC1, which acts on the C3-OH site of mogroside, discovered and identified by Sun Yuanxia's team, showed a nearly thousand-fold increase in catalytic activity after semi-rational design modification, and also gained additional C24-OH glycan elongation function. However, to date, the number of known functional genes involved in the biosynthesis of mogrosides is still relatively small, especially glycosyltransferase genes that can catalyze the elongation of sugar chains. The molecular synthesis mechanism of most mogrosides has not yet been fully elucidated. Summary of the Invention

[0004] In view of the shortcomings of existing technologies, such as the limited number of genes known to be related to the biosynthesis of mogrosides, the unclear molecular synthesis mechanisms of most mogroside compounds, and the extremely low content of mogrosides in whole fruit, this invention provides a set of novel glycosyltransferase genes that can act on the C3-OH, C3-O-Glc, and C24-O-Glc sites of mogrosides to extend glucosinolates, and their application in the preparation of high-sugar mogrosides.

[0005] The glycosyltransferase gene provided by the present invention has nucleotide sequences as shown in SEQ ID NOs: 1 and 2.

[0006] This invention establishes a gene library of glycosyltransferase family from *Siraitia grosvenorii* by integrating techniques and methods from functional genomics, transcriptomics, metabolomics, and bioinformatics. Through sequence alignment, conserved domain analysis, and phylogenetic tree analysis, the gene functions of the glycosyltransferase gene resource library are predicted and identified. For the first time, two new glycosyltransferase genes were discovered in the *Siraitia grosvenorii* genome, named UGT153033 and UGT30033, corresponding to the nucleotide sequences shown in SEQ ID NOs: 1 and 2, respectively.

[0007] Furthermore, this invention also provides a glycosyltransferase encoded by the aforementioned glycosyltransferase gene, the amino acid sequence of which is shown in SEQ ID NOs: 3 and 4, wherein:

[0008] (a) The amino acid sequence of SEQ ID NO: 3 is encoded by the nucleotide sequence of SEQ ID NO: 1;

[0009] (b) The amino acid sequence of SEQ ID NO:4 is encoded by the nucleotide sequence of SEQ ID NO:2.

[0010] In addition, the present invention also provides mutants of the above-mentioned glycosyltransferase, specifically including the following:

[0011] (c) The amino acid sequence corresponds to SEQ ID NO: 4, and there is a mutation at one or more sites including the 33rd, 181st, 194th, 197th, 199th, 261st, 283rd, 308th, and 443rd sites;

[0012] (d) A protein derived from (c) that is formed by substitution, deletion or addition of one or more amino acid residues based on the amino acid series of protein (c), and has the function of protein (c), but the amino acids corresponding to positions 33, 181, 194, 197, 199, 261, 283, 308 and 443 of the sequence of SEQ ID NO: 4 are the same as the amino acids after mutation at the corresponding positions of protein (c);

[0013] (e) is a protein derived from (c) that has more than 80% homology to the amino acid sequence of (c) and has the function of (c) protein, but the amino acids at positions 33, 181, 194, 197, 199, 261, 283, 308, and 443 of the sequence corresponding to SEQ ID NO: 4 are the same as the amino acids after mutation at the corresponding positions in the (c) protein.

[0014] (f) A protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to both ends of any of the proteins described in (c) to (e).

[0015] Specifically, the glycosyltransferase mutant starts from the amino acid sequence of SEQ ID NO:4, with the 33rd position mutated to A, the 181st position mutated to D, the 194th position mutated to G, the 197th position mutated to T, the 199th position mutated to A, the 261st position mutated to K, the 283rd position mutated to M, the 308th position mutated to S, and the 443rd position mutated to E.

[0016] Meanwhile, the present invention also provides a nuclear construct or expression vector containing the above-mentioned glycosyltransferase gene or expressing the above-mentioned glycosyltransferase and its mutants.

[0017] In addition, the present invention also provides a host cell containing the above-mentioned nucleic acid construct or expression vector.

[0018] Meanwhile, the present invention also provides the application of the above-mentioned glycosyltransferase, which can be used to prepare mogroside and its analogues through glycosyl catalytic reactions.

[0019] Meanwhile, the present invention also provides the application of the above-mentioned host cells, which can be used to prepare glycosyltransferases for glycosyl catalytic reactions, or to directly prepare mogrosides and their analogues.

[0020] Specifically, the glycosyltransferases or host cells mentioned above involve glycosyl catalytic reactions including:

[0021] (a) Glycosyl-catalyzed reaction as shown in the following reaction formula:

[0022]

[0023] Wherein, R1, R2, and R3 are H or monosaccharide glycosyl or polysaccharide glycosyl; the glycosyltransferase has the amino acid sequence shown in SEQ ID NO: 3.

[0024] The substrates R1 and R2 of formula (I) were substituted to form compounds of formula (II), as shown in Table 1.

[0025] Table 1. Production of mogrosides catalyzed by glycosyltransferase UGT153033

[0026]

[0027] (b) Glycosyl-catalyzed reactions as follows:

[0028]

[0029] Wherein, R1, R2, and R4 are H or monosaccharide glycosyl or polysaccharide glycosyl; the glycosyltransferase has the amino acid sequence shown in SEQ ID NO: 4.

[0030] The substitution of R1 and R2 of substrate (III) yields compounds of formula (IV), as shown in Table 2.

[0031] Table 2. Production of mogrosides catalyzed by glycosyltransferase UGT30033

[0032]

[0033] (c) Glycosyl-catalyzed reactions with the following reaction formula:

[0034]

[0035] Wherein: R1, R2, R3, and R4 are monosaccharide glycosyl groups or polysaccharide glycosyl groups, and R5 is H, O, or OH; the glycosyltransferase includes an amino acid sequence as shown in SEQ ID NOs:5, 6, 7, 8, 9, 10, and 11.

[0036] The substitution of R1 and R2 of substrate (V) yields compounds of formula (VI), as shown in Table 3.

[0037] Table 3. Production of mogrosides catalyzed by glycosyltransferase mutants.

[0038]

[0039] The beneficial effects of this invention are as follows:

[0040] 1. The glycosyltransferase gene of the present invention makes up for the deficiencies in the prior art, which is that there are few known functional genes involved in the biosynthesis of mogrosides, especially glycosyltransferase genes that can catalyze the extension of sugar chains, and that the molecular synthesis mechanism of most mogrosides has not been fully elucidated, thus providing a new gene for the synthesis of mogrosides.

[0041] 2. The glycosyltransferase produced by the gene expression of the present invention can realize in vitro glycosylation reaction and catalyze the generation of various mogrosides, thereby increasing the synthesis pathway and yield of mogrosides.

[0042] 3. The glycosyltransferase identified in this invention can specifically recognize the C3-OH, C3-O-Glc and C24-O-Glc sites of mogroside, thereby achieving mogroside glycan chain elongation. Attached Figure Description

[0043] Figure 1 HPLC and MS chromatograms of the glycosyltransferase UGT30033 catalyzing the production of mogroside IIe using mogroside Ia1 as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

[0044] Figure 2 HPLC and MS chromatograms of the glycosyltransferase UGT30033 catalyzing the conversion of mogroside IIe to mogroside III using mogroside IIe as a glycosyl acceptor and UDP-glucose as a glycosyl donor.

[0045] Figure 3 The glycosyltransferase mutant UGT300331 uses mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # -3 # HPLC identification chromatogram of the catalytic formation of mogroside III.

[0046] Figure 4 The glycosyltransferase mutant UGT30033 was developed using mogroside Ia1 as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 4 # HPLC identification chromatogram of the catalytic formation of mogroside IIA1.

[0047] Figure 5 The glycosyltransferase mutant UGT300331 uses mogroside IIa as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 4 # HPLC identification chromatogram of the catalytic formation of mogroside IIIA1.

[0048] Figure 6 The glycosyltransferase mutant UGT300332 uses mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 3 # HPLC identification chromatogram of the catalytic formation of mogroside III.

[0049] Figure 7 The glycosyltransferase mutant UGT30033 uses mogroside IIIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 5 # HPLC identification chromatogram of its catalytic formation into sermonoside I.

[0050] Figure 8 The glycosyltransferase mutant UGT30033 uses mogroside IVe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 5 # HPLC identification chromatogram of the catalytic formation of mogroside V.

[0051] Figure 9 The glycosyltransferase mutant UGT30033 uses 11-O-mogroside IIa as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 6 # HPLC identification chromatogram of the catalytic formation of 11-O-mogroside IIIA1.

[0052] Figure 10The glycosyltransferase mutant UGT30033 uses 11-O-mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 6 # HPLC identification chromatogram of the catalytic formation of 11-O-mogroside III.

[0053] Figure 11 The glycosyltransferase mutant UGT30033 uses 11-O-mogroside IIIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor. # and 6 # HPLC identification chromatogram of the catalytic formation of 11-O-siamonoside I.

[0054] Figure 12 LC-QQQ-MS quantitative analysis of immature monk fruit extract catalyzed by glycosyltransferase mutants UGT30033 1#, 2#, 4#, 5#, and 7#. Detailed Implementation

[0055] The present invention will be further described below with reference to the accompanying drawings. In the embodiments, unless otherwise specified, the technical means used are all conventional technical means in the art.

[0056] I. Obtaining glycosyltransferase genes UGT153033 and UGT30033

[0057] Example 1

[0058] (1) Using HMMER3.1, the published whole genome data of Luo Han Guo were annotated, and 138 glycosyltransferases were obtained from 34,369 proteins in the published Luo Han Guo genome.

[0059] (2) Combined with genomic data, the transcriptome differential expression analysis, amino acid sequence alignment, conserved domain and phylogenetic tree analysis were performed on samples of fruit, stem and leaf tissues of Luo Han Guo at different stages, and the function of the genes in the above glycosyltransferase family gene library was predicted.

[0060] (3) Select glycosyltransferases with high transcriptional expression levels and close homology (over 85%) with reported functional genes for functional verification;

[0061] (4) Finally, two new glycosyltransferase genes, UGT153033 (nucleotide sequence as shown in SEQ ID NO: 1) and UGT30033 (nucleotide sequence as shown in SEQ ID NO: 2), were discovered in the Luo Han Guo genome.

[0062] II. Construction of Recombinant Plasmids and Mutant Libraries for Glycosyltransferases

[0063] Example 2

[0064] (I) Extraction of RNA from Monk Fruit

[0065] (1) Take out fresh monk fruit samples stored for 15 days from the -80℃ freezer and place them in liquid nitrogen to keep the samples in an ultra-low temperature state; at the same time, pre-cool the centrifuge;

[0066] (2) Pre-cool the mortar and other containers with liquid nitrogen, remove the monk fruit sample from the liquid nitrogen, remove the foil wrapping the surface, and quickly cut the fruit into small pieces on a sterile plate using a disposable medical surgical blade and scalpel handle. Then transfer the pieces to the mortar, add liquid nitrogen and grind for a period of time until the sample is pulverized into a fine green powder.

[0067] (3) Add 100 mg of the ground powder to a centrifuge tube, take 1 mL of Trizol reagent to resuspend the powder and mix well, and let stand at room temperature for 10 min.

[0068] (4) Centrifuge at 4℃ and 12000r / min for 10min;

[0069] (5) Transfer the supernatant obtained after centrifugation into a new centrifuge tube, add 200 μL chloroform, 35 μL 3 mol / L sodium acetate, 15 μL β-mercaptoethanol, and 10 μL 1% polyvinylpyrrolidone (PVP), mix thoroughly, and place on ice for 15 min.

[0070] (6) Centrifuge at 4℃ and 12000r / min for 10min;

[0071] (7) Transfer the supernatant obtained after centrifugation into a new centrifuge tube, add an equal volume of isopropanol and 200 μL of 3 mol / L sodium acetate, and precipitate at -20℃ for 1 h;

[0072] (8) Centrifuge at 4℃ and 12000r / min for 10min;

[0073] (9) Discard the supernatant obtained by centrifugation, and add 1 mL of pre-cooled 75% ethanol to wash the precipitate;

[0074] (10) Repeat step (9);

[0075] (11) Centrifuge at 4℃ and 12000r / min for 10min;

[0076] (12) Discard the supernatant obtained by centrifugation and vacuum dry for 2 min to reduce ethanol residue;

[0077] (13) Add 30 μL of RNase-free water and dissolve at room temperature for 5 min to obtain the monk fruit RNA extract. Store at -80℃ for later use. Take 2 μL of RNA for agarose gel electrophoresis analysis.

[0078] (II) Construction of recombinant plasmids

[0079] (1) The extracted monk fruit RNA was used as a template for reverse transcription to obtain a cDNA template; the cDNA was used as a template for PCR amplification with primers R-30033-F / R and R-153033-F / R (see Table 4) to obtain an amplification product of 1.4-1.5kb.

[0080] Table 4 Primer sequence list

[0081] Primers Sequence (5'→3') 30033-F AGCTCCGTCGACAAGCTTGGATGGATGCCCAGCAAG 30033-R TGGTGGTGGTGGTGCTCGAGTTAAATTGAACATGGAGCCTTTTTGCGC 153033-F GCTCCGTCGACAAGCTTGGATGGTGCAAC 153033-R TGGTGGTGGTGGTGCTCGAGTTAAAATTTATATGGTTTC

[0082] (2) The PCR products were recovered using agarose gel to obtain the glycosyltransferase genes UGT153033 and UGT30033;

[0083] (3) The above glycosyltransferase gene was cloned into the pET32a plasmid to obtain the recombinant plasmids pET32a-UGT153033 and pET32a-UGT30033.

[0084] Example 3

[0085] Using the PCR product purified from agarose gel in Example 2 as a template, PCR amplification was performed using the Agilent GeneMorph II random mutagenesis kit. The obtained PCR product was purified, homologous recombination was performed, pET32a was inserted, and finally transformed into E. coli DH5α to obtain a mutant library. The obtained mutant corresponds to the amino acid sequence SEQ ID NO: 4, and has one or more mutations at positions 33, 181, 194, 197, 199, 261, 283, 308, and 443. Specifically, position 33 is mutated to A, position 181 to D, position 194 to G, position 197 to T, position 199 to A, position 261 to K, position 283 to M, position 308 to S, and position 443 to E.

[0086] The obtained mutants also include proteins with the same biological function or activity as the mutants described above, such as fragments, derivatives, or analogs. These can be proteins derived from the mutants, formed by substituting, deleting, or adding one or more amino acid residues based on the amino acid sequence of the mutant protein described above, and possessing the function of the mutant protein described above, but with amino acids at positions 33, 181, 194, 197, 199, 261, 283, 308, and 443 corresponding to the corresponding positions of the mutant protein described above being identical to the amino acids after mutation; or proteins derived from the mutants described above that have more than 80% homology to the amino acid sequence of the mutant protein described above and possess the function of the mutant protein described above, but with amino acids at positions 33, 181, 194, 197, 199, 261, 283, 308, and 443 corresponding to the corresponding positions of the mutant protein described above being identical to the amino acids after mutation; or proteins formed by adding tag sequences, signal sequences, or secretion signal sequences to both ends of any of the mutant proteins described above.

[0087] Sequencing and identification were performed on over 1000 single clones from the aforementioned mutant library, and seven glycosyltransferase mutants were obtained and named UGT30033 1. # -7 # The specific amino acid sequence of the mutant is as follows:

[0088] The glycosyltransferase mutant UGT30033 1 # The amino acid sequence is shown in SEQ ID NO:5;

[0089] The glycosyltransferase mutant UGT30033 2 # The amino acid sequence is shown in SEQ ID NO:6;

[0090] The glycosyltransferase mutant UGT30033 3 # The amino acid sequence is shown in SEQ ID NO:7;

[0091] The glycosyltransferase mutant UGT30033 4 # The amino acid sequence is shown in SEQ ID NO:8;

[0092] The glycosyltransferase mutant UGT30033 5 # The amino acid sequence is shown in SEQ ID NO:9;

[0093] The glycosyltransferase mutant UGT30033 6 # The amino acid sequence is shown in SEQ ID NO:10;

[0094] The glycosyltransferase mutant UGT30033 7 # The amino acid sequence is shown in SEQ ID NO:11.

[0095] III. Expression of glycosyltransferase genes UGT153033, UGT30033 and their mutants in Escherichia coli

[0096] Example 4

[0097] (I) Preparation of competent Escherichia coli cells

[0098] (1) Take out the strain stored in the -80℃ freezer, streak it on an LB solid plate, and incubate it in a 37℃ incubator for 12h;

[0099] (2) Pick a single clone and place it in 5 mL of LB liquid medium and incubate it in a shaker at 37°C for 12 h;

[0100] (3) Add 3% bacterial solution to 50 mL LB liquid medium and incubate until OD600 is 0.4-0.6;

[0101] (4) Place the bacterial culture on ice to cool for half an hour, and pre-cool the centrifuge at the same time;

[0102] (5) Centrifuge at 4℃ and 3000r / min for 10min, and discard the supernatant;

[0103] (6) Add 10 mL of CaCl2-MgCl2 mixed reagent and gently blow to mix the bacterial cells;

[0104] (7) Centrifuge at 4℃ and 3000r / min for 5min, and discard the supernatant;

[0105] (8) Add 2 mL of CaCl2-glycerol mixed reagent and gently mix the bacterial cells;

[0106] (9) Dispense 100 μL into each of the pre-cooled 1.5 mL centrifuge tubes;

[0107] (10) Store at -80℃ for later use.

[0108] (II) Expression of glycosyltransferases in Escherichia coli

[0109] (1) PET32a-UGT153033, PET32a-UGT30033, and PET32a-UGT30033 1 # -7 # The recombinant plasmid was transformed into competent Escherichia coli Rosetta(DE3) cells by heat shock, with the empty vector pET32a serving as a negative control.

[0110] (2) Add to the transformation system, resuspend the bacterial cells, and incubate on ice for 30 min;

[0111] (3) After heat shock in a 42℃ water bath for 90-95 seconds, immediately place on ice and incubate on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium and incubate on a shaker at 37℃ and 200 rpm for 45 minutes. Take 200 μL of bacterial culture and spread it on LB solid medium containing the corresponding antibiotic. Incubate in a constant temperature incubator at 37℃ for 12-16 hours. Select single clones for sequencing verification.

[0112] (4) Pick positive expression colonies and place them in 5 mL of LB liquid medium containing the corresponding antibiotic. Activate and culture at 37℃ and 200 rpm for 12 h. Transfer 1% bacterial culture to 50 mL of LB liquid medium containing the corresponding antibiotic for expansion culture. When the OD600 is 0.6-0.8, add IPTG solution to a final concentration of 0.1 mM. Induce at 16℃ and 150 rpm for 16 h.

[0113] (5) After induction, the bacterial cells were collected by centrifugation at 4°C and 6000 r / min for 15 min. The bacterial cell pellet was washed with sterile water and collected by centrifugation at 4°C and 6000 r / min for 15 min. This process was repeated twice. 3 mL of pre-cooled lysis buffer was taken and the bacterial cell pellet was resuspended on ice. The lysis buffer containing the bacterial cells was placed on an ice-water mixture. The cell lysis conditions were 30% energy, 1 second sonication followed by 2 seconds of pause, and 5 min of sonication. The solution after cell lysis was centrifuged at 4°C and 12000 r / min for 15 min. The cell lysis buffer was placed on ice for later use. The supernatant of the cell lysis buffer was used as crude enzyme solution for subsequent enzyme catalytic reaction experiments.

[0114] IV. In vitro glycosylation reaction and product detection

[0115] Example 5

[0116] The cell lysates of recombinant Escherichia coli Rosetta-pET32a-UGT153033 and Rosetta-pET32a-UGT30033 obtained in Example 4 were used as crude enzyme solutions for glycosylation reactions, and the cell lysates of recombinant Escherichia coli Rosetta-pET32a containing the empty vector were used as negative controls.

[0117] The glycosylation reaction system consisted of: 50 mM MgCl2, 50 mM UDP-glucose, 1 M Tris-HCl (pH = 7.5), 10 mg / mL saponin substrate, and an appropriate amount of crude enzyme solution.

[0118] The in vitro glycosylation reaction steps are as follows:

[0119] (1) After mixing the reaction system, react it in a water bath at 30°C for 12 hours, and then add an equal volume of n-butanol to terminate the reaction.

[0120] (2) After the n-butanol evaporates to dryness, the sample is dissolved in methanol, filtered through a 0.22μm filter, and detected by HPLC.

[0121] HPLC detection conditions: An Agilent Poroshell 120EC-C18 column (4μm, 4.6mm × 250mm) was used at a column temperature of 30℃ and a flow rate of 1.0mL / min. ELSD dual detector was employed, with an injection volume of 10μL. Binary gradient elution was used, with mobile phase A (water) and mobile phase B (acetonitrile). Elution program: 0-55 min, 22.5%-62.5% B; 55-58 min, 62.5% B; 58-60 min, 62.5%-22.5% B.

[0122] In this embodiment, the supernatant of cell lysates from recombinant Escherichia coli Rosetta-pET32a-UGT153033 and Rosetta-pET32a-UGT30033 was used as the crude enzyme solution for glycosylation. The specific reaction is as follows:

[0123] (1) Using mogroside Ia1 as a glycosyl acceptor and UDP-glucose as a glycosyl donor, UGT153033 catalyzed the formation of mogroside IIe; the HPLC and MS results of the product mogroside IIe are as follows: Figure 1 As shown. The reaction formula is as follows:

[0124]

[0125] In the formula, R1 is H, and R2 and R3 are Glc.

[0126] (2) Using mogroside IIe as a glycosyl acceptor and UDP-glucose as a glycosyl donor, UGT30033 catalyzed the synthesis of mogroside III; the HPLC and MS results of the product mogroside III are as follows: Figure 2 As shown. The reaction formula is as follows:

[0127]

[0128] In the formula, R1 and R2 are Glc, and R4 is Glc(6-1)Glc.

[0129] Example 6

[0130] Using the recombinant Escherichia coli Rosseta-pET32a-UGT30033 from Example 4 # -3 #The cell lysate supernatant of each mutant was used as crude enzyme solution for the transglycosylation reaction, and the cell lysate of recombinant E. coli UGT30033 was used as a negative control. The glycosylation reaction system and in vitro glycosylation reaction steps were as described in Example 5. The specific reaction is as follows: using mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the mutant catalyzes the formation of mogroside III. The HPLC detection results are as follows. Figure 3 As shown, a new substance was detected in the reaction systems of the crude enzyme solutions of the three UGT30033 mutants. This substance exhibited the same retention time as mogroside III, the product of UGT30033 and mogroside IIe, indicating that mogroside IIe was converted to mogroside III under the catalysis of the crude enzyme solution of the UGT30033 mutant. The reaction formula is as follows:

[0131]

[0132] In the formula, R1, R2, R3, and R4 are shown in Table 5 below, and R5 is H, O, or OH.

[0133] Example 7

[0134] Using the recombinant Escherichia coli Rosseta-pET32a-UGT30033 from Example 4 # -7 # The cell lysate supernatant of each mutant was used as crude enzyme solution for transglycosylation reaction. The reaction time was 2 h to 12 h. The glycosylation reaction system and in vitro glycosylation reaction steps were the same as in Example 5. The specific reaction is as follows:

[0135] (1) Using mogroside Ia1 as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT300331 # and 4 # Catalyzing its formation to mogroside IIA1, the HPLC identification results of the product are as follows: Figure 4 As shown.

[0136] (2) Using mogroside IIa as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT300331 # and 4 # Catalyzing its formation to mogroside IIIA1, the HPLC identification results of the product are as follows: Figure 5 As shown.

[0137] (3) Using mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT300332 # and 3 # Catalyzing its formation to mogroside III, the HPLC identification results of the product are as follows: Figure 6 As shown.

[0138] (4) Using mogroside IIIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT300331 # and 5 # Catalyzing its formation to sermonin I, the HPLC identification results of the product are as follows: Figure 7 As shown.

[0139] (5) Using mogroside IVe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT300331 # and 5 # Catalyzing its formation to mogroside V, the HPLC identification results of the product are as follows: Figure 8 As shown.

[0140] (6) Using 11-O-mogroside IIa as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT30033 1 # and 6 # Catalyzing its formation to 11-O-mogroside IIIA1, the HPLC identification results of the product are as follows: Figure 9 As shown.

[0141] (7) Using 11-O-mogroside IIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT30033 1 # and 6 # Catalyzing its formation to 11-O-mogroside III, the HPLC identification results of the product are as follows: Figure 10 As shown.

[0142] (8) Using 11-O-mogroside IIIe as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase mutant UGT30033 1 # and 6 # Catalyzing its formation to 11-O-siamanin I, the HPLC identification results of the product are as follows: Figure 11 As shown.

[0143] The reaction formulas for reactions (1) to (8) in this embodiment are shown in Example 6. R1, R2, R3, and R4 are shown in Table 5 below, and R5 is H, O, or OH.

[0144] Table 5 Glycosyltransferase UGT30033 1 # -7 # Various mutants catalyze the synthesis of mogrosides

[0145]

[0146] Example 8

[0147] Fresh, unripe monk fruit samples were removed from a -80°C freezer and dehydrated in a vacuum freeze dryer for 72 hours. Appropriate amounts of sample and water were weighed at a 1:100 material-to-liquid ratio, mixed, and vortexed. The mixture was then placed in an ultrasonic water bath for extraction, sonicated at 40 kHz for 1 hour at room temperature. The supernatant was collected by centrifugation for subsequent catalysis and testing.

[0148] UGT30033 mutant 1 after induction expression # 2 # 4 # 5 # 7 # The contents of various mogrosides in monk fruit extracts at different growth stages were quantitatively analyzed by LC-QQQ-MS before and after the reaction. The results are as follows: Figure 12 As shown in the figure, MG1 represents mogroside monoglycosides (IA1, IE1); MG2 represents mogroside disaccharides (IIA1, IIA2, IIe, 11-O-IIA); MG3 represents mogroside triglycosides (IIIA1, III, IIIe, 11-O-IIIA1, 11-O-III, 11-O-IIIe); MG4 represents mogroside tetraglycosides (IVa, IVe, SMG I, 11-O-SMMG I); and MG5 represents mogroside 5 glycosides (V and 11-OV).

[0149] The results showed that the extract from monk fruit aged 15 days, as determined by UGT30033 1 # Catalysis reduced the disaccharide content in the original extract from 99% to 52%, while increasing the tetrasaccharide content by 44%. The extract from monk fruit aged 30 days, after processing with UGT30033 2... # Catalysis reduced the disaccharide content of the original extract from 100% to 43%, while adding 14% trisaccharides and 43% tetrasaccharides; the monk fruit extract from fruit aged 45 days, after processing with UGT30033 4 # Catalysis increased the content of mogroside pentasaccharides from 60% to 63%; the extract from mogroside fruit aged 60 days, after processing with UGT30033 5 # Catalyzed by [a specific catalyst], the content of mogroside pentasaccharides increased from 73% to 78%; mogroside extract from fruit aged 90 days, after processing with UGT30033 7 [a specific catalyst], [further details needed]. # Catalysis by the mutant increased the content of mogrosides from 88% to 92%. This indicates that the UGT30033 mutant can remove or reduce the bitter low-sugar mogrosides in mogroside extract and increase the content of sweet high-sugar mogrosides in mogroside extract.

[0150] The above embodiments are merely exemplary embodiments of the present invention and are not intended to limit the present invention. The scope of protection of the present invention is defined by the claims. Those skilled in the art can make various modifications or equivalent substitutions to the present invention within its spirit and scope of protection, and such modifications or equivalent substitutions should also be considered to fall within the scope of protection of the present invention.

Claims

1. A set of glycosyltransferase genes, characterized in that, The nucleotide sequence is shown as SEQ ID NOs: 1, 2.

2. A set of glycosyltransferases, characterized in that, It comprises: (a) an amino acid sequence shown as SEQ ID NO: 3, which is encoded by a glycosyltransferase gene with a nucleotide sequence of SEQ ID NO: 1; (b) an amino acid sequence shown as SEQ ID NO: 4, which is encoded by a glycosyltransferase gene with a nucleotide sequence of SEQ ID NO: 2; (c) an amino acid sequence corresponding to SEQ ID NO: 4, which has one or more mutations at positions 33, 181, 194, 197, 199, 261, 283, 308, 443; (d) a protein derived from (c) based on the amino acid sequence of the protein of (c) with one or more substitutions, deletions or additions of amino acid residues, and having the function of the protein of (c), but the amino acids at positions 33, 181, 194, 197, 199, 261, 283, 308, 443 of the sequence of SEQ ID NO: 4 are the same as those of the corresponding positions of the protein of (c) after mutation; (e) a protein derived from (c) with more than 80% homology to the amino acid sequence of the protein of (c) and having the function of the protein of (c), but the amino acids at positions 33, 181, 194, 197, 199, 261, 283, 308, 443 of the sequence of SEQ ID NO: 4 are the same as those of the corresponding positions of the protein of (c) after mutation; (f) a protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to both ends of any of the proteins of (c)-(e).

3. The glycosyltransferase of claim 2, wherein The positions 33, 181, 194, 197, 199, 261, 283, 308, 443 are mutated to A, D, G, T, A, K, M, S, E, respectively.

4. The glycosyltransferase of claim 3, wherein (c) The glycosyltransferase mutant comprises an amino acid sequence shown as SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11.

5. A nucleic acid construct or expression vector comprising, It contains the glycosyltransferase gene of claim 1, or expresses the glycosyltransferase of any one of claims 2, 3 or 4.

6. A host cell, characterized in that: It contains the nucleic acid construct or expression vector of claim 5.

7. Use of a glycosyltransferase according to any one of claims 2 to 4, characterized in that, Preparation of mogrosides and analogues thereof by glycosyl catalytic reaction.

8. Use of a host cell according to claim 6, characterized in that Glycosyltransferase for preparing glycosyl catalytic reaction, or directly preparing mogrosides and analogues thereof.

9. Use according to any one of claims 7 or 8, characterized in that, The glycosyl catalytic reaction comprises: (a) a glycosyl catalytic reaction as shown in the following reaction formula: wherein R1, R2, R3 are H or monosaccharide or polysaccharide; the glycosyltransferase has an amino acid sequence shown as SEQ ID NO: 3; (b) a glycosyl catalytic reaction as shown in the following reaction formula: wherein R1, R2, R4 are H or monosaccharide or polysaccharide; the glycosyltransferase has an amino acid sequence shown as SEQ ID NO: 4; (c) a glycosyl catalytic reaction as shown in the following reaction formula: Wherein: R1, R2, R3, R4 are monosaccharide glycosyl or polysaccharide glycosyl, R5 is H or O or OH; the glycosyltransferase comprises an amino acid sequence as shown in SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11.

10. Use according to claim 9, characterized in that, The substrate of the glycosyl catalytic reaction is a compound of formula (I), (III) or (V), and the corresponding product is a compound of formula (II), (IV) or (VI), specifically including the following: The compound of formula (I) is mogroside Ia1, and the compound of formula (II) is mogroside IIe; Or, the compound of formula (III) is mogroside IIe, and the compound of formula (VI) is mogroside III; Or, the compound of formula (V) is mogroside Ia1, and the compound of formula (VI) is mogroside IIa1; Or, the compound of formula (V) is mogroside IIe, and the compound of formula (VI) is mogroside III; Or, the compound of formula (V) is mogroside IIa, and the compound of formula (VI) is mogroside IIIa1; Or, the compound of formula (V) is mogroside IIIe, and the compound of formula (VI) is sianoside 1; Or, the compound of formula (V) is mogroside III, and the compound of formula (VI) is mogroside IVa; Or, the compound of formula (V) is mogroside IVe, and the compound of formula (VI) is mogroside V; Or, the compound of formula (V) is 11-O-mogroside IIa, and the compound of formula (VI) is 11-O-mogroside IIIa1; Or, the compound of formula (V) is 11-O-mogroside IIe, and the compound of formula (VI) is 11-O-mogroside III; Or, the compound of formula (V) is 11-O-mogroside IIIe, and the compound of formula (VI) is 11-O-sianoside 1.